Dembski versus Europe

Well, Dembski can cry all he wants, but as least he as Ann Coulter to snuggle up to.

Or Sal? ;-0

Or Sal?

Dembski wrote: The Council of Europe may justly be renamed as "The European Council for the Advancement of Atheism."

I'm waiting for Dembski VS. MechaGodzilla

much more entertaining.

I guess WD experienced quite to many narcissistic mortifications since the Dover trial. As the self-proclaimed pope of the ID movement he has to fight on too many fronts simultaneously:
Surrounded by a corona of bootlickers lacking any sign of intellectuality and scientific knowledge he fights with his back to the wall. The DI gang doesn't seam to care too much about his opinions anymore and besides he has to be aware of some antipope who may show up in his own ranks. UD's current appearance is like the Fuehrerbunker in April 45. WD is commanding fantom armies that don't exist and is hoping for something mysterious to happen due to the "Macht der Vorsehung".

The decline of aggressive, politically motivated pseudoscience movements appears to be exponential.

Such movements pop up and, as long as the politics that motivate them are perceived as compatible with whatever authoritarian strain is most dominant in their time and place, enjoy a period of positive publicity and fruitful funding. Some of them, like Lysenkoism and eugenicism, succeed in being taught as science at government expense, or used as the rationale for legislation.

In this sense, ID did better than most on the funding side, but not very well on the side of gaining political power.

Eventually, because they are not compatible with evidence, the tide turns against them. Often, as is the case with ID, they also make contradictory claims. It's comical to note that even a couple of days ago they boasted about some "non-religious" musician goofball embracing ID, and today they're pushing the false dichotomy of "ID versus atheism" again. It's not religious, but challenging it makes you against "religion".

Typically there is a rapid drop-off in prestige and popularity once they are adequately challenged in the public sphere.

However, of course, they can't be entirely eliminated. They drop down to what seems like a low steady state, but is actually a state of decline, but at a slow rate of decline. ID seems to have hit this stage.

Behe and Dembski will continue to crank out repetitive books as long as they live, possibly at a diminishing pace, as will other members of the DI gang. Isolated crackpots will continue to stumble on fly-specked books and obscure web sites and believe that they have found "suppressed ancient knowledge". My guess is that it will be around 50-75 years before there really is no fragment or clearly identifiable descendant of the DI left.

But the whole thing will be increasingly irrelevant.

Behe and Dembski will continue to crank out repetitive books as long as they live, possibly at a diminishing pace, as will other members of the DI gang. Isolated crackpots will continue to stumble on fly-specked books and obscure web sites and believe that they have found "suppressed ancient knowledge". My guess is that it will be around 50-75 years before there really is no fragment or clearly identifiable descendant of the DI left.

"Intelligent design" is not science and shouldn't belong taught in school („Intelligent Design" sei keine Naturwissenschaft und gehöre nicht in den Schulunterricht)

criticizes the [Discovery] institute's current activities towards implementing Intelligent design in school science curricula by legal means.

Did Dembski ever claim that he was going to write 5 books on the subject?

The End of Christianity

The End of Materialism

My guess is that it will be around 50-75 years before there really is no fragment or clearly identifiable descendant of the DI left.

Some of the more educated, and self aware of the lunatic fringers such as creationists probably know it is all nonsense.

But Milton made a great point. "It is better to rule in hell than serve in heaven."

For the leadership it is much easier to push pseudoscience than actually contribute anything to further human progress and well being. We all have to eat and pay bills and how hard is it to pander to the willingly ignorant? It's the difference beween writing for the World Weekly News and The New York Times.

12. The war on the theory of evolution and on its proponents most often originates in forms of religious extremism which are closely allied to extreme right-wing political movements. The creationist movements possess real political power. The fact of the matter, and this has been exposed on several occasions, is that the advocates of strict creationism are out to replace democracy by theocracy.

— Council of Europe

Twenty percent (20%) of the US population still believes the sun goes around the earth. It has been 400 years since Copernicus. The same percentage do not know why a year has 12 months.

— raven

OK, I'll bite. Why does a year have 12 months?

Should read...

BTW, does anyone know if that is why "13" is considered an evil number?

(please excuse me, I R A Eenginear)

The praise for Jones has always amused me; all the talk of his brillinat decision and the like. Of course, the talk about plagiarism was stupid, a Judge can certainly use the contibutions of the opposing parties, but the point is that he did not write the decision. The plaintiffs did. Any law clerk could do it, and probably did

— Two L

A slip of the keyboard, there: the term "religious extremism," not "religious terrorism," is used in the Council of Europe document. This is the context:

raven wrote: Twenty percent (20%) of the US population still believes the sun goes around the earth. It has been 400 years since Copernicus. The same percentage do not know why a year has 12 months.

The praise for Jones has always amused me; all the talk of his brillinat decision and the like. Of course, the talk about plagiarism was stupid, a Judge can certainly use the contibutions of the opposing parties, but the point is that he did not write the decision. The plaintiffs did. Any law clerk could do it, and probably did

"Twenty percent (20%) of the US population still believes the sun goes around the earth. It has been 400 years since Copernicus. The same percentage do not know why a year has 12 months."

Since I still have some ounce of hope for humanity, I don't want to believe this. Where did the statistic come from?

Since I still have some ounce of hope for humanity, I don't want to believe this. Where did the statistic come from?

Some of the more educated, and self aware of the lunatic fringers such as creationists probably know it is all nonsense. But Milton made a great point. "It is better to rule in hell than serve in heaven."

"To believe in a God who acts in the world (aka theism) henceforward constitutes "religious extremism.""

Yes, since when is it extreme fundamentalism just to believe in god?

Those who oppose ID equate it with creationism because creationism is easy to disprove. People who believe the bible is literally true are, almost always, unsophisticated and uneducated. They have not a shred of evidence to back up their belief.

ID is not creationism. The ideas behind ID are unrelated to Christianity, or any particular religion. ID is just as compatible with Buddhism, deism, atheism, animism, theism, etc., as it is with Christianity.

Saying that a purely mechanistic process does not adequately explain evolution is a far cry from saying the ancient Israelites' god created the world in six days.

There may be fundamentalist literalist Christians who believe in ID. There are probably many more who have no idea what ID is.

There are Catholics who believe in ID, but most are probably not creationists. The Catholic church has endorsed evolution theory.

It is extremely uncommon for educated people to be bible literalists (creationists). And only educated people are aware of the subtleties of the NDE - IDE controversy.

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution.

Calling ID creationism is deliberately misleading.

raven --- 365 and one-quarter, approximately...

;-)

William E. Emba and Thought Provoker -

First of all, I'm sure the reference to 12 months was a typo and what was meant was the four seasons of temperate climates, which have a physical explanation.

I assume that TP is alluding to the fact that if we divided the solar year into 13 months of about 28 days each, we could allign them to lunar cycles, with a bit of fiddling with the details, but 12 months doesn't allow us to do that.

Anyway, lunar cycles aside, the number of months we divide the year into is arbitrary. We inherited the 12 month calender from the Romans, who once used a ten month calender, but switched to 12 at an early date in their history (not so early in human history). According to legend, it was the idea of Numa Pompilius.
http://en.wikipedia.org/wiki/Numa_Pompilius

Ancient societies used 12 a lot, presumably because it's easily subdivided into integers. The Romans may actually gotten the 12 month idea from any number of other ancient societies for all I know. That may be why 13 is sometimes considered unlucky, although then again, sometimes it's considered lucky.

The same percentage do not know why a year has 12 months.

BTW, does anyone know if that is why "13" is considered an evil number?

Eppure si muove...or does it? June 6th, 2007 Omar Just got an email reminder from the ICPSR data archive yesterday that the 2006 GSS data are out and ready to play with. Always curious to know what's happening with my favorite survey of the attitudes and behaviors of the American population I looked around the codebook to see what was new for 2006. Among the highlights, there is (1) a module designed to estimate global characteristics of the social networks of the American population using a cutting edge method based on asking people questions of the type: "How many people do you know...(named Jeff, in Prison, who can do a somersault, who eat hamburgers, etc. [see Zheng et al 2006] and see also a copy of the proposal of the GSS module designed to measure "network polarization" in the American population in order to see if it is related to "cultural polarization") and (2) a "science" module designed to measure the scientific knowledge of the American population. My guess is that (1) will produce the most fascinating and scientifically interesting results, and (2) will of course provide fodder for the constant complaints (and jokes) about the utter mental dullness of the population. A case in point is the following. The GSS folk actually made the mistake of asking the following question as part of their science module: Now, does the Earth go around the Sun, or does the Sun go around the Earth? Here we go. Now what follows is real social science data folks. No joking around: Earth around sun 73.6% Sun around earth 18.3% Don't Know 8.0% Refused 0.1% Yes. More than a fifth of the American population does not think (or are not quite sure) that they live in Copernicus' heliocentric solar system. Is this a glass half-full or glass half empty thing? Well, those glass half-full people might say, almost three-quarters of the population got the right answer. But the GSS questionnaire designers conspire against your carefree optimism half-glass full guy or gal. Among those who were up to date with seventeenth-century Galilean basic science, they actually dared to ask the follow-up question: How long does it take for the Earth to go around the Sun: one day, one month, or one year? One day 19.0% One month 1.1% One year 71.2% Other time period 0.1% Don't Know 8.5% Refused 0.1% Barring that guy who categorically refused to answer the question, we are again faced with the result that a full one-fifth of those in the American population who are aware that the earth revolves around the sun are in their turn unable to distinguish the earth's rotation around its axis from a full revolution around the sun. Poor Galileo; talk about reason to turn in your grave.

The ideas behind ID are unrelated to Christianity, or any particular religion. ID is just as compatible with Buddhism, deism, atheism, animism, theism, etc., as it is with Christianity.

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution. Calling ID creationism is deliberately misleading.

ID is creationism, as evidenced by the drafts of the Pandas textbook which show that ID can be defined simply by getting the textbook definition of creationism and substituting in 'intelligent agency' and so forth. But I think you know this.

ID is actually not fully compatible with all religions, as Richard B Hoppe showed. ID makes the assumption that only ONE designer is responsible. RBH showed that this is unreasonable and that multiple designers makes far more sense - and of course, this implies polytheism. Yet the ID community has made no effort to embrace Richard's theory, for which he has even suggested avenues of research (ID currently has none). Why do you suppose that is?

What I hate about ID people is that they are preying on good faith. It is polite to think the best of people and assume one isn't being deceived, but ID people have pushed it far too far. They've gone beyond the boundaries of good faith. Why should we believe they have any intention of honesty any more? It takes a lot of good faith just to assume that the same guys behind creationism really AREN'T pulling a scam when they come up with ID. We gave them that chance. We asked for the science they claimed they had. It didn't come. It currently does not exist. The pathetic attempts to justify ID that they have produced are useless, or riddled with flaws that even I can see (we can't identify the designer, yet we can predict junk dna? And we're supposed to let them get away with that? This is one of the cornerstones of their theory!)

ID an alternative to evolution? Don't make me laugh. It explains nothing about evolution. It explains nothing at all. That people are even still arguing about it is a testament to the spin ability of the DI, because ID is the most childish smoke... it's barely a sentence, let alone a science! 150 years of evolution is supposed to step aside to make way for some guys saying that biology looks designed, but we don't know how, why, when, who by? Why on earth are we still giving this playground nonsense any credit? It has no substance! If I asked to be allowed to build a skyscraper and told you that my experience in the field was a Lego kit, would you let me? You should if you take ID seriously. At least I can build things from Lego. ID can't even answer any questions.

"ID makes the assumption that only ONE designer is responsible. RBH showed that this is unreasonable and that multiple designers makes far more sense - and of course, this implies polytheism."

We happen to live in a monotheistic culture so some IDers may have implied that. I don't know. But there is nothing in ID theory about how many designers there might be. Nothing in ID pretends to answer questions that are theological and outside the realm of science.

And arguments about whether god is one or many seem very silly to me anyway. Certainly, if there is a god, it's capable of multiplying itself. Why would a god be subject to the same spatial and temporal restrictions as we are?

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution. Calling ID creationism is deliberately misleading.

— Realpc

"Had it not been for some ill-chosen words in an email, Dembski could have been leading the ID movement into the 21st Century." Please forgive my ignorance, but what were Dembski's "ill-chosen words"?

William Dembski Press Release by William Dembski October 17, 2000 The Michael Polanyi Center Peer Review Committee has now released its official report (http://pr.baylor.edu/pdf/001017polanyi.pdf) and the Baylor University administration has responded to the report (http://pr.baylor.edu/feat.fcgi?2000.10.17.polanyi). As director of the Center, I wish to offer the following comment: The report marks the triumph of intelligent design as a legitimate form of academic inquiry. This is a great day for academic freedom. I'm deeply grateful to President Sloan and Baylor University for making this possible, as well as to the peer review committee for its unqualified affirmation of my own work on intelligent design. The scope of the Center will be expanded to embrace a broader set of conceptual issues at the intersection of science and religion, and the Center will therefore receive a new name to reflect this expanded vision. My work on intelligent design will continue unabated. Dogmatic opponents of design who demanded the Center be shut down have met their Waterloo. Baylor University is to be commended for remaining strong in the face of intolerant assaults on freedom of thought and expression.

Some faculty members expressed "deep, genuine concern" after receiving an e-mail from the director of the Michael Polanyi Center a day after a report affirmed the center's legitimacy and credibility, according to the chairman of the Faculty Senate. A report was released Tuesday by a committee appointed to review the operation of the center. The committee was comprised of eight scholars from across the country and led by Dr. William F. Cooper. In response to that report, Dr. William Dembski issued the following statement: "The report marks the triumph of intelligent design as a legitimate form of academic inquiry. This is a great day for academic freedom. I'm deeply grateful to President Sloan and Baylor University for making this possible, as well as to the peer review committee for its unqualified affirmation of my own work on intelligent design. The scope of the Center will be expanded to embrace a broader set of conceptual issues at the intersection of science and religion, and the Center will therefore receive a new name to reflect this expanded vision. My work on intelligent design will continue unabated. Dogmatic opponents of design who demanded the Center be shut down have met their Waterloo. Baylor University is to be commended for remaining strong in the face of intolerant assaults on freedom of thought and expression." Chairman of the Faculty Senate, Dr. Jay Losey, said that "anyone can look at the review and also at Dembski's e-mail and make a personal judgment for themselves." "However, I will say there is deep, genuine concern on the part of Baylor faculty regarding some of the statements made in the e-mail," Losey said. "Deep, genuine concern." Attempts to reach Dembski at his office Wednesday were unsuccessful.

William Dembski was relieved of his duties as director of Baylor University's Michael Polanyi Center today. He will remain associate professor in conceptual foundations of science within the university's Institute for Faith and Learning. The action follows by two days the release of a peer review committee's report on the Polanyi Center that affirmed the academic work of the center while calling for the appointment of a faculty advisory committee and the dropping of the Polanyi name. "The theme of the report emphasized the need for the individuals associated with the center to work in a collegial manner with other members of the Baylor faculty," said Dr. Michael Beaty, director of the Institute for Faith and Learning, which houses the center. "Dr. Dembski's actions after the release of the report compromised his ability to serve as director." Dr. Bruce Gordon, associate director of the center, has been appointed interim director of the program. Gordon holds a Ph.D. in the history and philosophy of physics from Northwestern University, as well as degrees in mathematics, philosophy, theology and piano performance. He was recently a postdoctoral fellow of the Center for Philosophy of Religion at the University of Notre Dame, and is presently at work on a series of articles leading to a book on the metaphysical import of quantum statistics.

Baylor University President Robert Sloan has removed me as director of the Michael Polanyi Center despite his having personally solicited me to come to Baylor and establish the Center as a means of furthering work on intelligent design. Some Baylor faculty have exerted enormous pressure on Baylor to disassociate the university from me and my research. Earlier President Sloan had properly characterized these efforts as "intellectual McCarthyism." Because I released a press statement [see above] applauding the results of the peer review committee that passed upon and approved the academic soundness of my work, I am now being labeled as not "collegial" and the statement is said to have fatally compromised my ability to serve as Director. My press release allowed me publicly to state my full support for the results of the peer review committee report. Having made that statement, I then expected to proceed full steam ahead to implement the committee's recommendations by expanding the scope of the center while still focusing my own research on intelligent design -- just as the peer review committee recommended and President Sloan agreed. Instead, I was informed that my press release created a "firestorm" on campus. Shockingly, the administration formally asked me to retract my press release. I explained that the press release accurately conveyed how I perceived the outcome of the peer review committee and that for me to retract it would be tantamount to giving in to the censorship and vilification against me that had been a constant feature since I arrived on campus. I could not and would not betray all that I have worked for in my professional career. In the utmost of bad faith, the administration claimed my refusal to retract my press release constituted a lack of collegiality on my part and charged that this compromised my ability to serve as director, thereby providing the fig leaf of justification for my removal. Intellectual McCarthyism has, for the moment, prevailed at Baylor. The announcement of my removal from the Polanyi Center directorship states that I am to be kept on in my capacity as an Associate Professor in Baylor's Institute for Faith and Learning. I look forward in that capacity to continuing to work on intelligent design and its implications.

that was a nice trip down memory lane, Pim.

I had forgotten all about that stuff.

thanks

there is nothing in ID theory about how many designers there might be. Nothing in ID pretends to answer questions that are theological and outside the realm of science.

"Had it not been for some ill-chosen words in an email, Dembski could have been leading the ID movement into the 21st Century."

The Troll is quotemined thusly: But there is nothing in ID theory... Nothing in ID pretends to answer questions...

Saying that a purely mechanistic process does not adequately explain evolution is a far cry from saying the ancient Israelites' god created the world in six days.

ID is not creationism. The ideas behind ID are unrelated to Christianity, or any particular religion. ID is just as compatible with Buddhism, deism, atheism, animism, theism, etc., as it is with Christianity.

Calling ID creationism is deliberately misleading.

when it comes to stuff like ghosts, astrology, and the like, I've known many people who were highly educated and intelligent by any standards, by no means all of them American or Canadian, who claimed to believe in such stuff. The way I see it, such stuff isn't the equivalent of creationism, because it doesn't outright deny existing science.

ID is not creationism.

ID makes the assumption that only ONE designer is responsible. RBH showed that this is unreasonable and that multiple designers makes far more sense

"Poor Galileo; talk about reason to turn in your grave."

Ah, but is Galileo rotating about his grave or is his grave rotating about him?!!

"To believe in a God who acts in the world (aka theism) henceforward constitutes "religious extremism."" Yes, since when is it extreme fundamentalism just to believe in god?

— realpc

Those who oppose ID equate it with creationism because creationism is easy to disprove. People who believe the bible is literally true are, almost always, unsophisticated and uneducated. They have not a shred of evidence to back up their belief.

ID is not creationism.

The ideas behind ID are unrelated to Christianity, or any particular religion.

ID is just as compatible with Buddhism, deism, atheism, animism, theism, etc., as it is with Christianity.

Saying that a purely mechanistic process does not adequately explain evolution is a far cry from saying the ancient Israelites' god created the world in six days.

There may be fundamentalist literalist Christians who believe in ID. There are probably many more who have no idea what ID is.

There are Catholics who believe in ID, but most are probably not creationists.

The Catholic church has endorsed evolution theory.

It is extremely uncommon for educated people to be bible literalists (creationists).

And only educated people are aware of the subtleties of the NDE - IDE controversy.

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution.

Calling ID creationism is deliberately misleading.

Well, Dembski can cry all he wants, but as least he as Ann Coulter to snuggle up to.

Shudder! Could we be careful with the mental images we generate, please?

Well, Dembski can cry all he wants, but as least he as Ann Coulter to snuggle up to.

— Mike Elzinga

Mike Elzinga wrote: Well, Dembski can cry all he wants, but as least he as Ann Coulter to snuggle up to.

Shudder! Could we be careful with the mental images we generate, please?

However, a slippery slope is dangerous, and I prefer to delimit the problem as much as possible. For example, astrology is outright denying science whether we discuss the family friendly version who believes in certain correlations that isn't there or we discuss the full blown action-at-a-distance kind. This is btw the main reason theistic evolution is problematical, it is a slippery slope, most or all versions outright deny existing science and most or all versions are indistinguishable from creationism.

RealPretentiousNewAgeTool: if "ID is not creationism," then please explain the significance of the phrase "cdesign proponentsists."

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution.

Calling ID creationism is deliberately misleading.

"The ID advocates claim that evolution cannot explain how many modern species or morphologies have arisen."

No they claim that RM + NS is not adequate to explain evolution. They accept evolution, but deny that the neo-Darwinist theory completely explains it.

ND is a particular theory of evolution. But "evolution" is often used as a synonym for ND because ND has dominated for so long.

I don't think you can find a serious ID researcher who denies evolution. They just believe in evolution as a purposeful, guided, creative process.

ND says evolution is a blind, mindless, unintentional, process.

The essential debate is philosphical -- is life inherently meaningful, or meaningless? Is the universe alive or dead?

This is hard, maybe impossible, to answer scientifically. ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity.

So let them give it a shot.

It may turn out to be the sort of question that science and math are not really up to answering. And if that's the case, each of us can make up our own mind how to look at life and the universe.

Right now neither team -- NDE or IDE -- can prove its case. I think we should stay open-minded and curious. All that bashing and insulting is not going to help your cause.

I don't think you can find a serious ID researcher who denies evolution.

— realpc

I don't think you can find a serious ID researcher who denies evolution. They just believe in evolution as a purposeful, guided, creative process.

ND says evolution is a blind, mindless, unintentional, process.

realpc wrote:

"This is hard, maybe impossible, to answer scientifically. ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity.

So let them give it a shot."

Fire away. That is the beauty of science. Anyone can demonstrate anything they want at any time. They just have to have evidence. So far Dembski, even though he can print anything he wants to in any book he publishes, has utterly failed to convince anyone of anything. Of course proving a negative can be really tough, but then again he is the one who has chosen this approach. And no matter what mathematics tells us about what is or is not possible, all the evidence must still be explained.

re the nature of 13 being unlucky :
(from my memory of folklore)
"back in the day" some people counted on their fingers 1-10 and got to 12 by counting both feet - therefore 13 is unlucky because it was beyond their arithmetic. (alternately I heard this tale as 13= unlucky because only men could count to 13 and that part is "dirty/ evil")

Right now neither team --- NDE or IDE --- can prove its case.

is life inherently meaningful, or meaningless?

re the nature of 13 being unlucky : (from my memory of folklore) "back in the day" some people counted on their fingers 1-10 and got to 12 by counting both feet - therefore 13 is unlucky because it was beyond their arithmetic. (alternately I heard this tale as 13= unlucky because only men could count to 13 and that part is "dirty/ evil")

realpc -

You seem to have many misconceptions about evolution, as well as about ID.

Let's start with evolution.

CAN YOU EXPLAIN THE THEORY OF EVOLUTION IN YOUR OWN WORDS?

Please, please, please?

I'm going to keep asking. Hope you don't mind.

I'm helping you. After all, it's kind of silly to argue against something, when what you're actually arguing against is your own misconceptions.

Let's see what you think the theory of evolution says, and then maybe we can clear up some misconceptions.

"The ID advocates claim that evolution cannot explain how many modern species or morphologies have arisen." No they claim that RM + NS is not adequate to explain evolution. They accept evolution, but deny that the neo-Darwinist theory completely explains it.

— realpc

ND is a particular theory of evolution.

But "evolution" is often used as a synonym for ND because ND has dominated for so long.

I don't think you can find a serious ID researcher who denies evolution.

They just believe in evolution as a purposeful, guided, creative process.

ND says evolution is a blind, mindless, unintentional, process.

The essential debate is philosphical --- is life inherently meaningful, or meaningless?

Is the universe alive or dead?

This is hard, maybe impossible, to answer scientifically.

ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity.

So let them give it a shot.

It may turn out to be the sort of question that science and math are not really up to answering.

And if that's the case, each of us can make up our own mind how to look at life and the universe.

Right now neither team --- NDE or IDE --- can prove its case.

I think we should stay open-minded and curious. All that bashing and insulting is not going to help your cause.

ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity. So let them give it a shot.

We have. (What makes you think we've been stopping them?) So far, they have consistently failed to do what they say they can do.

I think we should stay open-minded and curious. All that bashing and insulting is not going to help your cause.

Tell that to the lying bigots on YOUR side who blame evolution and scientists for nearly every evil known to Mankind.

I've heard it claimed that the unluckiness of 13 was related to the number of diners there were at the Last Supper (disregarding, of course, the painting referenced in the Monty Python sketch). Twelve disciples + The Big Guy = 13. Diner No. 13 was, of course, Judas, and that situation (at least according to some) seems to have turned out poorly.

Though if, as some other posts here suggest, the unluckiness of 13 is well over 2000 years old, I suppose the above explanation might show an effect of the superstition rather than a cause....

"Science has never claimed to answer questions about religion, because science deals with the natural, not the supernatural."

That is false. NDE claims to have a definitive answer to a metaphysical question. NDE states that RM and NS alone can account for the origin of species. NDE supporters do not feel they need evidence to support this statement. You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion.

The reasoning is circular. In order to qualify as scientific, a theory must be "naturalist" (what used to be called "materialist"). So any theory that goes beyond materialist philosophy must be unscientific, must be wrong.

Evidence and logic are not involved. It's a question of definitions.

Sure there are many ignorant loonies who support IDE, but there are also sane and educated people who support it.

NDE is, and has been for quite a while, the standard accepted theory. If it wants to remain the standard, it should use logic and evidence to make its case, not tradition and personal attacks.

You know very well that non-standard theories can't make it into mainstream journals easily, no matter the quality of their evidence and reasoning.

I think that most of the anti-ID movement is based on hatred of fundamentalist Christianity. ID does not support fundamentalist Christianity, or any form of Christianity. But it does deny materialist philosophy, so it opens a door to faith and super-human levels of intelligence. That's why scientific atheists despise it.

In other words, strong emotions have gotten mixed into a scientific debate. You will not see any of this clearly as long as you are motivated by hatred of religious intolerance. Sure religious intolerance is nasty, but it has nothing to do with the scientific/philosophical question of NDE vs IDE.

Nigel D,

Well said. Your eloquence is exceeded only by your immense knowledge.

Real PC,
Why do you think this is a metaphysical question ? Do you have evidence ?

That is false. NDE claims to have a definitive answer to a metaphysical question. NDE states that RM and NS alone can account for the origin of species. NDE supporters do not feel they need evidence to support this statement. You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion.

realpc has nothing to offer but the same old creationist talking-points, all of which have been refuted long ago, which he continues to repeat without modification, with the same old pretense of originality, regardless of what anyone else has to say (including the authors of the posts he hijacks with his droning stupidity). Even his "non-standard theories can't make it into mainstream journals" crap is just a robotic repetition. He's clearly run out of both ideas and energy, and is simply not making an ounce of effort; so there's no reason for any of us to make any effort for him.

There were 10 orginal Months. Think about Dec ember. Julius and Augustus needed there own Months. Now we have 12.

Actually, the Roman Calendar, at least from the reign of the second king, Numa Pompilius, began on March 1 and had 12 months. December was the 10th month; the last two were January and February. The months were short, totalling 355 days, and so they needed an occasional leap-month to keep the average around 365 days. Julius Caesar lengthened some of the months to bring the year up to 365 days, and also instituted the leap day, so his year was 365.25 days, close enough to an actual year to make further reform unnecessary for about a millenium.

realpc wrote:

"NDE states that RM and NS alone can account for the origin of species. NDE supporters do not feel they need evidence to support this statement. You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion."

Well, in this case we have very well documented natural mechanisms by which species evolve. We have observed speciation in nature and in the laboratory. We have examined the genetic mechanisms that promote and enforce reproductive isolation and we have studied the process of genetic divergence that follows. Speciation is a completely predictable, perhaps even inevitable, consequence of sexual reproduction.

As others have already pointed out, there is no metaphysical or "supernatural" component involved at all. The only way to get one inserted is to presuppose that it exists apriori, which is exactly what realpc has done without a shred of evidence. Once again, he has committed the very sin that he accuses others of.

What strikes me about the Parliamentary Assembly's document is how informed and up-to-date it is. It is a very good read.

We seldom, if ever, see this kind of thing coming from any governmental organization here in the United States.

This is certainly an example of what the benefits would be of paying attention to what other countries know about what is going on in the world.

realpc, why do you continue to say "NDE states that RM and NS alone can account for the origin of species." when Nigel just explained that to be a strawman, as have many others before? Did you not read that part of his post, or do you not understand it? Or do you ignore it because you can't answer it?

Nigel D, Well said. Your eloquence is exceeded only by your immense knowledge.

— David Stanton

"Science has never claimed to answer questions about religion, because science deals with the natural, not the supernatural." That is false. NDE claims to have a definitive answer to a metaphysical question.

— realpc

NDE states that RM and NS alone can account for the origin of species.

NDE supporters do not feel they need evidence to support this statement.

You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion.

The reasoning is circular. In order to qualify as scientific, a theory must be "naturalist" (what used to be called "materialist"). So any theory that goes beyond materialist philosophy must be unscientific,

must be wrong.

Evidence and logic are not involved.

It's a question of definitions.

Sure there are many ignorant loonies who support IDE, but there are also sane and educated people who support it.

NDE is, and has been for quite a while, the standard accepted theory.

If it wants to remain the standard, it should use logic and evidence to make its case, not tradition and personal attacks.

You know very well that non-standard theories can't make it into mainstream journals easily, no matter the quality of their evidence and reasoning.

I think that most of the anti-ID movement

is based on hatred of fundamentalist Christianity.

ID does not support fundamentalist Christianity, or any form of Christianity.

But it does deny materialist philosophy,

so it opens a door to faith and super-human levels of intelligence.

That's why scientific atheists despise it.

In other words, strong emotions have gotten mixed into a scientific debate.

You will not see any of this clearly as long as you are motivated by hatred of religious intolerance.

Sure religious intolerance is nasty, but it has nothing to do with the scientific/philosophical question of NDE vs IDE.

"The theory of evolution resulted from the consideration of vast amounts of evidence, and has been tested skeptically over and over again."

I can't believe I have to say this again. I believe in evolution, most ID advocates believe in evolution. NDE is one theory that tries to explain evolution.

You can believe in evolution but disagree with the ND explanaation.

I'm sure I will have to repeat this many more times.

The praise for Jones has always amused me; all the talk of his brillinat decision and the like.

Well, compared to all the drivel and horseshit the defendants in that case tried to shovel in our faces, Jones did end up looking rather brilliant. At least he picked more sensible material to copy.

realpc wrote:

"I can't believe I have to say this again. I believe in evolution, most ID advocates believe in evolution. NDE is one theory that tries to explain evolution.

You can believe in evolution but disagree with the ND explanaation."

But you still refuse to describe exactly what you mean by "NDE". You still refuse to describe exactly how you assume it is supposed to work. You still refuse to say exactly what you think it cannot explain. You still refuse to provide any evidence for you views. Until you do we will continue to talk past each other to no avail.

Perhaps the reason for your reluctance stems from the fact that we have already been through this many times before. All your so called theories have been shot down because you have not one shread of evidence. Metaphysical musings about supernmatural causes do not constitute evidence.

NDE is one theory that tries to explain evolution.

Please describe exactly how the other "theories" explain evolution, and what physical evidence backs them up and/or calls NDE/MET into question.

I'm sure I will have to repeat this many more times.

We're sure you will too: repeating the same self-important rubbish over and over again, and pretending you're making some substantive, original and important point, is all you know how to do.

realpc -

Which of the following statements do you disagree with, and why? Be very specific.

1. The genomes of cellular organisms and viruses are composed of nucleic acid molecules, DNA except in the case of RNA viruses. (Arguably, RNA viral genomes almost always use a cellular DNA intermediate for replication).
2. The fundamental aspect of reproduction of viruses and celluar life is replication of the genome.
3. Nucleic acid replication does not and cannot produce an offspring nucleic acid sequence identical to the parent sequence. Sometimes, variations from the parent sequence are termed "mutations", merely meaning "change" or "difference". The biochemical nature of many types of "mutations" is well understood.
4. In addition to this, prokaryotic cells sometimes share nucleic acid sequences with each other in a variety of ways that can cause genetic variability. Elements like plasmids, for example.
5. In addition to this, when most sexually reproducing eukaryotic cells divide, they naturally undergo a process of genetic recombination, generally not considered to be "mutation", which guarantees a unique genome, relative to the parents, for each individual offspring.
6. In addition to this, many viruses insert genetic material into the genomes of cells they infect.
7. In addition to all this, spontaneous mutations can occur in the genomic sequence of quiescent cells that are not even reproducing.
8. As reproduction proceeds, the proportion of various alternate nucleic acid sequences in a population, sometimes termed "alleles" for convenience, can vary over time without any selective pressure. This process is sometimes called "random genetic drift".

I don't pretend that this list of sources of genetic variability between parents and offspring is exhaustive.

9. Each individual cell, organism, or viral particle expresses various genes in a regulated way throughout its development and beyond.
10. The physical form of the organism is called its phenotype. The phenotype interacts with and can sometimes be modified by the surrounding environment.
11. Some types of genetic variability are expressed in the phenotype, others are not.
12. Among phenotypes in a shared environment, some may have features that give them a net reproductive advantage, relative to that environment.
13. The interaction of individual phenotypes with the environment is complicated. Sometimes features that confer a survival advantage also confer a reproductive advantage. Sometimes, however, there is a trade-off. When a feature that confers significant reproductive advantage is selected for even though it acts against longevity, this is often termed "sexual selection". Various exaggerated male bird plumages that increase predation but attract females are used as examples.
14. Within a given environment, if a phenotype enjoys a reproductive advantage over other phenotypes from the same genetic population, in the next generation, the alleles associated with the reproductively favored phenotype will be more frequent. This is sometimes known, broadly, as "natural selection". NOTE - it does not need to involve premature deaths, reproductive frustrations, or the like, although in practice organisms usually do face such constraints. All that is required is that there be different phenotypes, and that some of them have a relative, mathematical reproductive "advantage" (ie produce more offspring that can also reproduce) relative to others.
15. If some phenotypes are better adapted to a shared environment than others, they will be selected for, relative to the others. Thus, it is often said that selection is required for adaptation. Once a phenotype exists that is highly adapted to a given environment, much variation will tend to be selected against, unless the environment changes.

Now remember, my specific question is very simple - which part of the above do you disagree with?

That is false. NDE claims to have a definitive answer to a metaphysical question. NDE states that RM and NS alone can account for the origin of species. NDE supporters do not feel they need evidence to support this statement.

— realpc

You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion.

NDE is, and has been for quite a while, the standard accepted theory. If it wants to remain the standard, it should use logic and evidence to make its case, not tradition and personal attacks.

The essential debate is philosphical --- is life inherently meaningful, or meaningless? Is the universe alive or dead? This is hard, maybe impossible, to answer scientifically. ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity.

So let them give it a shot.

It may turn out to be the sort of question that science and math are not really up to answering. And if that's the case, each of us can make up our own mind how to look at life and the universe.

Right now neither team --- NDE or IDE --- can prove its case. I think we should stay open-minded and curious. All that bashing and insulting is not going to help your cause.

Dembski's now claiming that the prosecution of a Lutheran pastor for denying the Holocaust means that ID will soon be declared a crime against humanity.

Uncommon Descent is certainly a crime against logic.

I can't believe I have to say this again.

I believe in evolution, most ID advocates believe in evolution.

NDE is [the] one theory that tries to explain evolution.

You can believe in evolution but disagree with the ND explanaation.

I'm sure I will have to repeat this many more times.

"Take, for example, Newtonian gravity. It works from the premise that the process involved in an object attracting another object is natural"

That's exactly what I mean! Objects attracting each other at a distance is defined as "natural" -- but why? Just because we can see that, obviously, gravity exists. It doesn't matter that science can't explain it.

The criteria for deciding that a phenonmenon is natural is simply that science accepts that it's real.

The implied contrast with "natural" is "supernatural." But no one bothers to define "supernatural." There's just an intuitive sense that supernatural is everything ignorant, non-scientific, people believe, and which has not been accepted by science.

I hope this isn't too confusing. It's really central to the whole ID debate, and many other important questions as well.

A "natural" explanation, as defined by current mainstream science, is an explanation that scientists generally accept as valid. It doesn't matter how strange or inconclusive the explanation, as long as the phenomenon has been shown to exist. Gravity exists, we can all observe it, so it's natural. We don't know how or why it exists, only that it does.

Well it's exactly the same with evolution! We see that evolution is a fact, so evolution is natural. But as with gravity, we have no real explanation for evolution.

Gravity is natural because science acknowledges its existence, and the same with evolution.

Something can be defined as "natural" whether or not it can be explained within materialist science.

There is absolutely no reason why the ID theory of evolution must be defined as "non-natural."

Neither ID nor ND have been demonstrated. We cannot observe the cause of evolution. Neither explanation is more natural than the other. But ND is a materialist explanation. By that I mean it uses only the substances, fields and forces already defined and accepted my science. It fits within the framework of current scientific philosophy.

That's exactly what I mean! Objects attracting each other at a distance is defined as "natural" --- but why? Just because we can see that, obviously, gravity exists. It doesn't matter that science can't explain it.

The criteria for deciding that a phenonmenon is natural is simply that science accepts that it's real.

The implied contrast with "natural" is "supernatural." But no one bothers to define "supernatural." There's just an intuitive sense that supernatural is everything ignorant, non-scientific, people believe, and which has not been accepted by science.

I hope this isn't too confusing. It's really central to the whole ID debate, and many other important questions as well.

The implied contrast with "natural" is "supernatural." But no one bothers to define "supernatural." There's just an intuitive sense that supernatural is everything ignorant, non-scientific, people believe, and which has not been accepted by science.

Neither ID nor ND have been demonstrated. We cannot observe the cause of evolution. Neither explanation is more natural than the other. But ND is a materialist explanation. By that I mean it uses only the substances, fields and forces already defined and accepted my science. It fits within the framework of current scientific philosophy.

"Biological evolution can be explained in natural terms, down to the atomic level."

Maybe adaptation, but not the origin of a new, more complex, species. But that leads us back to defining "complexity" again.

Genes sometimes duplicate. This is demonstrable fact. It also makes the resultant descendent more complicated than its predecessor by any measure. After it mutates a few times, and duplicates some more, it is even more obviously so. Or is someone going to really try to claim that ATGATGA is just as complex as ATGATAGTGATTTAGTGGGA?

MSU bites the dust again.

Realpc: What is this 'ID theory of evolution' that you keep referring to? How do you expect us to comprehend what you are driving at when you can't even clearly define your terms?

What do evolution-accepting IDists believe? Do you think that a god comes along and thinks 'Hmm. These mice are getting out of hand. I'll have to take this hawk and alter its DNA. If I move its eyes to the front and give it better hearing it can hunt mice at night. Perhaps I should give it soft feathers while I'm at it.' Is that how owls arose, do you think?

"Biological evolution can be explained in natural terms, down to the atomic level." Maybe adaptation, but not the origin of a new, more complex, species. But that leads us back to defining "complexity" again.

Unfortunately all RealPC has ever proved is that he is a complete waste of time. He has driven multiple threads completely off topic with his inane repetitious drivel. This thread started out interesting but has become quite boring as a result of RealPC's trolling. I recommend moving RealPC's comments to the bathroom wall. You are welcome to move mine there as well since it is also off topic.

Rule I: We are to admit no more causes of natural things than such as are both true and sufficient to explain their appearances. To this purpose the philosophers say that Nature does nothing in vain, and more is in vain when less will serve; for Nature is pleased with simplicity and affects not the pomp of superfluous causes. Rule II: Therefore to the same natural effects, we must, as far as possible assign the same causes. As to respiration in a man and in a beast; the descent of stones in Europe and in America; the light of our culinary fire and of the sun; the reflection of light in the earth, and in the planets. Rule III: The qualities of bodies, which admit neither intensification nor remission of degrees, and which are found to belong to all bodies within the reach of our experiments, are to be esteemed the universal qualities of all bodies whatsoever.

In experimental philosophy we are to look upon propositions collected by general induction from phænomena as accurately or very nearly true, notwithstanding any contrary hypotheses that may be imagined, till such time as other phænomena occur, by which they may either be made more accurate, or liable to exceptions. This rule we must follow, that the argument of induction may not be evaded by hypotheses.

ID is based on our ignorance about particular examples of evolution.

Realpc: What is this 'ID theory of evolution' that you keep referring to?

1) Some stuff really looks designed

...But that leads us back to defining "complexity" again.

And that, in turn, reminds us that you've never attempted to do so. And that leads us to conclude that your General Theory of Unspecified Complexity and Stuff is still a load of insubstantial brown air, hanging around like a fart in a Russian space station, long after we've all got tired of smelling it over and over.

Go away, realpc. You don't belong at the grownups' table, and you bring nothing to it but the same old self-important word-salad, constantly interrupting conversations you don't comprehend.

"What do evolution-accepting IDists believe? Do you think that a god comes along and thinks 'Hmm. These mice are getting out of hand. I'll have to take this hawk and alter its DNA."

As I have explained before, there is a natural tendency in our universe for systems to evolve in the directlion of increasing complexity. That is more or less all that ID is proposing. Everything else -- gods that look like old men and zap things into existence, and who diapprove of homsexuality -- is added to the theory by its opponents.

The debate hinges on the concept of complexity, and we have no agreed-on definition.

there is a natural tendency in our universe for systems to evolve in the directlion of increasing complexity. That is more or less all that ID is proposing

That is not what ID is proposing at all.

there is a natural tendency in our universe for systems to evolve in the direction of increasing complexity.

The debate hinges on the concept of complexity, and we have no agreed-on definition.

As I have explained before, there is a natural tendency in our universe for systems to evolve in the directlion of increasing complexity.

That is more or less all that ID is proposing.

Everything else --- gods that look like old men and zap things into existence, and who diapprove of homsexuality --- is added to the theory by its opponents.

"Pretending not to understand the relationship between ID and YE creationism only makes you look dishonest or foolish.

All YE creationists I know of claim to support ID and "Biblical Literalism""

Maybe all YECists believe in ID, I have no idea. That says nothing about how many IDists believe in YEC (this should be in the first chapter of any intro to logic book).

realpc-

Here's my real quote -

"All YE creationists I know of claim to support ID and "Biblical Literalism. By doing so, they constitute the vast majority of ID supporters."

And of course I also said -

"I doubt if there are any actual ID advocates who would admit, in the prescence of YEC creationists, to opposing YEC creationism"

Don't quote-mine when anybody can see the real quote right above. Any logic book ought to tell you that.

In fact, don't twist other peoples' words at all. Honestly address what they actually say.

HAHAHAHAHAHAHAHAHAHAHAHA! But warn me first. I don't want them to find me dead of shock in front of a computer screen.

The debate hinges on the concept of complexity, and we have no agreed-on definition.

Sir Toe_Jam -

In fact, all you have to do is look up "complex" in Wikipedia and you get this pretty quickly.

http://en.wikipedia.org/wiki/Complex_adaptive_systems

I guess realpc should retire.

I'm almost feeling bad for beating him up so much now, since I have no problem with goofy new age beliefs in general, many of which aren't even in conflict with science.

But he's now proven that he knows NOTHING about evolution, nothing about ID or creationism, AND nothing about complexity.

And since that stuff is all he ever talks about...

harold,

The page you cited says: "complexity is hard to quantify in biology." You probably know that's what I meant. Commenters here at PT have come up with some bizarre definitions and examples of complexity, which you may have missed. At PT, we have not agreed on any definition of biological complexity.

In addition, some PT commenters deny that biological complexity has increased since life began. We had many frustrating philosohical debates about this.

The ID position depends on the idea that complexity has increased, and that RM + NS cannot account for it. NDists perform mental contortions to avoid the ID conclusion.

As I have been saying, this has nothing to do with politics or teaching the Christian creation myth in public school. It doesn't matter what various ID supporters believe about religion or sexual morality, or global warming. None of that has any relevance to the central question.

The UD site is political. I have nothing in common with them aside from accepting the central premise of the ID theory of evolution.

There is no ID conclusion, moron. They have /asserted/ that evolution cannot account for increasing complexity, without saying why, or defining complexity. It's not a conclusion. It's a sleazy trick to undermine confidence in evolution without doing any work.

There is also no ID theory of evolution, but we've already told you that in this thread and I can't be bothered with your dumbass attempts at trolling. I will, however, take the opportunity to educate real people.

Sounds like you're getting worried pigwidgeon!

And despite lack of agreement on the term complexity, Realpc seems to believe that complexity in nature increases.
Of course, ID has nothing to do with complexity really, it's merely the null hypothesis or the set theoretic complement of chance and regularity.
Complexity as defined by ID merely is an indicator of our ignorance.
Some have been confused by these unusual terminologies to actual come to a belief that ID has a real theory.
It doesn't.

The page you cited says: "complexity is hard to quantify in biology." You probably know that's what I meant. Commenters here at PT have come up with some bizarre definitions and examples of complexity, which you may have missed. At PT, we have not agreed on any definition of biological complexity.

In addition, some PT commenters deny that biological complexity has increased since life began. We had many frustrating philosohical debates about this.

The ID position depends on the idea that complexity has increased, and that RM + NS cannot account for it. NDists perform mental contortions to avoid the ID conclusion.

As I have been saying, this has nothing to do with politics or teaching the Christian creation myth in public school. It doesn't matter what various ID supporters believe about religion or sexual morality, or global warming. None of that has any relevance to the central question.

The UD site is political. I have nothing in common with them aside from accepting the central premise of the ID theory of evolution.

Perhaps Realpc can explain how he has gone from the foundation of ID to his interpretation thereof?

realpc couldn't explain ice to an Inuit.

At PT, we have not agreed on any definition of biological complexity.

"it is not reasonable to state that there is a monotonic or invariant tendency toward greater complexity in either case."

harold,

The system as a whole, not individual species, becomes more complex. I don't think we can assume our species will evolve into something more complex, for example. And the system could not survive without its base of primitive organisms.

My perspective is holistic, by the way, and I think of systems in terms of levels of organization. So when I say complexity is increasing, I am talking about the biosphere in general, or some level higher than the species.

And by the way, human civilization is an example of this tendency to evolve toward complexity. Although our biological evolution may have slowed or stopped, our cultural evolution has taken off.

The system as a whole, not individual species, becomes more complex.

— realCharlie Wagner:

My perspective is holistic, by the way, and I think of systems in terms of levels of organization. So when I say complexity is increasing, I am talking about the biosphere in general, or some level higher than the species.

— realCharlie Wagner further:

And by the way, human civilization is an example of this tendency to evolve toward complexity. Although our biological evolution may have slowed or stopped, our cultural evolution has taken off.

— realCharlie Wagner further:

I'd think that level of complexity (if that means anything) of the system as a whole would be mainly related to the number of current species, which I would expect to level off when the rate of extinction equals the rate of new species appearing.

As for complexity of the most complex of species, I'd expect that to level off when it reaches the point of diminishing returns; i.e., when even more complexity would cost more to maintain than it would produce in benefit.

Although as I'm not a biologist, my inferences could be wrong.

Henry

The system as a whole, not individual species, becomes more complex. I don't think we can assume our species will evolve into something more complex, for example. And the system could not survive without its base of primitive organisms. My perspective is holistic, by the way, and I think of systems in terms of levels of organization. So when I say complexity is increasing, I am talking about the biosphere in general, or some level higher than the species. And by the way, human civilization is an example of this tendency to evolve toward complexity. Although our biological evolution may have slowed or stopped, our cultural evolution has taken off.

"There is, of course, a huge difference between claiming that evolution, as it is understood, has this overall, statistical effect, versus denying that the theory of evolution explains evolution."

First, NDE should not be called "The" theory of evolution, because that implies IDE is not a theory of evolution, and that there has never been any theory of evolution except ND. There have been other theories, and some of them came along before Darwin's. Lamarck's theory, for example, has been discounted but never disproven.

Increasing complexity of the biosphere is central to this debate. Can RM + NS adequately explain it, or not? We don't know.

All the pro-evolution evidence supports evolution in general, not NDE specifically.

NDE was enthusiastically accepted because it is the only theory of evolution that eliminates purpose and intelligence from nature. Natural purpose and intelligence are not the kind of things modern scientists like to deal with.

But alternate theories were discarded too readily. How did they supposedly disprove Lamarckianism, for example? I'm not saying Lamarckianism is correct (although I suspect some aspects of it are partially correct). My point is that NDE won the beauty contest before the other contestants ever got on stage.

As more is learned about complexity, NDE starts to look a little faded. Maybe something is missing after all.

The problem is that Dembski and Behe are radical revolutionaries, with respect to scientific naturalism. They aren't just criticizing some aspects of NDE, they are criticizing the philosophical foundation of current mainstream (non-holistic) science.

First, NDE should not be called "The" theory of evolution, because that implies IDE is not a theory of evolution...

....some evidence, if found, would falsify it...

The troll is quotemined thusly: NDE should ... be called "The" theory of evolution... IDE is not a theory of evolution... there has never been any theory of evolution except ND. Darwin's... theory, for example, has been discounted but never disproven. Increasing complexity of the biosphere ...? We don't know. All the ...evidence supports evolution in general... NDE was enthusiastically accepted ... it is the only theory of evolution...from nature. Natural...things modern scientists like to deal with. As more is learned ....complexity...starts to look a little faded. Maybe something is missing after all. The problem is ... Dembski and Behe. They aren't just criticizing ... NDE, they are criticizing the ... mainstream ... science.

The problem is that Dembski and Behe are radical revolutionaries, with respect to scientific naturalism. They aren't just criticizing some aspects of NDE, they are criticizing the philosophical foundation of current mainstream (non-holistic) science.

— realpc

"There is, of course, a huge difference between claiming that evolution, as it is understood, has this overall, statistical effect, versus denying that the theory of evolution explains evolution." First, NDE should not be called "The" theory of evolution, because that implies IDE is not a theory of evolution, and that there has never been any theory of evolution except ND.

— realpc

There have been other theories, and some of them came along before Darwin's. Lamarck's theory, for example, has been discounted but never disproven.

Increasing complexity of the biosphere is central to this debate.

Can RM + NS adequately explain it, or not? We don't know.

All the pro-evolution evidence supports evolution in general, not NDE specifically.

NDE was enthusiastically accepted because it is the only theory of evolution that eliminates purpose and intelligence from nature.

Natural purpose and intelligence are not the kind of things modern scientists like to deal with.

But alternate theories were discarded too readily. How did they supposedly disprove Lamarckianism, for example? I'm not saying Lamarckianism is correct (although I suspect some aspects of it are partially correct).

My point is that NDE won the beauty contest before the other contestants ever got on stage.

As more is learned about complexity, NDE starts to look a little faded.

Maybe something is missing after all.

The problem is that Dembski and Behe are radical revolutionaries, with respect to scientific naturalism.

They aren't just criticizing some aspects of NDE,

they are criticizing the philosophical foundation of current mainstream (non-holistic) science.

For the general audience: realpc AKA Charlie Wagner is the second (only to the legendary John A. Davidson) largest crank ever to have "blessed" this forum with his presence. He is completely and utterly uneducable. As a consequence, he also believes that if there is something he doesn´t know - and man-o-Manischewitz there´s plenty - then we don´t know either.

realpc- I, too, am curious about which aspects of Lamarckism you suspect to be partially correct, and what you would consider to constitute a "disproof" of Lamarckism. As far as I recall, August Weissmann did a pretty good job of disproving it in 1889. Or perhaps Lamarckist effects are still hiding somewhere, along with leprechauns and irreducible complexity?

"MET is looking as fresh as a daisy, what with new dinosaur-bird intermediate fossils cropping up in China,"

Yeah, that's what I keep trying to tell you. The evidence is always for evolution, not for the currently accepted explanation of evolution. Evolution is already an established fact. So there's more evidence for it? Ok, how does that support the RM + NS theory (and that IS the currently accepted theory)? It doesn't. There is no evidence for RM + NS only as the explanation for the origin of new species.

It's difficult or impossible to prove that the current theory, what you call MET, is wrong. You can always use the standard reply -- given enough time, anything is possible.

It might also be impossible to disprove IDE. Maybe the question won't be answered. But it is an important and interesteing controversy, and trying to silence the dissenters is a mistake.

There is no evidence for RM + NS only as the explanation for the origin of new species.

But it is an important and interesteing controversy, and trying to silence the dissenters is a mistake.

Increasing complexity of the biosphere is central to this debate. Can RM + NS adequately explain it, or not? We don't know.

NDE was enthusiastically accepted because it is the only theory of evolution that eliminates purpose and intelligence from nature. Natural purpose and intelligence are not the kind of things modern scientists like to deal with

No they claim that RM + NS is not adequate to explain evolution.

Have you never heard of genetic recombination, neutral genetic drift or sexual selection? These are other processes that form a part of modern evolutionary theory.

NDE states that RM and NS alone can account for the origin of species.

why do you continue to say "NDE states that RM and NS alone can account for the origin of species." when Nigel just explained that to be a strawman, as have many others before?

The ID position depends on the idea that complexity has increased, and that RM + NS cannot account for it.

modern evolutionary theory does not depend on a simple mantra of what you call "RM and NS".

Can RM + NS adequately explain it, or not?

MET contains significantly more than RM+NS.

Ok, how does that support the RM + NS theory (and that IS the currently accepted theory)?

realpc AKA Charlie Wagner is the second (only to the legendary John A. Davidson) largest crank ever to have "blessed" this forum with his presence. He is completely and utterly uneducable.

I don't know if he's charlie wagner, but whoever realpc is, Richard makes it clear he has a learning disability.

I don't know if he's charlie wagner, but whoever realpc is, Richard makes it clear he has a learning disability.

Really RealPC, just about everyone here has told you that your whole, "NDE which is RM+NS is the currently accepted theory." is a straw-man of what the currently accepted theory (Modern Synthesis) really is.

You haven't even heralded any evidence(from the literature or otherwise) to support the primary premise on which you base all of your argumentation. You criticize the logic of others but it seems you are the only one using circular logic here. Please go away until you have some real insight to offer other than your whole NDE can't explain complexity crap.

The problem is that Dembski and Behe are radical revolutionaries, with respect to scientific naturalism. They aren't just criticizing some aspects of NDE, they are criticizing the philosophical foundation of current mainstream (non-holistic) science.

Because they claim that if they can show that something is necessarily designed, there is necessarily a designer?

Dembski and Behe aren't saying anything (Dembski makes some farting noises, though), and they have prove of even less. Sorry, but that's the plain and simple truth.

Or, wait, has Charlie been banned or not?

I guess I think of him as having been banned, because he's violating the rules by switching names, at least without informing that he has done so (I assume, don't know, that he hasn't).

Anyhow, it's like Pastor Bentonit says, he's one of the worst trolls on these forums, never learning, repeating the same nonsense, and ignoring whatever he doesn't understand, which is nearly everything above 8th grade level.

Glen D
http://tinyurl.com/35s39o

Maybe realpc thinks he is doing the "Messin' With Sasquatch" thing. He appears to have about the same dopey "mentality" as those guys in the Beef Jerky ad on TV.

I see three distinct relationships with science.

For me, any creationist claim, broadly defined (any strong claim that natural processes can not explain the evolution of cellular and post-cellular life, or any strong claim that life could never haver originated naturally) renders the claimer a "creationist" (and thus dishonest or ill-informed), rather than a theistic evolutionist.

"any strong claim that life could never have originated naturally renders the claimer a "creationist" "

And that statement hinges on the word "naturally." By "naturally," you probably mean in accordance with your preferred view of reality.

"Supernatural" is also used without a definition in these debates. I think there are higher order dimensions, which are hypothesized in physics, but which science really knows nothing about. So would those higher levels belong to "nature" or to "super-nature?" What if, as David Bohm believes, lower levels unfold from higher levels? What if evolution on our level is guided somehow by processes on some higher level? That doesn't seem far-fetched, but it would be compatible with ID.

There is no point using the word "natural" if you never indicate what you mean by it.

For me, any creationist claim, broadly defined (any strong claim that natural processes can not explain the evolution of cellular and post-cellular life, or any strong claim that life could never haver originated naturally) renders the claimer a "creationist" (and thus dishonest or ill-informed), rather than a theistic evolutionist.

And that statement hinges on the word "naturally." By "naturally," you probably mean in accordance with your preferred view of reality.

"Supernatural" is also used without a definition in these debates.

I think there are higher order dimensions, which are hypothesized in physics, but which science really knows nothing about. So would those higher levels belong to "nature" or to "super-nature?".

What if, as David Bohm believes, lower levels unfold from higher levels?

What if evolution on our level is guided somehow by processes on some higher level?

That doesn't seem far-fetched, but it would be compatible with ID.

And that statement hinges on the word "naturally." By "naturally," you probably mean in accordance with your preferred view of reality.

There is no point using the word "natural" if you never indicate what you mean by it.

Interesting that realpc considers Dembski a revolutionary, yet doesn't find anything of use on uncommon descent, his main blog. (??)

Technically, realpc has violated the PT posting rules, and so is banable, for having posted also using the names realPC and realpc2. Or so I think. An administrator would have to check the IP addresses attached to these nom-de-blog...

[ID supporters believe that] RM + NS is not adequate to explain evolution

First off, let me straighten you out on some terminology. "Random" mutation and natural selection are two of several mechanisms that form a part of meodern evolutionary theory. When I use the term "evolution", and in most of the contexts in which I see that term, it means "modern evolutionary theory". It has a second meaning, that of "change over time", in which it is also used. However, for the sake of simplicity, I use it only in its first meaning in discussions such as this one.

"random mutation plus natural selection is sufficient to explain the complexity of life on earth."

Yes, exactly -- that is the current standard theory. And ID says it isn't sufficient. That is the essential debate.

Coin, when I read the word "mutation" I think of point mutation. Is gene duplication really a mutation? It seems like the definition of "mutation" has to be made too broad to do what you suggest. What do the biologists in the audience say?

As for sexual selection, I always considered that a completely different form of selection from natural selection, the latter being concerned with survival. Am I being too narrow?

Sexual selection is a subset of natural selection in which the fitness landscape is highly skewed in favor of a trait reinforced by mate choice (usually female choice). It's important to remember that the "environment" that does the selecting always includes one's conspecifics.

It gets interesting, of course, in cases of "runaway" sexual selection, where the trait of interest might actually be highly deletrious were there not the strong pressure toward mating success, and this is where people perceive a conflict between sexual and what might be termed "pure" natural selection. But, as we've learned, fitness landscapes are always multi-dimensional. It's important as well to keep in mind that the female's choosiness is also a product of evolutionary pressure. All evolution is co-evolution.

Science Avenger: Those are really good points. I'd personally tend to use both "mutation" and "natural selection" in the most general senses, i.e. "mutation" meaning any error in the genome and natural selection being any preferential representation of phenotypes in a new generation; but I of course would not say these are the only or necessarily even the preferable definitions of these words. So I'm not really sure what the best way to word things would be...

I would say, additionally, to Science Avenger, that natural selection is really not concerned with survival, except in the obvious sense that some duration of survival is a necessary condition of reproduction. How long that duration needs to be varies greatly across the biosphere, from about a half an hour to a decade or more, of course, so among us megafauna survival to reproductive maturity is unusually salient. But reproductive success is the only variable selection has to work with when it's all said and done.

As far as I can tell, the other systems at work in evolution--- genetic recombination, sexual selection, punctuated equilibrium--- are all emergent mechanisms, side effects of RM+NS which are built entirely on top of RM+NS.

As far as I can tell, the other systems at work in evolution--- genetic recombination, sexual selection, punctuated equilibrium--- are all emergent mechanisms, side effects of RM+NS which are built entirely on top of RM+NS.

"random mutation plus natural selection is sufficient to explain the complexity of life on earth." Yes, exactly --- that is the current standard theory. And ID says it isn't sufficient. That is the essential debate.

"It's all so funny really. It is refreshing to step back and see that we are all still such children, haggling over what something is or isn't. As a young child we picked up and tried to discern, with our limited database of knowledge, what objects were. Though we cannot recall the emotional feeling of 'awed wonder', we are delighted when we see it reflected on the face of our young.

To me it seems very clear.

But first let's set the stage here.

First we have the EVOLUTIONISTS. They say evolution is the only way to go because some viruses, bacteria etc. have been found to mutate into changing their number of chromosomes, i.e. become ANOTHER SPECIES entirely, by our chromosomal spe-cial definition.
They say, if the viruses can mutate into another species, then so can everything.

Then there are the CREATIONISTS. They say NO EVOLUTION! Everything was created with the wonderous, miraculous powers of God. And they would as soon hang you as a heretic, than listen to you even consider suggesting that GOD is an ALIEN.

Though the CREATIONISTS HAVE SOFTENED A BIT THESE LAST FEW YEARS, EITHER OF THE ABOVE TWO CAMPS SCOFF AT ANY THEORY THAT ENCOMPASSES BOTH IDEAS.

To me - it seems pretty clear.

Yes, viruses and bacteria can mutate, even to the point of the new generations being different species, by our cromosomal count standard.

However, where is the proof that anything higher than a crustacean has done this?

- - - - - -

THE WAY I SEE IT, THERE IS A MORE ADVANCED PERSON(S) - OR ENTITY (IES). CALL HIM OR THEM "GOD", IF YOU LIKE. THEY HAVE LEARNED THE INS AND OUTS OF DNA COMPLETELY. THEY ARE COMPLETE MASTERS OF THE SUBJECT.

THEY CREATED US. THE BUILDING BLOCKS THEY USED ARE THE SAME, AND SOME PARTS ARE SIMILAR - HOWEVER NO "LINK" CAN BE FOUND BECAUSE THERE IS NONE. SIMILARITIES CAN GIVE HOPE TO A "LINK', BUT WHO NEEDS A LINK?

To clarify:
WHEN YOU WERE A KID AND YOU PLAYED WITH YOU ERECTOR SET DID YOU CHANGE YOUR BUILDING JUST ONE PIECE BY ONE PIECE AT A TIME? MAYBE SOMETIMES YOU DID, BUT USUALLY YOU TORE IT DOWN AND CREATED ANOTHER ONE. SOME FACETS WERE THE SAME, BUT A 'MISSING LINK' WAS CERTAINLY NOT EVER TO BE FOUND IF SOMEONE WANTED TO RECREATE BOTH MODELS.

AS WE GOT OLDER WE BECAME MORE COMPLEX IN OUR ERECTOR DESIGNS. SOME OF US LOST INTEREST. OTHERS WENT ON TO BECOME ARCHETECTS AND BECAME QUITE PROFICIENT AT CREATING IN THE 3RD DIMENSION AT THE FOURTH DIMENSION.

Perhaps DNA is 5th dimensional.

To me it's obvious that we did not entirely evolve from thunder and sunshine, like a computer cannot just 'come to be'. It takes an intelligent design somewhere along the line. A basic law of physics states that, "Any system without work gets more chaotic."

I suppose it would be possible to creat a simple organism that would grow into a mammal over generations - as long as it was encoded in the DNA to do that. However, from the evidence of the dinasaurs, and what our "folklores" tell us, God created us "in his image", knowing full well that we could happen upon this "tree of life" (The Human Genome Project - the "Human Tree of Life".) Our lore tells us that God did not want us to do this, just as a parent doesn't want a child to do something that can harm him; and believe me, the potential for harm when speaking of genetic creation, is expontentially larger than we would first contemplate. (So far, we didn't forsee "chimera viruses" - opps!)

But God gave us Pokeymon to practice with, and tv came from somewhere, in part, to sedate our minds."

posting three times and using capitals does not make your argument any stronger

This JERK already dumped this LOAD OF CRAP on another thread. Anyone interested in examples of speciation can go there to see my reply. As for the intermediate form CRAP, here is a partial list of some intermediates between major vertebrate groups (references available at the web site listed):

Fish 12
Amphibians 18
Reptiles 19
Birds 12
Mammals 30
Whales 11
Horses 25
Elephants 11
Humans 11

talkorigins.org/faq/transitions

Coin wrote: "For this reason (though I would disagree with any wording of this idea, such as that used by RealPC, that implies that the "theory of evolution" consists only of the study of these two things), I would absolutely agree with the idea that random mutation plus natural selection is sufficient to explain the complexity of life on earth.

Would anyone disagree with this, and if so, why?"

I strongly disagree with it. For one thing, sexual reproduction contributed to some of the organisms on earth being as complex as they are; for there is a hugely significant correlation between the evolution of sex and, on average, greater complexity among organisms than what occurs without sex. Put it this way: Had sex not evolved, there would not be organisms on earth that are as complex as elephants and humans. Sex contributed to the differences among many organisms. Look at how different asexually reproducing organisms are from each other, and look at how complex they are. Now look at how different mice, T-rexes, flowering plants, dolphins, elephants, giraffes, brontosauruses, eagles, Toucans and humans are from each other. They are as different as they are partly because sexual reproduction evolved.

Vast numbers and combinations of organisms sexually reproducing did not, by itself, cause a population of fish to evolve into elephants. Obviously the events we call mutations were important as well. But vast numbers and combinations of organisms sexually reproducing contributed to fish evolving into elephants.

Here is a quote from Ernst Mayr:

"Evolution in sexually reproducing organisms consists of genetic changes from generation to generation in populations, from the smallest local deme to the aggregate of interbreeding populations in a biological species. Numerous processes, particularly mutation, contribute to these genetic changes to supply the phenotypic variation needed by selection. The most important factor is recombination, which is largely responsible for the virtually inexhaustible supply of new genotypes in every generation. Selection, then, is responsible for the elimination of all but on the average two parents. Those individuals that are best adapted to the abiotic and biotic environment have the greatest chance to be among the survivors. This process favors the development of new adaptations and the acquisition of evolutionary novelties, thus leading to evolutionary advance, as stated in the language of evolutionary biology" (What Evolution Is, p. 157).

What features of sex have been important in contributing to differences among some organisms? Well, one thing: it is a great way of combining helpful DNA sequences in organisms. For example, there are a number of genes that contribute to skin color in humans. Sex can put those genes in organisms and help the organism live and reproduce. There may be other features of sex that have contributed to the differences that some organisms share. But that is one.

Sex (without mutations) did not cause a population of fish to evolve into humans. But sex, mutations, and varying levels of reproductive success were kind of events that were, at the very least, hugely important in causing a population of fish to evolve into humans.

An interesting aspect of sex is this: It sometimes causes the existence of an organism that has a trait that is more accentuated than the trait is in any other member of the population. For example, humans have been breeding sugar beets for some time. In the early 1800s the sugar beet had about 5% sugar content by weight. In comparison, today's beets have about 20% sugar content. Sexual reproduction can put together all the genes that can contribute to an increase in sugar content. So let's say there are 11 genes in the sugar beet population that tend to increase sugar content. But not all 11 of those genes are in any one beet. You can cross various beets to get all 11 genes in some beets. Now there may have been mutations to some sugar beets that occurred after 1800 that contributed to the increase in the amount of sugar content in the beets. But there may not have been. It might have been that, simply by crossing certain beets, humans increased the sugar content of beets so that the sugar content of some of the beets was higher than it was in any member of the population before the breeding began. Moreover, if there were new mutations that occurred after 1800 that tended to increase the sugar content, all those mutation could, via sexual reproduction, be combined in some organisms to increase the sugar content of some members of the population. So, mutations that occurred after 1800 may have helped increase the sugar content. So, for example, beet A may have come into being with a new mutation that tended to increase A's sugar content. Five years later, beet B may have come into being with a new mutation that tended to increase B's sugar content. By crossing beets A and B, we could have brought about a beet that had even greater sugar content than beets A or B.

Moreover, the same process was at work with giraffe's necks. Because certain giraffes reproduced with each other, it contributed to their necks getting longer and longer. Now there is going to be a limit to how long the neck can get without new mutations that affect neck size occurring in the population. But just putting all the "neck-size increasing" genes together through sex can contribute to a member of the population having a longer neck than any other member of the population. This accentuation of traits occurs in sexual reproduction at least because sex puts the maximum number of genes that produce a certain protein together in members of the population. So, if there are 11 genes in a population that tend to produce lighter skin color, sex can eventually put all those genes together in some members of the population. And let's say a gene mutates so that it tend to produce a greater amount of a particular protein than do other versions of the same gene. The organism that has the mutation can produce offspring that inherit the mutation. These offspring can reproduce with each other, so that some of them have two copies of the mutation. This might contribute to an accentuation of the trait.

A final point: diet and activity (for instance, exercise) are other kinds of events that contributed to greater complexity in some organisms. For example, organisms that are poorly nourished tend to be less complex in certain ways than other members of the population, for example, in terms of brain development, size and musculature. And consider the muscle mass on professional body builders. It is partly the result of diet, exercise and, in some cases (unfortunately) anabolic steroids. On how interactions between an organism and its environment affect diversity and complexity, I recommend Richard Lewontin's book The Triple Helix.

Now if one gets in excellent condition through diet and exercise, one will not be able to directly pass this trait down in the same way that one passes down a gene. However, the diet and exercise can affect the quality and quantity of one's sperm, which can affect one's ability to produce viable and complex offspring. Moreover, it might be that high levels of stress tend to increase the likelihood of mutations to gametes. Most mutations are neutral or harmful. But some mutations are reproductively beneficial. Finally, if organism X gets in good shape through diet and exercise, it can increase the number of members of the opposite gender that are willing to reproduce with X. This can enable one to reproduce with a more fit and interesting member of the population, which can contribute to offspring that are better able to flourish.

I wrote: "An interesting aspect of sex is this: It sometimes causes the existence of an organism that has a trait that is more accentuated than the trait is in any other member of the population."

Along these same lines, sex sometimes contributes to the existence of organisms that are able to do relatively well in a particular environment. For example, by crossing red carnations with white carnations, I can get pink carnations. By crossing certain sugar beets, I can increase the sugar content in some beets. Finally, when Michael Jordan's mother reproduced with his father, it contributed to the existence of Michael Jordan.

The second comment is an argument I usually see made when an anti-evolutionist attempts to cast evolution as "RM+NS". But while I understand the spirit behind this comment--- no, RM+NS is not all there is to evolution, our understanding of evolution has increased since the Harding administration and there are indeed other "mechanisms" at work in the evolutionary process--- depending on how it's worded I'm sometimes not sure I strictly agree with it, since it seems to me the "other mechanisms" are not actually separate from RM+NS, but examples of RM+NS at work. As far as I can tell, the other systems at work in evolution--- genetic recombination, sexual selection, punctuated equilibrium--- are all emergent mechanisms, side effects of RM+NS which are built entirely on top of RM+NS.

— Coin

The only exceptions (lateral gene transfer by viruses, perhaps), the things which are not fundamentally based on RM+NS, are minor effects generally negligible to the process of speciation.

For this reason (though I would disagree with any wording of this idea, such as that used by RealPC, that implies that the "theory of evolution" consists only of the study of these two things), I would absolutely agree with the idea that random mutation plus natural selection is sufficient to explain the complexity of life on earth. Would anyone disagree with this, and if so, why?

It's all so funny really. It is refreshing to step back and see that we are all still such children, haggling over what something is or isn't. As a young child we picked up and tried to discern, with our limited database of knowledge, what objects were. Though we cannot recall the emotional feeling of 'awed wonder', we are delighted when we see it reflected on the face of our young.

— christorvik@yahoo.com

But first let's set the stage here. First we have the EVOLUTIONISTS.

They say evolution is the only way to go because some viruses, bacteria etc. have been found to mutate into changing their number of chromosomes, i.e. become ANOTHER SPECIES entirely, by our chromosomal spe-cial definition.

They say, if the viruses can mutate into another species, then so can everything.

Then there are the CREATIONISTS. They say NO EVOLUTION! Everything was created with the wonderous, miraculous powers of God. And they would as soon hang you as a heretic, than listen to you even consider suggesting that GOD is an ALIEN. Though the CREATIONISTS HAVE SOFTENED A BIT THESE LAST FEW YEARS, EITHER OF THE ABOVE TWO CAMPS SCOFF AT ANY THEORY THAT ENCOMPASSES BOTH IDEAS.

To me - it seems pretty clear.

Yes, viruses and bacteria can mutate, even to the point of the new generations being different species, by our cromosomal count standard. However, where is the proof that anything higher than a crustacean has done this?

THE WAY I SEE IT, THERE IS A MORE ADVANCED PERSON(S) - OR ENTITY (IES).

CALL HIM OR THEM "GOD", IF YOU LIKE. THEY HAVE LEARNED THE INS AND OUTS OF DNA COMPLETELY. THEY ARE COMPLETE MASTERS OF THE SUBJECT.

THEY CREATED US.

THE BUILDING BLOCKS THEY USED ARE THE SAME, AND SOME PARTS ARE SIMILAR

- HOWEVER NO "LINK" CAN BE FOUND BECAUSE THERE IS NONE.

SIMILARITIES CAN GIVE HOPE TO A "LINK', BUT WHO NEEDS A LINK?

To clarify: WHEN YOU WERE A KID AND YOU PLAYED WITH YOU ERECTOR SET DID YOU CHANGE YOUR BUILDING JUST ONE PIECE BY ONE PIECE AT A TIME? MAYBE SOMETIMES YOU DID, BUT USUALLY YOU TORE IT DOWN AND CREATED ANOTHER ONE. SOME FACETS WERE THE SAME, BUT A 'MISSING LINK' WAS CERTAINLY NOT EVER TO BE FOUND IF SOMEONE WANTED TO RECREATE BOTH MODELS.

AS WE GOT OLDER WE BECAME MORE COMPLEX IN OUR ERECTOR DESIGNS. SOME OF US LOST INTEREST. OTHERS WENT ON TO BECOME ARCHETECTS AND BECAME QUITE PROFICIENT AT CREATING IN THE 3RD DIMENSION AT THE FOURTH DIMENSION.

Perhaps DNA is 5th dimensional.

To me it's obvious that we did not entirely evolve from thunder and sunshine, like a computer cannot just 'come to be'.

It takes an intelligent design somewhere along the line.

A basic law of physics states that, "Any system without work gets more chaotic."

I suppose it would be possible to creat a simple organism that would grow into a mammal over generations - as long as it was encoded in the DNA to do that.

However, from the evidence of the dinasaurs, and what our "folklores" tell us, God created us "in his image",

knowing full well that we could happen upon this "tree of life" (The Human Genome Project - the "Human Tree of Life".)

Our lore tells us that God did not want us to do this,

just as a parent doesn't want a child to do something that can harm him;

and believe me, the potential for harm when speaking of genetic creation, is expontentially larger than we would first contemplate. (So far, we didn't forsee "chimera viruses" - opps!)

But God gave us Pokeymon to practice with, and tv came from somewhere, in part, to sedate our minds."

"random mutation plus natural selection is sufficient to explain the complexity of life on earth." Yes, exactly --- that is the current standard theory.

— realpc

And ID says it isn't sufficient. That is the essential debate.

ID says it isn't sufficient. That is the essential debate.

THE WAY I SEE IT, THERE IS A MORE ADVANCED PERSON(S) - OR ENTITY (IES). CALL HIM OR THEM "GOD", IF YOU LIKE. THEY HAVE LEARNED THE INS AND OUTS OF DNA COMPLETELY. THEY ARE COMPLETE MASTERS OF THE SUBJECT. THEY CREATED US. THE BUILDING BLOCKS THEY USED ARE THE SAME, AND SOME PARTS ARE SIMILAR - HOWEVER NO "LINK" CAN BE FOUND BECAUSE THERE IS NONE. SIMILARITIES CAN GIVE HOPE TO A "LINK', BUT WHO NEEDS A LINK? To clarify: WHEN YOU WERE A KID AND YOU PLAYED WITH YOU ERECTOR SET DID YOU CHANGE YOUR BUILDING JUST ONE PIECE BY ONE PIECE AT A TIME? MAYBE SOMETIMES YOU DID, BUT USUALLY YOU TORE IT DOWN AND CREATED ANOTHER ONE. SOME FACETS WERE THE SAME, BUT A 'MISSING LINK' WAS CERTAINLY NOT EVER TO BE FOUND IF SOMEONE WANTED TO RECREATE BOTH MODELS. AS WE GOT OLDER WE BECAME MORE COMPLEX IN OUR ERECTOR DESIGNS. SOME OF US LOST INTEREST. OTHERS WENT ON TO BECOME ARCHETECTS AND BECAME QUITE PROFICIENT AT CREATING IN THE 3RD DIMENSION AT THE FOURTH DIMENSION.

Ben said: Can you think of any accepted theory, in any field, which is formulated strictly in terms of, "theory X is insufficient to explain the phenomenon, therefore explanation Y is confirmed?" Just one example.

The Council of Europe may justly be renamed as "The European Council for the Advancement of Atheism."

— Dembski

I was under the impression that one of the main qualifications for being Pope was something to do with belief in God.

Re "These distinctions can be subtle."

Oh, you mean there might be two separate Gods who were both the sole creator of the same universe, independently of each other? :D

Henry

This happens when words are too loosely defined. If we're willing to grant multiple gods, then the pope and Dembski believe in different gods. If there's only one, then Dembski believes in it, but the Pope only believes he believes in it. These distinctions can be subtle.

— Flint