Dembski versus Europe

Posted 23 June 2007 by

Logo130X120.jpgAfter lamenting the honorary degree bestowed on Judge Jones, Dembski has set his sights on the Council of Europe who recently released a working document

The theory of evolution is being attacked by religious fundamentalists who call for creationist theories to be taught in European schools alongside or even in place of it. From a scientific view point there is absolutely no doubt that evolution is a central theory for our understanding of the Universe and of life on Earth. Creationism in any of its forms, such as "intelligent design", is not based on facts, does not use any scientific reasoning and its contents are pathetically inadequate for science classes. The Assembly calls on education authorities in member States to promote scientific knowledge and the teaching of evolution and to oppose firmly any attempts at teaching creationism as a scientific discipline.

Dembski was not amused:

The Council of Europe may justly be renamed as "The European Council for the Advancement of Atheism." To believe in a God who acts in the world (aka theism) henceforward constitutes "religious extremism." It will be interesting to see at what point advocacy of ID is regarded in Europe as a "hate crime" against ... science? ... society? ... humanity?

— Dembski
This just after the Discovery Institute were touting the 'expansion' of ID into Europe. What has gone wrong? As a side note, the term religious terrorism was used in the statement but in a rather different context. And neither does the proposal mention that the advocacy of ID is seen as a hate crime as the document is about the dangers of creationism (which includes ID) in education.

Some creationist fundamentalists attack Darwinism and materialism by accusing them of being the "real ideological source of terrorism". "Darwinism is the basis of several violent ideologies that brought disaster to the human race in the 20th century". Is it necessary to point out that human beings did not await the publication in 1859 of Darwin's work The Origin of Species to indulge in a large number of massacres? How many people have died in the name of religious wars? The use of religion, like the reference to social Darwinism by some dictatorial regimes, is insufficient and cannot in any way call into question the theory of evolution or religion.

Of course, Dembski may very well have been annoyed by such observations as:

93. Creationism has many contradictory aspects. The "intelligent design" theory, which is the latest, more refined version of creationism, does not completely deny a degree of evolution. However, this school of thought has hardly provided any fuel for the scientific debate up to now9. Though more subtle in its presentation, the doctrine of intelligent design is no less dangerous.

and

Creationism in any of its forms, such as "intelligent design", is not based on facts, does not use any scientific reasoning and its contents are pathetically inadequate for science classes.

Once at the forefront of the ID movement, Dembski et al, seem to have found his true calling into ridiculing those who are seen standing in the way of the Wedge Strategy. I can understand why it may hurt to see an honorary degree bestowed on Judge Jones whose outstanding and in depth ruling on Intelligent Design served to protect this country from the scientific vacuity of Intelligent Design being taught in public schools. Remember that only a few years ago, Dembski was appointed by Baylor to run a prestigious Center focusing on Intelligent Design issues. Had it not been for some ill-chosen words in an email, Dembski could have been leading the ID movement into the 21st Century. Similarly, Dembski had an opportunity to not only defend ID but also show the flaws with Darwinian theory during the now infamous Kitzmiller trial. One may wonder what the outcome would have been if Dembski had been given the opportunity to apply his revolutionary vise theory? Instead, Dembski is now doomed to live in a "state of scientific purgatory" with global warming deniers, creationists and other 'skeptics' who seem to rely on ignorance rather than knowledge to further their positions. It continues to fascinate me how scientific ignorance and Intelligent Design appear to be correlated in so many more ways. In fact, I'd argue that there is a good opportunity for a 'design inference' here. Shunned by the liberals, shunned by the conservatives, shunned by scientists and shunned by many theologian. It seems that most rational people have come to reject the appeal from ignorance, the vacuous rhetoric and the scientific vacuity of what will forever be known as "Intelligent Design". Intelligent Design, once seen as a hopeful development, has caused itself to self destruct. What remains is an empty shell of rhetoric, a lack of scientific relevance, and a theologically speaking unneccessarily risky and limited approach to religious thought.

In my case my cards have been on the table, my career is ruined so (laughter) it doesn't matter at this point but eh I say just what I want in this regard but it's a real problem.

— Dembski
Dembski lecture at Southern Baptist Theological Seminary in 2003.

167 Comments

Mike Elzinga · 23 June 2007

Well, Dembski can cry all he wants, but as least he as Ann Coulter to snuggle up to.

PvM · 23 June 2007

Or Sal? ;-0

Torbjörn Larsson, OM · 24 June 2007

Seems EC has been getting a lot together lately. It is promising all over.
Or Sal?
Sal is just a heel. But since Dembski has foot-in-mouth disease, he may still think of it as snuggling. And it has always seemed to be a tight fit. Hey, does his case of 'salitosis' explain why Divine wind Dembski most often makes noises at the other end?

stevearoni · 24 June 2007

Dembski wrote: The Council of Europe may justly be renamed as "The European Council for the Advancement of Atheism."

Um, but I thought Bill said that ID wasn't about God. I'm confused again.

Sir_Toejam · 24 June 2007

I'm waiting for Dembski VS. MechaGodzilla

much more entertaining.

sparc · 24 June 2007

I guess WD experienced quite to many narcissistic mortifications since the Dover trial. As the self-proclaimed pope of the ID movement he has to fight on too many fronts simultaneously:
Surrounded by a corona of bootlickers lacking any sign of intellectuality and scientific knowledge he fights with his back to the wall. The DI gang doesn't seam to care too much about his opinions anymore and besides he has to be aware of some antipope who may show up in his own ranks. UD's current appearance is like the Fuehrerbunker in April 45. WD is commanding fantom armies that don't exist and is hoping for something mysterious to happen due to the "Macht der Vorsehung".

harold · 24 June 2007

The decline of aggressive, politically motivated pseudoscience movements appears to be exponential.

Such movements pop up and, as long as the politics that motivate them are perceived as compatible with whatever authoritarian strain is most dominant in their time and place, enjoy a period of positive publicity and fruitful funding. Some of them, like Lysenkoism and eugenicism, succeed in being taught as science at government expense, or used as the rationale for legislation.

In this sense, ID did better than most on the funding side, but not very well on the side of gaining political power.

Eventually, because they are not compatible with evidence, the tide turns against them. Often, as is the case with ID, they also make contradictory claims. It's comical to note that even a couple of days ago they boasted about some "non-religious" musician goofball embracing ID, and today they're pushing the false dichotomy of "ID versus atheism" again. It's not religious, but challenging it makes you against "religion".

Typically there is a rapid drop-off in prestige and popularity once they are adequately challenged in the public sphere.

However, of course, they can't be entirely eliminated. They drop down to what seems like a low steady state, but is actually a state of decline, but at a slow rate of decline. ID seems to have hit this stage.

Behe and Dembski will continue to crank out repetitive books as long as they live, possibly at a diminishing pace, as will other members of the DI gang. Isolated crackpots will continue to stumble on fly-specked books and obscure web sites and believe that they have found "suppressed ancient knowledge". My guess is that it will be around 50-75 years before there really is no fragment or clearly identifiable descendant of the DI left.

But the whole thing will be increasingly irrelevant.

Ron Okimoto · 24 June 2007

Harold wrote:

Behe and Dembski will continue to crank out repetitive books as long as they live, possibly at a diminishing pace, as will other members of the DI gang. Isolated crackpots will continue to stumble on fly-specked books and obscure web sites and believe that they have found "suppressed ancient knowledge". My guess is that it will be around 50-75 years before there really is no fragment or clearly identifiable descendant of the DI left.

There has been some weirdness over at talk.origins that over the last several years one or two posters have claimed that Dembski was going to write 5 holy books that would destroy Darwinism. I don't have links, but they expect 5 books (probably something like the Pentateuch). Apparently with the failure of ID in Ohio, Dover, and the current backpeddling none of the books published so far accomplish that feat, but they still made the claims. Where did such a whack idea get started? Do the Dembski sycophants over at UD ever mention the 5 books? Did Dembski ever claim that he was going to write 5 books on the subject? What books count and when will the fifth book be published?

sparc · 24 June 2007

BTW, seems like rats desert the sinking ship: On the German creationist site Evolution und Schöpfung I found a copy of news article on a talk that the (former?) DI fellow Siegfried Scherer gave for a Christian student group at the University of Kiel. He stated that (translation mine)
"Intelligent design" is not science and shouldn't belong taught in school („Intelligent Design" sei keine Naturwissenschaft und gehöre nicht in den Schulunterricht)
In addition, according to wikipedia Scherer
criticizes the [Discovery] institute's current activities towards implementing Intelligent design in school science curricula by legal means.
I wonder if he would prefer illegal means.

Bob O'H · 24 June 2007

Did Dembski ever claim that he was going to write 5 books on the subject?

Take any 5 from these, as listed in his CV: Books in Preparation Freeing Inquiry from Ideology: A Michael Polanyi Reader, co-edited with Bruce Gordon; an anthology of Michael Polanyi's writings, book under contract with InterVarsity Press. Being as Communion: The Metaphysics of Information, Templeton Book Prize project, book under contract with Ashgate publishers for series in science and religion. John Warwick Montgomery Festschrift Volume (co-edited with Thomas Schirrmacher). The End of Christianity, book under contract with Broadman & Holman. The Mathematical Foundations of Intelligent Design. Technical research monograph. The Nature of Nature, co-edited with Bruce Gordon, conference retrospective on the Nature of Nature conference at Baylor, 12---15 April 2000, book award through Grace Valley Christian Center, Davis, California. The End of Materialism, co-edited collection with Jeffrey Schwartz and Mario Beauregard. The Patristic Understanding of Creation, co-edited with Brian Frederick, anthology of writings from the Church Fathers on creation and design.

Sir_Toejam · 24 June 2007

The End of Christianity

The End of Materialism

"One of these things is not like the others, One of these things just doesn't belong, Can you tell which thing is not like the others By the time I finish my song?"

raven · 24 June 2007

My guess is that it will be around 50-75 years before there really is no fragment or clearly identifiable descendant of the DI left.
Probably just a fond hope. A significant percentage of humans will believe anything no matter how bizarre and disproven. 1. Twenty percent (20%) of the US population still believes the sun goes around the earth. It has been 400 years since Copernicus. The same percentage do not know why a year has 12 months. 2. The HIV deniers are still quoting 20 year old papers, long after the efforts shifted from identification, to treatment, to better treatments, towards a cure. This is a whacky belief that can and sometimes does kill people. 3. There are still germ theory of disease deniers running around. This is another mistaken belief that is potentially lethal. My theory is that these are part of the 50% below median 100 IQers who are not concerned with figuring out how the world works because it is just one big, confusing mystery. The lower limit for any popular belief such as astrology, creationism, geocentrism, etc. seems to be 20-25%.

raven · 24 June 2007

Some of the more educated, and self aware of the lunatic fringers such as creationists probably know it is all nonsense.

But Milton made a great point. "It is better to rule in hell than serve in heaven."

For the leadership it is much easier to push pseudoscience than actually contribute anything to further human progress and well being. We all have to eat and pay bills and how hard is it to pander to the willingly ignorant? It's the difference beween writing for the World Weekly News and The New York Times.

Larry Gilman · 24 June 2007

PvM wrote, "As a side note, the term religious terrorism was used in the statement but in a rather different context." A slip of the keyboard, there: the term "religious extremism," not "religious terrorism," is used in the Council of Europe document. This is the context:

12. The war on the theory of evolution and on its proponents most often originates in forms of religious extremism which are closely allied to extreme right-wing political movements. The creationist movements possess real political power. The fact of the matter, and this has been exposed on several occasions, is that the advocates of strict creationism are out to replace democracy by theocracy.

— Council of Europe
All fair enough. The reference to "strict creationism" lets the IDers partly off the hook. Though not insofar as they rub elbows with the Christian Dominionists, who are, of course, religious extremists as surely as the Taliban. Larry

William E Emba · 24 June 2007

Twenty percent (20%) of the US population still believes the sun goes around the earth. It has been 400 years since Copernicus. The same percentage do not know why a year has 12 months.

— raven
OK, I'll bite. Why does a year have 12 months?

Thought Provoker · 24 June 2007

OK, I'll bite. Why does a year have 12 months?

It has something to do with the moon. BTW, does anyone know if that is we "13" is consider an evil number. God's plan was 12, evil worshippers think it is closer to 13.

Thought Provoker · 24 June 2007

Should read...

BTW, does anyone know if that is why "13" is considered an evil number?

(please excuse me, I R A Eenginear)

Jim Wynne · 24 June 2007

The praise for Jones has always amused me; all the talk of his brillinat decision and the like. Of course, the talk about plagiarism was stupid, a Judge can certainly use the contibutions of the opposing parties, but the point is that he did not write the decision. The plaintiffs did. Any law clerk could do it, and probably did

— Two L
I think that the two words that summed up the defendants' case best came from Jones: "Breathtaking inanity."

PvM · 24 June 2007

A slip of the keyboard, there: the term "religious extremism," not "religious terrorism," is used in the Council of Europe document. This is the context:

Big difference though.

raven · 24 June 2007

raven wrote: Twenty percent (20%) of the US population still believes the sun goes around the earth. It has been 400 years since Copernicus. The same percentage do not know why a year has 12 months.
That was clumsy wording on my part. The real question was, "How long does it take the earth to go around the sun?" and one choice was 12 months. A month is a human calendar construct although it is loosely based on the lunar calendar. But they are designed to add up to 365 days, the time it takes for the earth to orbit the sun once.

George Cauldron · 24 June 2007

The praise for Jones has always amused me; all the talk of his brillinat decision and the like. Of course, the talk about plagiarism was stupid, a Judge can certainly use the contibutions of the opposing parties, but the point is that he did not write the decision. The plaintiffs did. Any law clerk could do it, and probably did

Larry, quit pretending to be a lawyer and take your meds. You're embarrassing your whole family.

anonymous · 24 June 2007

"Twenty percent (20%) of the US population still believes the sun goes around the earth. It has been 400 years since Copernicus. The same percentage do not know why a year has 12 months."

Since I still have some ounce of hope for humanity, I don't want to believe this. Where did the statistic come from?

raven · 24 June 2007

Since I still have some ounce of hope for humanity, I don't want to believe this. Where did the statistic come from?
The latest Gallup poll, GSS, general social survey. On PZs blog (pharyngula), he mentioned it on June 7 and June 8, 2007. There are links you can follow to get to the various sections. The numbers are real, double checked, not made up. Factoids that tell one a lot about the state of the US population.

harold · 24 June 2007

Raven -
Some of the more educated, and self aware of the lunatic fringers such as creationists probably know it is all nonsense. But Milton made a great point. "It is better to rule in hell than serve in heaven."
With this I very strongly agree. That's why, when I discuss the apparently questionable sincerity and not-so-secret authoritarian fantasies of the type of creationists we deal with here, I'm always careful to differentiate them from people whose traditional beliefs may happen to overlap with YEC, but who aren't directly trying to suppress scientific education or force their own beliefs into taxpayer funded public schools. (Of course, I disagree with all science-denying beliefs and encourage people not to base their religion on the denial of science, but there's a big difference.) I've never met anyone who told me that they thought the sun went around the earth, and I've worked at some of the worst jobs you can imagine. I wonder if 20% includes the number of people who misread questions, take polls intoxicated, etc. I'm not a big believer in the concept of a single, general trait that can reasonably be called "intelligence" (which does not mean I'm "against" IQ tests, they're very useful in a number of clinical and educational situations), but at any rate, when it comes to stuff like ghosts, astrology, and the like, I've known many people who were highly educated and intelligent by any standards, by no means all of them American or Canadian, who claimed to believe in such stuff. The way I see it, such stuff isn't the equivalent of creationism, because it doesn't outright deny existing science.

realpc · 24 June 2007

"To believe in a God who acts in the world (aka theism) henceforward constitutes "religious extremism.""

Yes, since when is it extreme fundamentalism just to believe in god?

Those who oppose ID equate it with creationism because creationism is easy to disprove. People who believe the bible is literally true are, almost always, unsophisticated and uneducated. They have not a shred of evidence to back up their belief.

ID is not creationism. The ideas behind ID are unrelated to Christianity, or any particular religion. ID is just as compatible with Buddhism, deism, atheism, animism, theism, etc., as it is with Christianity.

Saying that a purely mechanistic process does not adequately explain evolution is a far cry from saying the ancient Israelites' god created the world in six days.

There may be fundamentalist literalist Christians who believe in ID. There are probably many more who have no idea what ID is.

There are Catholics who believe in ID, but most are probably not creationists. The Catholic church has endorsed evolution theory.

It is extremely uncommon for educated people to be bible literalists (creationists). And only educated people are aware of the subtleties of the NDE - IDE controversy.

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution.

Calling ID creationism is deliberately misleading.

David B. Benson · 24 June 2007

raven --- 365 and one-quarter, approximately...

;-)

harold · 24 June 2007

William E. Emba and Thought Provoker -

First of all, I'm sure the reference to 12 months was a typo and what was meant was the four seasons of temperate climates, which have a physical explanation.

I assume that TP is alluding to the fact that if we divided the solar year into 13 months of about 28 days each, we could allign them to lunar cycles, with a bit of fiddling with the details, but 12 months doesn't allow us to do that.

Anyway, lunar cycles aside, the number of months we divide the year into is arbitrary. We inherited the 12 month calender from the Romans, who once used a ten month calender, but switched to 12 at an early date in their history (not so early in human history). According to legend, it was the idea of Numa Pompilius.
http://en.wikipedia.org/wiki/Numa_Pompilius

Ancient societies used 12 a lot, presumably because it's easily subdivided into integers. The Romans may actually gotten the 12 month idea from any number of other ancient societies for all I know. That may be why 13 is sometimes considered unlucky, although then again, sometimes it's considered lucky.

Henry J · 24 June 2007

The same percentage do not know why a year has 12 months.

Didn't there used to be ten, til some Romans inserted two more named after a couple of their emperors? I recall that being an explanation of why the 10th-12th months are named using prefixes for 8th-10th.

BTW, does anyone know if that is why "13" is considered an evil number?

Going on memory (which could be wrong), I think it might be the day of the month on which the Crucifixion was thought to have happened. Henry

raven · 24 June 2007

I'm going to give my source for the Gallup GSS data. It is from a blog called orgtheory. I gather some people can't quite comprehend how little some people know about the world. It is below, interpret it how you like. Source is http://orgtheory.wordpress.com
Eppure si muove...or does it? June 6th, 2007 Omar Just got an email reminder from the ICPSR data archive yesterday that the 2006 GSS data are out and ready to play with. Always curious to know what's happening with my favorite survey of the attitudes and behaviors of the American population I looked around the codebook to see what was new for 2006. Among the highlights, there is (1) a module designed to estimate global characteristics of the social networks of the American population using a cutting edge method based on asking people questions of the type: "How many people do you know...(named Jeff, in Prison, who can do a somersault, who eat hamburgers, etc. [see Zheng et al 2006] and see also a copy of the proposal of the GSS module designed to measure "network polarization" in the American population in order to see if it is related to "cultural polarization") and (2) a "science" module designed to measure the scientific knowledge of the American population. My guess is that (1) will produce the most fascinating and scientifically interesting results, and (2) will of course provide fodder for the constant complaints (and jokes) about the utter mental dullness of the population. A case in point is the following. The GSS folk actually made the mistake of asking the following question as part of their science module: Now, does the Earth go around the Sun, or does the Sun go around the Earth? Here we go. Now what follows is real social science data folks. No joking around: Earth around sun 73.6% Sun around earth 18.3% Don't Know 8.0% Refused 0.1% Yes. More than a fifth of the American population does not think (or are not quite sure) that they live in Copernicus' heliocentric solar system. Is this a glass half-full or glass half empty thing? Well, those glass half-full people might say, almost three-quarters of the population got the right answer. But the GSS questionnaire designers conspire against your carefree optimism half-glass full guy or gal. Among those who were up to date with seventeenth-century Galilean basic science, they actually dared to ask the follow-up question: How long does it take for the Earth to go around the Sun: one day, one month, or one year? One day 19.0% One month 1.1% One year 71.2% Other time period 0.1% Don't Know 8.5% Refused 0.1% Barring that guy who categorically refused to answer the question, we are again faced with the result that a full one-fifth of those in the American population who are aware that the earth revolves around the sun are in their turn unable to distinguish the earth's rotation around its axis from a full revolution around the sun. Poor Galileo; talk about reason to turn in your grave.

harold · 24 June 2007

realpc -
The ideas behind ID are unrelated to Christianity, or any particular religion. ID is just as compatible with Buddhism, deism, atheism, animism, theism, etc., as it is with Christianity.
First of all, you aren't a real ID advocate yourself, your ideas would be rejected by the membership of and contributors to the DI - possibly to the extent that you'd be tied to a stake long before any scientists, if they had real power. Nevertheless - IF THIS IS TRUE, WHY DO THEY, AND YOU, ALWAYS REFER TO ITS OPPONENTS AS "ATHEISTS"?? It would be most amiss of you to reply to this post without answering this very prominent question. Technically, I'm not an atheist, by the way.
It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution. Calling ID creationism is deliberately misleading.
I'm not sure if you understand how disingenuous or misinformed this is. ID did not occur to anyone spontaneously, and it doesn't make any sense. It is nothing more than an attempt to "court proof" creationism in public schools. The central arguments of ID attempt (and fail) to show that biological evolution is impossible and features of life must be magically created. That's creationism.

pigwidgeon · 24 June 2007

ID is creationism, as evidenced by the drafts of the Pandas textbook which show that ID can be defined simply by getting the textbook definition of creationism and substituting in 'intelligent agency' and so forth. But I think you know this.

ID is actually not fully compatible with all religions, as Richard B Hoppe showed. ID makes the assumption that only ONE designer is responsible. RBH showed that this is unreasonable and that multiple designers makes far more sense - and of course, this implies polytheism. Yet the ID community has made no effort to embrace Richard's theory, for which he has even suggested avenues of research (ID currently has none). Why do you suppose that is?

What I hate about ID people is that they are preying on good faith. It is polite to think the best of people and assume one isn't being deceived, but ID people have pushed it far too far. They've gone beyond the boundaries of good faith. Why should we believe they have any intention of honesty any more? It takes a lot of good faith just to assume that the same guys behind creationism really AREN'T pulling a scam when they come up with ID. We gave them that chance. We asked for the science they claimed they had. It didn't come. It currently does not exist. The pathetic attempts to justify ID that they have produced are useless, or riddled with flaws that even I can see (we can't identify the designer, yet we can predict junk dna? And we're supposed to let them get away with that? This is one of the cornerstones of their theory!)

ID an alternative to evolution? Don't make me laugh. It explains nothing about evolution. It explains nothing at all. That people are even still arguing about it is a testament to the spin ability of the DI, because ID is the most childish smoke... it's barely a sentence, let alone a science! 150 years of evolution is supposed to step aside to make way for some guys saying that biology looks designed, but we don't know how, why, when, who by? Why on earth are we still giving this playground nonsense any credit? It has no substance! If I asked to be allowed to build a skyscraper and told you that my experience in the field was a Lego kit, would you let me? You should if you take ID seriously. At least I can build things from Lego. ID can't even answer any questions.

realpc · 24 June 2007

"ID makes the assumption that only ONE designer is responsible. RBH showed that this is unreasonable and that multiple designers makes far more sense - and of course, this implies polytheism."

We happen to live in a monotheistic culture so some IDers may have implied that. I don't know. But there is nothing in ID theory about how many designers there might be. Nothing in ID pretends to answer questions that are theological and outside the realm of science.

And arguments about whether god is one or many seem very silly to me anyway. Certainly, if there is a god, it's capable of multiplying itself. Why would a god be subject to the same spatial and temporal restrictions as we are?

PvM · 24 June 2007

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution. Calling ID creationism is deliberately misleading.

— Realpc
No, calling ID a theory of evolution is deliberately misleading, calling ID creationism is a well established fact.

Paul Burnett · 24 June 2007

"Had it not been for some ill-chosen words in an email, Dembski could have been leading the ID movement into the 21st Century." Please forgive my ignorance, but what were Dembski's "ill-chosen words"?

PvM · 24 June 2007

After Dembski was awarded directorship of the Center at Baylor, he sent out an email

William Dembski Press Release by William Dembski October 17, 2000 The Michael Polanyi Center Peer Review Committee has now released its official report (http://pr.baylor.edu/pdf/001017polanyi.pdf) and the Baylor University administration has responded to the report (http://pr.baylor.edu/feat.fcgi?2000.10.17.polanyi). As director of the Center, I wish to offer the following comment: The report marks the triumph of intelligent design as a legitimate form of academic inquiry. This is a great day for academic freedom. I'm deeply grateful to President Sloan and Baylor University for making this possible, as well as to the peer review committee for its unqualified affirmation of my own work on intelligent design. The scope of the Center will be expanded to embrace a broader set of conceptual issues at the intersection of science and religion, and the Center will therefore receive a new name to reflect this expanded vision. My work on intelligent design will continue unabated. Dogmatic opponents of design who demanded the Center be shut down have met their Waterloo. Baylor University is to be commended for remaining strong in the face of intolerant assaults on freedom of thought and expression.

Soon thereafter,

Some faculty members expressed "deep, genuine concern" after receiving an e-mail from the director of the Michael Polanyi Center a day after a report affirmed the center's legitimacy and credibility, according to the chairman of the Faculty Senate. A report was released Tuesday by a committee appointed to review the operation of the center. The committee was comprised of eight scholars from across the country and led by Dr. William F. Cooper. In response to that report, Dr. William Dembski issued the following statement: "The report marks the triumph of intelligent design as a legitimate form of academic inquiry. This is a great day for academic freedom. I'm deeply grateful to President Sloan and Baylor University for making this possible, as well as to the peer review committee for its unqualified affirmation of my own work on intelligent design. The scope of the Center will be expanded to embrace a broader set of conceptual issues at the intersection of science and religion, and the Center will therefore receive a new name to reflect this expanded vision. My work on intelligent design will continue unabated. Dogmatic opponents of design who demanded the Center be shut down have met their Waterloo. Baylor University is to be commended for remaining strong in the face of intolerant assaults on freedom of thought and expression." Chairman of the Faculty Senate, Dr. Jay Losey, said that "anyone can look at the review and also at Dembski's e-mail and make a personal judgment for themselves." "However, I will say there is deep, genuine concern on the part of Baylor faculty regarding some of the statements made in the e-mail," Losey said. "Deep, genuine concern." Attempts to reach Dembski at his office Wednesday were unsuccessful.

Soon thereafter he was director no more

William Dembski was relieved of his duties as director of Baylor University's Michael Polanyi Center today. He will remain associate professor in conceptual foundations of science within the university's Institute for Faith and Learning. The action follows by two days the release of a peer review committee's report on the Polanyi Center that affirmed the academic work of the center while calling for the appointment of a faculty advisory committee and the dropping of the Polanyi name. "The theme of the report emphasized the need for the individuals associated with the center to work in a collegial manner with other members of the Baylor faculty," said Dr. Michael Beaty, director of the Institute for Faith and Learning, which houses the center. "Dr. Dembski's actions after the release of the report compromised his ability to serve as director." Dr. Bruce Gordon, associate director of the center, has been appointed interim director of the program. Gordon holds a Ph.D. in the history and philosophy of physics from Northwestern University, as well as degrees in mathematics, philosophy, theology and piano performance. He was recently a postdoctoral fellow of the Center for Philosophy of Religion at the University of Notre Dame, and is presently at work on a series of articles leading to a book on the metaphysical import of quantum statistics.

Dembski released another press release

Baylor University President Robert Sloan has removed me as director of the Michael Polanyi Center despite his having personally solicited me to come to Baylor and establish the Center as a means of furthering work on intelligent design. Some Baylor faculty have exerted enormous pressure on Baylor to disassociate the university from me and my research. Earlier President Sloan had properly characterized these efforts as "intellectual McCarthyism." Because I released a press statement [see above] applauding the results of the peer review committee that passed upon and approved the academic soundness of my work, I am now being labeled as not "collegial" and the statement is said to have fatally compromised my ability to serve as Director. My press release allowed me publicly to state my full support for the results of the peer review committee report. Having made that statement, I then expected to proceed full steam ahead to implement the committee's recommendations by expanding the scope of the center while still focusing my own research on intelligent design -- just as the peer review committee recommended and President Sloan agreed. Instead, I was informed that my press release created a "firestorm" on campus. Shockingly, the administration formally asked me to retract my press release. I explained that the press release accurately conveyed how I perceived the outcome of the peer review committee and that for me to retract it would be tantamount to giving in to the censorship and vilification against me that had been a constant feature since I arrived on campus. I could not and would not betray all that I have worked for in my professional career. In the utmost of bad faith, the administration claimed my refusal to retract my press release constituted a lack of collegiality on my part and charged that this compromised my ability to serve as director, thereby providing the fig leaf of justification for my removal. Intellectual McCarthyism has, for the moment, prevailed at Baylor. The announcement of my removal from the Polanyi Center directorship states that I am to be kept on in my capacity as an Associate Professor in Baylor's Institute for Faith and Learning. I look forward in that capacity to continuing to work on intelligent design and its implications.

Those were the two days in october 2000 when Dembski was given the opportunity to take ID to great news heights via the Baylor Center. Alas... History shows how Waterloo can be a self fulfilling prediction.

Sir_Toejam · 24 June 2007

that was a nice trip down memory lane, Pim.

I had forgotten all about that stuff.

thanks

Richard Simons · 24 June 2007

there is nothing in ID theory about how many designers there might be. Nothing in ID pretends to answer questions that are theological and outside the realm of science.
There is nothing in ID theory. Unless perhaps you would like to reveal to everyone just what the theory of ID is? Remember, a theory is an explanation for observations that has been tested by making predictions that were later validated, and enables further testable predictions to be made. In other words, it must be refutable.

Sir_Toejam · 24 June 2007

"Had it not been for some ill-chosen words in an email, Dembski could have been leading the ID movement into the 21st Century."

true. after all, it doesn't require much horsepower to haul an empty trailer.

Science Avenger · 24 June 2007

The Troll is quotemined thusly: But there is nothing in ID theory... Nothing in ID pretends to answer questions...
By George he finally got it right.

ben · 25 June 2007

Saying that a purely mechanistic process does not adequately explain evolution is a far cry from saying the ancient Israelites' god created the world in six days.
It's also a far cry from making any positive assertion at all, something ID declines ever to do. It's the same old false dichotomy, presenting bogus criticisms of one theory as if they somehow provide evidence for an opposing conjecture. No thanks.
ID is not creationism. The ideas behind ID are unrelated to Christianity, or any particular religion. ID is just as compatible with Buddhism, deism, atheism, animism, theism, etc., as it is with Christianity.
In that case I suppose it is just an incredible coincidence that 99% of IDers are fundamentalist Christians foaming at the mouth for the opportunity to impose their kooky religious beliefs on others (the other 1% being contrarian cranks who will assert any wacko conjecture that will draw attention to them and make them appear they're fighting the good fight against a corrupt establishment).

ben · 25 June 2007

Calling ID creationism is deliberately misleading.
Perhaps you should take that argument to the ID blogs and ask the cdesign proponentsists why they got so confused between the two awhile back ("awhile back" = "at the precise moment SCOTUS banned the teaching of creationism in US public schools").

Torbjörn Larsson, OM · 25 June 2007

when it comes to stuff like ghosts, astrology, and the like, I've known many people who were highly educated and intelligent by any standards, by no means all of them American or Canadian, who claimed to believe in such stuff. The way I see it, such stuff isn't the equivalent of creationism, because it doesn't outright deny existing science.
I certainly agree with your premise that there is a difference between fundamentalism, whether organized socio-political or unorganized, and more vague or sloppy beliefs. However, a slippery slope is dangerous, and I prefer to delimit the problem as much as possible. For example, astrology is outright denying science whether we discuss the family friendly version who believes in certain correlations that isn't there or we discuss the full blown action-at-a-distance kind. This is btw the main reason theistic evolution is problematical, it is a slippery slope, most or all versions outright deny existing science and most or all versions are indistinguishable from creationism.
ID is not creationism.
I would like to complement harold's and others excellent explanations with the observation that ID is creationism in two categories, as a socio-political movement and as a theological/philosophical view.
ID makes the assumption that only ONE designer is responsible. RBH showed that this is unreasonable and that multiple designers makes far more sense
The main thing that shows that MDT is a real theory that replaces the SUDID of primitive creationism is that it is possible to detect differences between different designers. If I am not mistaken, literature history and criminology has used similar methods for a long time now, and the result to date is that multiple designers are always observed. :-) The problem for ID is, as RBH points out, that there is no theory to test similarly.

Ian · 25 June 2007

"Poor Galileo; talk about reason to turn in your grave."

Ah, but is Galileo rotating about his grave or is his grave rotating about him?!!

Nigel D · 25 June 2007

OK, realpc, I'll bite...

"To believe in a God who acts in the world (aka theism) henceforward constitutes "religious extremism."" Yes, since when is it extreme fundamentalism just to believe in god?

— realpc
Dembski is erecting another straw man here. It is not extreme fundamentalism to believe in god. The EC statement claims no such thing; this is Dembski's misrepresentation of the position in the statement. It is, however, extreme fundamentalism to reject an extremely large corpus of high-quality science to have one's own religious version taught in its place.

Those who oppose ID equate it with creationism because creationism is easy to disprove. People who believe the bible is literally true are, almost always, unsophisticated and uneducated. They have not a shred of evidence to back up their belief.

A couple of points here that seem to have evaded you: (1) ID is easy to disprove, because any line of reasoning from an object to a conclusion about whether or not it was designed perforce involves some assumptions about the intent of the design. This is inescapable. The argument is therefore an empty one, even on purely logical grounds. This was pointed out in, I believe, the 1820s, as a rebuttal of Reverend Paley's original "design inference". (2) ID has proved itself to have creationist roots. It has religiously-motivated backing. Its principal statement of strategy specifically describes replacing "materialistic" approaches to the world with religiously-based ones. Dembski calls the critics of ID "atheists" as if this somehow invalidates their criticism. When quizzed about the designer, the ID advocates are so careful to say it could be God, but it might not be, yet if you take this to its logical conclusion (i.e. what if the designer is not God? If not, then who designed the designer?), then the theory becomes circular and disappears in infinite regression.

ID is not creationism.

As formulated by Behe, Dembski, Wells et al., yes it is. The ID advocates claim that evolution cannot explain how many modern species or morphologies have arisen. In the absence of common descent and natural selection, some species must have been "created" in some fashion. If you consider the "evolution is God's toolkit" hypothesis, this is not ID, but theistic evolution.

The ideas behind ID are unrelated to Christianity, or any particular religion.

Yeah, sure, as long as it is a monotheistic religion, the IDists are happy. ID has a very big tent. Note that the ID crowd has not embraced the theory of multiple designers, which actually fits the evidence rather better than "one-designer" ID.

ID is just as compatible with Buddhism, deism, atheism, animism, theism, etc., as it is with Christianity.

In principle you may be right, but this is not what Dembski et al. actually propose. And see above re the theory of multiple designers.

Saying that a purely mechanistic process does not adequately explain evolution is a far cry from saying the ancient Israelites' god created the world in six days.

True, but of no relevance. ID proponents claim that the gaps in evolutionary explanations represent evidence for something else, which is simply false. Furthermore, their critiques of evolutionary theory always employ strawmen, misrepresentation, obfuscation and woeful ignorance to put forth arguments against modern evolutionary theory. They then claim that this represent evidence in favour of ID, which precludes the simple null hypothesis of "we don't know yet". And any scientist will tell you that "we don't know yet" is a fairly reliable tried and tested hypothesis.

There may be fundamentalist literalist Christians who believe in ID. There are probably many more who have no idea what ID is.

But this is not relevant to Dembski's statements on ID.

There are Catholics who believe in ID, but most are probably not creationists.

And there are probably Catholics who have no idea how car engines work, either. How is this relevant? Those Catholics who do believe in ID have probably been seduced by the apparent simplicity of the arguments. If you look through the ID books, there are many places where the authors seem to be very convincing, unless one has prior knowledge on which to base an independent judgement.

The Catholic church has endorsed evolution theory.

But this in no way guarantees that any specific Catholic will actually understand evolutionary theory, does it?

It is extremely uncommon for educated people to be bible literalists (creationists).

Biblical literalism is a logically untenable position, since different parts of the Bible contradict one another. Not all creationists are Biblical literalists. Old Earth Creationists and "Day-Age" Creationists accept most of what geology and physics tell us, but may still deny biological evolution. Yet these people are not Biblical literalists.

And only educated people are aware of the subtleties of the NDE - IDE controversy.

I have no idea what "IDE" or "NDE" are, but I assume you refere to evolution vs. ID. There isn't really much subtlety involved, I'm afraid. The ID proponents all too often misrepresent what evolutionary theory actually claims. They set up these straw men and demolish them to convince the credulous and the ignorant. By appealing directly to the lay audience, they bypass any knowledgeable criticism of their arguments. When criticism is presented to them, they ignore it, or respond with empty rhetoric. The theory of evolution, in its modern form, contains much subtlety, and there are aspects of it that are difficult to understand. This is what gives the ID proponents an easy job. Real science is left behind, because there are so few people with the time and understanding to rebut the anti-science arguments and keep ID where it belongs.

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution.

Not so; instead it is a scientific theory (that has withstood test after test for over 150 years) versus a complete absence of scientific honesty, intellectual rigour and any support from the evidence.

Calling ID creationism is deliberately misleading.

So, how would you describe the "designer" then? Because if natural processes cannot account for the existence of every last species alive today, we are left with some form of special creation. If natural processes cannot account for the diversity of life, we are left only with supernatural ones. If that does not imply creationism, then what is the alternative? Modern evolutionary theory describes several natural mechanisms that together can account for all of the diversity, similarity and complexity of life as we find it today.

Gerard Harbison · 25 June 2007

Well, Dembski can cry all he wants, but as least he as Ann Coulter to snuggle up to.

Shudder! Could we be careful with the mental images we generate, please?

Gerard Harbison · 25 June 2007

Well, Dembski can cry all he wants, but as least he as Ann Coulter to snuggle up to.

— Mike Elzinga
Shudder! Could we be careful with the mental images we generate, please?

ben · 25 June 2007

Mike Elzinga wrote: Well, Dembski can cry all he wants, but as least he as Ann Coulter to snuggle up to.
Shudder! Could we be careful with the mental images we generate, please?
Imagine that adam's apple on that lovechild. Someone could lose an eye. Sorry.

harold · 25 June 2007

Torbjorn Larsson - Incidentally, apologies for my many past mis-spellings or your name, and my current failure to use the accent.
However, a slippery slope is dangerous, and I prefer to delimit the problem as much as possible. For example, astrology is outright denying science whether we discuss the family friendly version who believes in certain correlations that isn't there or we discuss the full blown action-at-a-distance kind. This is btw the main reason theistic evolution is problematical, it is a slippery slope, most or all versions outright deny existing science and most or all versions are indistinguishable from creationism.
I think we may have some disagreements, but that they are largely either semantic, or related to very subtle "philosophical" distinctions. Crudely put, I see three distinct relationships with science. 1. One can try to very carefully limit one's beliefs to that which can be verified by science, and there is nothing wrong with that. I would argue that there are some aspects of private conscious experience which are so poorly amenable to the techniques of current scientific study that this ambition can never be fully achieved, but I have no problem with it, and this philosophical approach is entirely consistent with what I consider an ethical life. 2. Many people tend to embellish scientific reality, without denying, in my view, underlying established science. Extreme examples of this are viewed, probably correctly, as "unscientific". Nevertheless, here you and I have a subtle difference of opinion. I don't consider the belief in "something extra", in every case, to constitute dishonest denial of what is. I don't see this as being along a continuum with lying creationism and the like, I see a clear qualitative distinction. For me, by definition, the term "theistic evolution" refers to a full understanding and acceptance of evolutionary biology by someone who has some irrelevant (in this context) theistic belief as well. This could include some variant of the never-testable philosophical belief that God or some such entity in some way, at some time, intended, planned, or anticipated that evolution would lead to humans, consciousness, or whatever. For me, any creationist claim, broadly defined (any strong claim that natural processes can not explain the evolution of cellular and post-cellular life, or any strong claim that life could never haver originated naturally) renders the claimer a "creationist" (and thus dishonest or ill-informed), rather than a theistic evolutionist. I tend to consider myself a theistic evolutionist, but of the least theistic possible sort :-). I suppose I see the "truth" as consisting of 99% "1)" and 1% some of the least irrational elements from "2)". My extreme curiousity may bias me by making me somewhat interested, not in extra-scientific beliefs as sources of knowledge per se, but in their structure and why people choose them. I suppose, philosophically, I'd best describe myself as an "existentialist Unitarian Universalist". I tend to see some of the dharmic traditions, such as zen, (embellished as they may be with cultural artifacts) as more compatible with the universe that is revealed to us than the Western traditon "strong atheism". 3. Then there are those who lie about what has been measured, and about logic. ID/creationism, HIV-denial, holocaust revisionism, climate change denial, and so on. I see this type of dishonesty as qualitatively distinct. I don't see a "spectrum" with Ken Miller and Dalai Lama at one end and Ken Ham at the other, I see a dividing line, with Ken Miller and the Dalai Lama on the good side, and Behe, Dembski, Ham, and the like firmly on the bad side.

Raging Bee · 25 June 2007

RealPretentiousNewAgeTool: if "ID is not creationism," then please explain the significance of the phrase "cdesign proponentsists."

Glen Davidson · 25 June 2007

It is not evolution vs creationism, it is one theory of evolution vs another theory of evolution.

Gee, then why is it called "Intelligent Design"? Is "design" a form of evolution? And can you even understand normal English?

Calling ID creationism is deliberately misleading.

When I design I do it in order that I might create, you obtuse thing. Of course it's more complicated (mostly in a very dishonest way), but the very word "design" leads one to envision creation, not evolution as such (more like Behe's successive creation events (which he seems to prefer now), interspersed with relatively inconsequential evolution). We know the level of dishonesty in ID, and how you repeat these dishonest claims ad nauseum. Doesn't change the fact that the only thing you guys do in favor of your "science" is to try to manipulate the language and misrepresent your purposes. Glen D http://tinyurl.com/35s39o

realpc · 25 June 2007

"The ID advocates claim that evolution cannot explain how many modern species or morphologies have arisen."

No they claim that RM + NS is not adequate to explain evolution. They accept evolution, but deny that the neo-Darwinist theory completely explains it.

ND is a particular theory of evolution. But "evolution" is often used as a synonym for ND because ND has dominated for so long.

I don't think you can find a serious ID researcher who denies evolution. They just believe in evolution as a purposeful, guided, creative process.

ND says evolution is a blind, mindless, unintentional, process.

The essential debate is philosphical -- is life inherently meaningful, or meaningless? Is the universe alive or dead?

This is hard, maybe impossible, to answer scientifically. ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity.

So let them give it a shot.

It may turn out to be the sort of question that science and math are not really up to answering. And if that's the case, each of us can make up our own mind how to look at life and the universe.

Right now neither team -- NDE or IDE -- can prove its case. I think we should stay open-minded and curious. All that bashing and insulting is not going to help your cause.

Gerard Harbison · 25 June 2007

I don't think you can find a serious ID researcher who denies evolution.

— realpc
Fixed it for you.

Laser · 25 June 2007

I don't think you can find a serious ID researcher who denies evolution. They just believe in evolution as a purposeful, guided, creative process.

That's simply not true. First, as Gerard points out, there are no ID researchers. Second, many ID proponents do deny evolution.

ND says evolution is a blind, mindless, unintentional, process.

Not even close. Do us a favor and do some reading, would ya? Start with Origin of Species.

David Stanton · 25 June 2007

realpc wrote:

"This is hard, maybe impossible, to answer scientifically. ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity.

So let them give it a shot."

Fire away. That is the beauty of science. Anyone can demonstrate anything they want at any time. They just have to have evidence. So far Dembski, even though he can print anything he wants to in any book he publishes, has utterly failed to convince anyone of anything. Of course proving a negative can be really tough, but then again he is the one who has chosen this approach. And no matter what mathematics tells us about what is or is not possible, all the evidence must still be explained.

jasonmitchell · 25 June 2007

re the nature of 13 being unlucky :
(from my memory of folklore)
"back in the day" some people counted on their fingers 1-10 and got to 12 by counting both feet - therefore 13 is unlucky because it was beyond their arithmetic. (alternately I heard this tale as 13= unlucky because only men could count to 13 and that part is "dirty/ evil")

Richard Simons · 25 June 2007

Right now neither team --- NDE or IDE --- can prove its case.
A nice little challenge for you: choose any scientific theory you like and explain how it could be proven. Perhaps at the same time you'd like to give us an example of a scientific theory that you consider to be more strongly demonstrated than the theory of evolution.
is life inherently meaningful, or meaningless?
Christians often claim that the existence of God gives meaning to life, the universe, everything, but there's something that's never been clear to me. Even if there is a god, what exactly is the meaning (or purpose) of the universe? Are we God's equivalent to an ant farm? It has always sounded to me like one of those formulaic expressions that means nothing.

Glen Davidson · 25 June 2007

re the nature of 13 being unlucky : (from my memory of folklore) "back in the day" some people counted on their fingers 1-10 and got to 12 by counting both feet - therefore 13 is unlucky because it was beyond their arithmetic. (alternately I heard this tale as 13= unlucky because only men could count to 13 and that part is "dirty/ evil")

Interesting. However, the fact that there are 12 months, or moons, in the year (at least to as closely as we can match up lunar and solar cycles--the "lunar year" is around 11 days shorter than the solar year, I believe) probably has more responsibility for the sacredness of the number "12". Thirteen can be seen as an illegitimate addition to "12", or possibly as a "blasphemous" addition of the sacred number "7" (number of "planets" known to the ancient world) and the unholy (one less than "7") number "6". There's an alternative idea, however, which is that at least in some cultures "13" was a sacred number, and as the Abrahamic religions with their sacred number "12" (and don't forget, the "Hebrew calendar" used for timing holy events in Judaism is still lunar) encountered cultures where "13" was sacred, the true believers naturally assumed that "13" was demonic, Satanic, whatever. None of these ideas is mutually exclusive (the counting explanation could complement the reasoning from the lunar year---or vice versa), nor do they exhaust the possibilities. Glen D http://tinyurl.com/35s39o

harold · 25 June 2007

realpc -

You seem to have many misconceptions about evolution, as well as about ID.

Let's start with evolution.

CAN YOU EXPLAIN THE THEORY OF EVOLUTION IN YOUR OWN WORDS?

Please, please, please?

I'm going to keep asking. Hope you don't mind.

I'm helping you. After all, it's kind of silly to argue against something, when what you're actually arguing against is your own misconceptions.

Let's see what you think the theory of evolution says, and then maybe we can clear up some misconceptions.

Nigel D · 25 June 2007

"The ID advocates claim that evolution cannot explain how many modern species or morphologies have arisen." No they claim that RM + NS is not adequate to explain evolution. They accept evolution, but deny that the neo-Darwinist theory completely explains it.

— realpc
First off, let me straighten you out on some terminology. "Random" mutation and natural selection are two of several mechanisms that form a part of meodern evolutionary theory. When I use the term "evolution", and in most of the contexts in which I see that term, it means "modern evolutionary theory". It has a second meaning, that of "change over time", in which it is also used. However, for the sake of simplicity, I use it only in its first meaning in discussions such as this one. Additionally, the "neo-Darwinist" theory is about 70 or 80 years out of date. "Neo-Darwinism" is a term that was coined back in the 1920s / 1930s to indicate Darwinian theory modified by an understanding of Mendelian inheritance. But this has been superseded several times since then, so is no longer of any relevance. Finally, Dembski et al. frequently misrepresent evolutionary theory as if it were nothing more than "random" mutation and natural selection. Have you never heard of genetic recombination, neutral genetic drift or sexual selection? These are other processes that form a part of modern evolutionary theory. So, when I say that Dembski rejects evolution, I mean he rejects modern evolutionary theory. Which is true. What he accepts is a pale shadow of evolution, comprising no more than RM + NS, and it seems that he accepts it for two reasons: (1) he has found the evidence to support both sufficiently compelling that he cannot argue against them; and (2) it suits him to assemble RM + NS into a straw man that he can then demolish in specific chosen examples.

ND is a particular theory of evolution.

No. (I assume that's a typo and you meant NS). NS is a mechanism by which evolution occurs. It is one of several.

But "evolution" is often used as a synonym for ND because ND has dominated for so long.

Not here, and not by me. "Evolution" as a term used by biological scientists often refers to modern evolutionary theory taken as a whole: "random" mutation; natural selection; genetic drift; sexual selection; genetic recombination; and all the rest of it.

I don't think you can find a serious ID researcher who denies evolution.

As Gerard Harbison points out, ID proponents don't do research. However, all of them very much deny evolutionary theory as an explanatory tool. The claim of irreducible complexity is a good example here. Not only has IC been shown to be a meaningless concept (because it depends on how one defines the parts, the system and the function); all the examples of IC have been shown not to be IC; and IC is not a challenge to evolution because it actually arises as a prediction of evolutionary theory.

They just believe in evolution as a purposeful, guided, creative process.

If this is true, they have made a very good job of hiding this belief. What appears to the rest of us is that they attempt to pick holes in evolutionary theory, then claim that the holes they imagine are evidence that certain things could not possibly have evolved by the mechanisms outlined in evolutionary theory, then claim that this is evidence of design.

ND says evolution is a blind, mindless, unintentional, process.

Again, assuming you meant "NS". Well, it is blind in terms of not being able to "see" where it is going; it is mindless, in that ants are just as capable of evolving as we are; it is unintentional as far as can be determined. There is too much evidence of jury-rigged design for any rational thinker to suppose otherwise.

The essential debate is philosphical --- is life inherently meaningful, or meaningless?

No. The ID crowd claim that there is empirical evidence that life has been designed. Yet all of their claims have been shown to be at best sadly mistaken, and at worst, deliberately misleading. The evidence suggests that there is no reason whatsoever to either infer or assume intentional or rational design in nature. Indeed, there is much evidence to argue against the concept of rational design. The debate you suggest has nothing whatever to do with evolution. To any person of faith, there can be meaning to their life in any way they choose to see it, irrespective of how we arrived at our present existence. What I think you refer to is the "comfort factor" of feeling that humankind occupies a priveleged position in biology. And for this there is no evidence whatsoever.

Is the universe alive or dead?

That's a meaningless question. Did you have a point to make?

This is hard, maybe impossible, to answer scientifically.

No it isn't. It is irrelevant. It depends solely on one's definition of life.

ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity.

And they have been shown to be wrong many times over. The axioms from which Dembski et al. choose to work have virtually no biological relevance at all.

So let them give it a shot.

Why? We know already that they are wrong. If they really had something to offer, they should go to the peer-reviewed scientific literature first; they should welcome criticism from the scientific community, because this represents the first test of any idea. Instead, they try to get their world-view taught in schools, so that their own brand of ignorance will be propagated.

It may turn out to be the sort of question that science and math are not really up to answering.

If that is the case, why do the ID proponents pretend to use science and maths to address it in the first place? Science has never claimed to answer questions about religion, because science deals with the natural, not the supernatural.

And if that's the case, each of us can make up our own mind how to look at life and the universe.

This option is already available to everyone, unless they've been indoctrinated into some extreme fundamentalist religion.

Right now neither team --- NDE or IDE --- can prove its case.

Au contraire. Modern evolutionary theory is supported by the preponderance of evidence. In science, this is as strong as anything ever gets. It is as well-supported by evidence as atomic theory, quantum mechanics and relativity. Absolute proof is the reserve of pure mathematics only.

I think we should stay open-minded and curious. All that bashing and insulting is not going to help your cause.

When the IC proponents publish material that is so clearly and demonstrably wrong; when they ignore all criticism and re-use arguments that have been repreatedly refuted; when they pretend expertise themselves but refuse to accept the expertise of others; then they deserve all of the bashing that comes their way. And I think you'll find that Dembski and his colleagues are not so averse to throwing some truly biting insults at evolutionary theory and its practitioners. In comparison, the supporters of evolutionary theory are paragons of restraint and civility.

Raging Bee · 25 June 2007

ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity. So let them give it a shot.

We have. (What makes you think we've been stopping them?) So far, they have consistently failed to do what they say they can do.

I think we should stay open-minded and curious. All that bashing and insulting is not going to help your cause.

Tell that to the lying bigots on YOUR side who blame evolution and scientists for nearly every evil known to Mankind.

Rieux · 25 June 2007

I've heard it claimed that the unluckiness of 13 was related to the number of diners there were at the Last Supper (disregarding, of course, the painting referenced in the Monty Python sketch). Twelve disciples + The Big Guy = 13. Diner No. 13 was, of course, Judas, and that situation (at least according to some) seems to have turned out poorly.

Though if, as some other posts here suggest, the unluckiness of 13 is well over 2000 years old, I suppose the above explanation might show an effect of the superstition rather than a cause....

realpc · 25 June 2007

"Science has never claimed to answer questions about religion, because science deals with the natural, not the supernatural."

That is false. NDE claims to have a definitive answer to a metaphysical question. NDE states that RM and NS alone can account for the origin of species. NDE supporters do not feel they need evidence to support this statement. You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion.

The reasoning is circular. In order to qualify as scientific, a theory must be "naturalist" (what used to be called "materialist"). So any theory that goes beyond materialist philosophy must be unscientific, must be wrong.

Evidence and logic are not involved. It's a question of definitions.

Sure there are many ignorant loonies who support IDE, but there are also sane and educated people who support it.

NDE is, and has been for quite a while, the standard accepted theory. If it wants to remain the standard, it should use logic and evidence to make its case, not tradition and personal attacks.

You know very well that non-standard theories can't make it into mainstream journals easily, no matter the quality of their evidence and reasoning.

I think that most of the anti-ID movement is based on hatred of fundamentalist Christianity. ID does not support fundamentalist Christianity, or any form of Christianity. But it does deny materialist philosophy, so it opens a door to faith and super-human levels of intelligence. That's why scientific atheists despise it.

In other words, strong emotions have gotten mixed into a scientific debate. You will not see any of this clearly as long as you are motivated by hatred of religious intolerance. Sure religious intolerance is nasty, but it has nothing to do with the scientific/philosophical question of NDE vs IDE.

David Stanton · 25 June 2007

Nigel D,

Well said. Your eloquence is exceeded only by your immense knowledge.

Steve · 25 June 2007

Real PC,
Why do you think this is a metaphysical question ? Do you have evidence ?

harold · 25 June 2007

realpc - I'm of a generous nature. I'm slow to give up on a hopeless cause.
That is false. NDE claims to have a definitive answer to a metaphysical question. NDE states that RM and NS alone can account for the origin of species. NDE supporters do not feel they need evidence to support this statement. You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion.
This is grossly incorrect. There is no polite way to say this. It reveals the profoundest possible ignorance of the subject. The theory of evolution resulted from the consideration of vast amounts of evidence, and has been tested skeptically over and over again. How could anyone say that the origin of species is a "metaphysical question"? Do you seriously believe that the speciation of modern horses and modern donkeys from some recent common ancestor was a "metaphysical" event? I'm going to ask you again (and again, and again, and again, if need be)... Please explain the theory of evolution as you understand it. Or admit that you can't.

Raging Bee · 25 June 2007

realpc has nothing to offer but the same old creationist talking-points, all of which have been refuted long ago, which he continues to repeat without modification, with the same old pretense of originality, regardless of what anyone else has to say (including the authors of the posts he hijacks with his droning stupidity). Even his "non-standard theories can't make it into mainstream journals" crap is just a robotic repetition. He's clearly run out of both ideas and energy, and is simply not making an ounce of effort; so there's no reason for any of us to make any effort for him.

Rob · 25 June 2007

There were 10 orginal Months. Think about Dec ember. Julius and Augustus needed there own Months. Now we have 12.

Gerard Harbison · 25 June 2007

Actually, the Roman Calendar, at least from the reign of the second king, Numa Pompilius, began on March 1 and had 12 months. December was the 10th month; the last two were January and February. The months were short, totalling 355 days, and so they needed an occasional leap-month to keep the average around 365 days. Julius Caesar lengthened some of the months to bring the year up to 365 days, and also instituted the leap day, so his year was 365.25 days, close enough to an actual year to make further reform unnecessary for about a millenium.

David Stanton · 25 June 2007

realpc wrote:

"NDE states that RM and NS alone can account for the origin of species. NDE supporters do not feel they need evidence to support this statement. You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion."

Well, in this case we have very well documented natural mechanisms by which species evolve. We have observed speciation in nature and in the laboratory. We have examined the genetic mechanisms that promote and enforce reproductive isolation and we have studied the process of genetic divergence that follows. Speciation is a completely predictable, perhaps even inevitable, consequence of sexual reproduction.

As others have already pointed out, there is no metaphysical or "supernatural" component involved at all. The only way to get one inserted is to presuppose that it exists apriori, which is exactly what realpc has done without a shred of evidence. Once again, he has committed the very sin that he accuses others of.

Mike Elzinga · 25 June 2007

What strikes me about the Parliamentary Assembly's document is how informed and up-to-date it is. It is a very good read.

We seldom, if ever, see this kind of thing coming from any governmental organization here in the United States.

This is certainly an example of what the benefits would be of paying attention to what other countries know about what is going on in the world.

slang · 26 June 2007

realpc, why do you continue to say "NDE states that RM and NS alone can account for the origin of species." when Nigel just explained that to be a strawman, as have many others before? Did you not read that part of his post, or do you not understand it? Or do you ignore it because you can't answer it?

Nigel D · 26 June 2007

Nigel D, Well said. Your eloquence is exceeded only by your immense knowledge.

— David Stanton
Thank-you, sir. You are most kind.

Nigel D · 26 June 2007

"Science has never claimed to answer questions about religion, because science deals with the natural, not the supernatural." That is false. NDE claims to have a definitive answer to a metaphysical question.

— realpc
OK, I'll start by setting your terminology straight again. If by "NDE" you mean "neo-Darwinian evolution", I have already pointed out how outdated and hence irrelevant that term is. Henceforth, when you put "NDE", I shall assume that you mean "MET" (modern evolutionary theory). Bear in mind that the latter is significantly more complex and detailed than the former. MET does not answer any metaphysical questions. It answers the question of how new species of organism arise from precursor species. It answers this by assessing the physical evidence (including the fossil record; genetic data; data from molecular biology and protein biochemistry; morphology and anatomy; and more). There is nothing metaphysical about this.

NDE states that RM and NS alone can account for the origin of species.

You seem to have ignored a large chunk of my previous post. Are you ignoring it because you cannot answer it, or did you merely scan my words and pick out a few odd sentences to address? MET includes far more than just RM + NS.

NDE supporters do not feel they need evidence to support this statement.

The statement arises not from MET, but from your strawman.

You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion.

Not so. We started (i.e. prior to 1859) from the position of "how does this happen? at present we do not know". Since then, speciation has been observed in living examples. Change of higher taxa has been well documented from the fossil record. Your use of the word "natural" is mistaken (probably arising from the way Dembski changes its use as it suits him). If a human being designs a car, and other humans beings build it, intelligence is invloved. Yet, the whole process is natural. Natural processes can involve intelligence. What scientists assume is that the natural processes that can be observed to be at work in the world around us were also at work in the past. Here I use the term "natural" as an opposite to "supernatural". While "natural" can also mean the opposite of "artificial", I do not use it in that sense here. Why do we assume only natural processes occur? Because the ultimate arbiter in science is always reality. All of the processes I described in my previous post have been observed, and they are the same for all observers. The supernatural cannot be measured, it cannot be observed by different people at different times and different places. These factors are important, because they define the reproducibility of an observation or measurement. Without data that are the same for everyone, no consensual truth can be achieved. Also, it is not parsimonious to assume that a supernatural process is occurring when explanations based on naturally-occurring processes are perfectly adequate.

The reasoning is circular. In order to qualify as scientific, a theory must be "naturalist" (what used to be called "materialist"). So any theory that goes beyond materialist philosophy must be unscientific,

This is partially right. For something to be scientific, it must be the same for everyone who measures it or observes it. Gravity is the same for every observer. Newtonian mechanics are the same for every observer. General relativity is the same for every observer in a given frame of reference. And so on. The key to science is that, by checking all theories and observations against reality, the "truth" will be the same for everyone. Thus, science achieves consensus (sometimes quite slowly, but it does). However, this is a "working model". It is not a philosophy. All scientists should be aware that they are operating under the assumption of methodological naturalism, but by the same token, without that framework no consensual truth can ever emerge.

must be wrong.

Not necessarily wrong, but certainly not science.

Evidence and logic are not involved.

On the contrary, evidence and logical conclusions drawn from the evidence are the only things permitted. Some speculative theories (e.g. string theory) currently have only modest support from the evidence, but those theories are in the process of hunting for experiments that will help to decide how much merit the theory possesses.

It's a question of definitions.

Not really. For an idea or proposal to be considered science, it must check itself against reality. And it must in principle be possible for any researcher to check that idea against reality.

Sure there are many ignorant loonies who support IDE, but there are also sane and educated people who support it.

But there is no evidence to suggest that those educated people support ID out of academic honesty. Indeed, given how often critiques of ID are ignored by its proponents, the evidence suggests the opposite - that ID proponents continue to support and expound it despite knowing that it is wrong.

NDE is, and has been for quite a while, the standard accepted theory.

MET is the standard accepted theory for evolution. The basic ideas have withstood every test and the theory has been adapted to include new discoveries as and when they have cropped up. It does this purely on the basis of compatability with the evidence.

If it wants to remain the standard, it should use logic and evidence to make its case, not tradition and personal attacks.

This sentence shows a sad lack of understanding of the scientific process. Most scientists would love to overturn a long-standing theory. This would accrue them much scientific kudos and acclaim. However, in the case of evolution, I don't believe that anyone expects this to occur. The reason for this is that Darwin's original ideas were so firmly grounded in the evidence. Since 1859, various parts of the original Darwinian theory have been discarded or modified or built upon, as new information has come to light. Thus, natural selection is still considered an important mechanism of evolution even after such things as Mendelian inheritance, the structure and function of DNA, and punctuated equilibria have been discovered / proposed. MET is based on a vast body of evidence, and logical deductions from that evidence. I am not aware of any evolutionary biologist making "personal attacks" in order to support MET. Can you please either supply examples or withdraw that slanderous remark? On the other hand, certain ID proponents have accused evolutionary theory of causing the Holocaust and eugenics programmes. This is a matter of documented public record, so you should perhaps ask the ID proponents why they feel the need to make such attacks.

You know very well that non-standard theories can't make it into mainstream journals easily, no matter the quality of their evidence and reasoning.

It is true that extraordinary claims require extraordinary evidence. However, I am fairly sure that any extraordinary claim, if suitably supported by a body of evidence from which logical conclusions have been drawn, would be snapped up by any mainstream journal. It would add significant prestige to whichever journal is the first to publish a new theory to replace one that has long stood as the standard in its field.

I think that most of the anti-ID movement

There is no anti-ID movement. Instead there is a movement of people who support good science and abhor the sloppy scholarship and intellectual dishonesty that typify pro-ID publications.

is based on hatred of fundamentalist Christianity.

There is no hatred of fundamentalist Christianity. There is, however, an abhorrence of having someone else's religious viewpoint forced onto one's own children.

ID does not support fundamentalist Christianity, or any form of Christianity.

But it is supported by many fundamentalist Christians. According to the wedge document, ID is the starting point of turning America's culture away from "materialist" ideas (i.e. evidence) back to spiritual ones (i.e. superstition and unquestionable religious authority).

But it does deny materialist philosophy,

I have never seen any formulation of ID that has any more to it than "this cannot have evolved by itself, so it must have been designed". Since Dembski, Behe, Wells et al. are so keen to avoid the claim that the designer is the Christian God, the "official" formulation of ID has no comment to make about materialist philosophy, other than to say that we should be open to "other explanations". However, any denial of a working assumption of methodological naturalism is perforce a denial of scientific methods. Without this assumption, there can never be any consensual truth, because "truth" will then be free to become different things to different people. Science insists only that "truth" be checked against reality, and thus be the same for every observer.

so it opens a door to faith and super-human levels of intelligence.

Faith (beliefe in the absence of evidence) is the direct antithesis of science (in which any belief must be supported by evidence). The two are mutually exclusive ways to investigate a phenomenon. Science has no comment about super-human intelligence, because it is entirely plausible that super-human intelligence may be discovered at some time in the future. WRT super-human intelligence, science can say no more than "we don't know".

That's why scientific atheists despise it.

This is very wrong. I have no idea what a "scientific atheist" might be. I assume you mean a scientist who also happens to be an atheist. ID is rejected by science because it is scientifically vacuous. Its support is based on arguments that have been repeatedly refuted. It is intrinsically an argument from ignorance. It is being forced into American and European culture by groups with a clearly religious fundamentalist agenda. ID is also rejected by many hundreds of thousands of scientists who are also Christians. The rejection of ID is based purely on its own lack of merit, not by any pre-existing bias.

In other words, strong emotions have gotten mixed into a scientific debate.

This is a deliberate tactic employed by the ID proponents, because they know that, while they cannot win the debate on scientific grounds, they can accrue much support with simplistic, emotional arguments and rhetoric.

You will not see any of this clearly as long as you are motivated by hatred of religious intolerance.

Well, I think I see things fairly clearly. You are the one who has failed to address the bulk of the points I have raised. Perhaps you are the one who is not seeing clearly. Besides, I think we should all abhor religious intolerance, but this cuts both ways. Excessive proselytising (which is, at root, what ID creationism is) should be rejected no matter from which direction it comes. Freedom of religion is also freedom from religion.

Sure religious intolerance is nasty, but it has nothing to do with the scientific/philosophical question of NDE vs IDE.

Except insofar as the proponents of ID are refusing to tolerate the religious freedom of the rest of us. ID has been demonstrated to be religiously motivated. It is fundamentalist Christian creationism in a new suit. It has no scientific merit whatsoever. And it is intolerant of other world views.

realpc · 26 June 2007

"The theory of evolution resulted from the consideration of vast amounts of evidence, and has been tested skeptically over and over again."

I can't believe I have to say this again. I believe in evolution, most ID advocates believe in evolution. NDE is one theory that tries to explain evolution.

You can believe in evolution but disagree with the ND explanaation.

I'm sure I will have to repeat this many more times.

Raging Bee · 26 June 2007

The praise for Jones has always amused me; all the talk of his brillinat decision and the like.

Well, compared to all the drivel and horseshit the defendants in that case tried to shovel in our faces, Jones did end up looking rather brilliant. At least he picked more sensible material to copy.

David Stanton · 26 June 2007

realpc wrote:

"I can't believe I have to say this again. I believe in evolution, most ID advocates believe in evolution. NDE is one theory that tries to explain evolution.

You can believe in evolution but disagree with the ND explanaation."

But you still refuse to describe exactly what you mean by "NDE". You still refuse to describe exactly how you assume it is supposed to work. You still refuse to say exactly what you think it cannot explain. You still refuse to provide any evidence for you views. Until you do we will continue to talk past each other to no avail.

Perhaps the reason for your reluctance stems from the fact that we have already been through this many times before. All your so called theories have been shot down because you have not one shread of evidence. Metaphysical musings about supernmatural causes do not constitute evidence.

Raging Bee · 26 June 2007

NDE is one theory that tries to explain evolution.

Please describe exactly how the other "theories" explain evolution, and what physical evidence backs them up and/or calls NDE/MET into question.

I'm sure I will have to repeat this many more times.

We're sure you will too: repeating the same self-important rubbish over and over again, and pretending you're making some substantive, original and important point, is all you know how to do.

harold · 26 June 2007

realpc -

Which of the following statements do you disagree with, and why? Be very specific.

1. The genomes of cellular organisms and viruses are composed of nucleic acid molecules, DNA except in the case of RNA viruses. (Arguably, RNA viral genomes almost always use a cellular DNA intermediate for replication).
2. The fundamental aspect of reproduction of viruses and celluar life is replication of the genome.
3. Nucleic acid replication does not and cannot produce an offspring nucleic acid sequence identical to the parent sequence. Sometimes, variations from the parent sequence are termed "mutations", merely meaning "change" or "difference". The biochemical nature of many types of "mutations" is well understood.
4. In addition to this, prokaryotic cells sometimes share nucleic acid sequences with each other in a variety of ways that can cause genetic variability. Elements like plasmids, for example.
5. In addition to this, when most sexually reproducing eukaryotic cells divide, they naturally undergo a process of genetic recombination, generally not considered to be "mutation", which guarantees a unique genome, relative to the parents, for each individual offspring.
6. In addition to this, many viruses insert genetic material into the genomes of cells they infect.
7. In addition to all this, spontaneous mutations can occur in the genomic sequence of quiescent cells that are not even reproducing.
8. As reproduction proceeds, the proportion of various alternate nucleic acid sequences in a population, sometimes termed "alleles" for convenience, can vary over time without any selective pressure. This process is sometimes called "random genetic drift".

I don't pretend that this list of sources of genetic variability between parents and offspring is exhaustive.

9. Each individual cell, organism, or viral particle expresses various genes in a regulated way throughout its development and beyond.
10. The physical form of the organism is called its phenotype. The phenotype interacts with and can sometimes be modified by the surrounding environment.
11. Some types of genetic variability are expressed in the phenotype, others are not.
12. Among phenotypes in a shared environment, some may have features that give them a net reproductive advantage, relative to that environment.
13. The interaction of individual phenotypes with the environment is complicated. Sometimes features that confer a survival advantage also confer a reproductive advantage. Sometimes, however, there is a trade-off. When a feature that confers significant reproductive advantage is selected for even though it acts against longevity, this is often termed "sexual selection". Various exaggerated male bird plumages that increase predation but attract females are used as examples.
14. Within a given environment, if a phenotype enjoys a reproductive advantage over other phenotypes from the same genetic population, in the next generation, the alleles associated with the reproductively favored phenotype will be more frequent. This is sometimes known, broadly, as "natural selection". NOTE - it does not need to involve premature deaths, reproductive frustrations, or the like, although in practice organisms usually do face such constraints. All that is required is that there be different phenotypes, and that some of them have a relative, mathematical reproductive "advantage" (ie produce more offspring that can also reproduce) relative to others.
15. If some phenotypes are better adapted to a shared environment than others, they will be selected for, relative to the others. Thus, it is often said that selection is required for adaptation. Once a phenotype exists that is highly adapted to a given environment, much variation will tend to be selected against, unless the environment changes.

Now remember, my specific question is very simple - which part of the above do you disagree with?

Edin Najetovic · 26 June 2007

Ah, it's been a while since I've seen this here. Starting of with a moderate and humble critique of ID-haters that quickly morphs into an all out attack on evolution in all its forms... so predictable.

That is false. NDE claims to have a definitive answer to a metaphysical question. NDE states that RM and NS alone can account for the origin of species. NDE supporters do not feel they need evidence to support this statement.

— realpc
Oh dear, did he just label a well researched and very much researchable phenomenon 'metaphysics'? I do believe he did...

You start from the premise that the origin and evolution of life is "natural" (meaning that no intelligence is involved in the process). That premise then becomes your conclusion.

Well, yes. That's sorta what science does, though the conclusion is hardly as tautological as you make it appear. Naturalism (or Materialism, whichever you want to call it, labels don't really matter) is a method, never a conclusion. Take, for example, Newtonian gravity. It works from the premise that the process involved in an object attracting another object is natural (that's why he called it natural philosophy!) and works from there. His conclusion is not only naturalist, as his premise was. Indeed, his conclusion also contains words, just like its premise. And as if that wasn't big enough an affront to sound logic, his conclusion is English... just like his premise. You must hate gravity with a passion...

NDE is, and has been for quite a while, the standard accepted theory. If it wants to remain the standard, it should use logic and evidence to make its case, not tradition and personal attacks.

I could not agree more and I would agree that some people (including me! Mea culpa) on this blog take things to a low level of rhetorics and namecalling that can hardly be called beneficial. Still, I would counter that people who would support ID stop misrespresenting what science and evolution ARE. Play by the rules of naturalism, or denounce it entirely. There is no way of accepting something like the Theory of Gravity but denouncing the naturalist premises of evolution. You can't have your cake and eat it too.

The essential debate is philosphical --- is life inherently meaningful, or meaningless? Is the universe alive or dead? This is hard, maybe impossible, to answer scientifically. ID researchers believe they can demonstrate mathematically that Rm + NS cannot generate increasing complexity.

I'm sorry to say that this remark shows you are a religious person here to shill an opinion you are not qualified to pontificate upon. As you should know, science doesn't involve itself with meaning. And if you try to ascribe meaning -either meaningfulness or meaninglessness- to any of its parts, your actions are inherently flawed. And besides why does meaningful equate alive and meaningless dead? That's just frontloading.

So let them give it a shot.

It's a free country, nothing's stopping them. They have been spewing nonsense for quite a while so any counterpoints that they are being censored would be nonsense.

It may turn out to be the sort of question that science and math are not really up to answering. And if that's the case, each of us can make up our own mind how to look at life and the universe.

Err... you can do that even if people say that you should believe something else. You're free to believe you can fly, if you want to. As to whether they're up to answering it... the naturalist parts, sure. The others, not quite.

Right now neither team --- NDE or IDE --- can prove its case. I think we should stay open-minded and curious. All that bashing and insulting is not going to help your cause.

While strictly true (science can never be proven definitively, if it could it wouldn't be science), there is something called 'beyond reasonable doubt', and it has been show quite often that this reasonable doubt is long gone for evolution. Much the same as gravity actually. Really, if you want to shill your religious talking points, it may be a good idea to read something else than talking points memos released by the local church.

Gerard Harbison · 26 June 2007

Dembski's now claiming that the prosecution of a Lutheran pastor for denying the Holocaust means that ID will soon be declared a crime against humanity.

Uncommon Descent is certainly a crime against logic.

Glen Davidson · 26 June 2007

Since Charlie knows nothing, he repeats his mantra over and over again:

I can't believe I have to say this again.

You're as wrong about this as you are about, well, anything of consequence. We heard your misrepresentations the first time, and that we don't accept your dishonesty is only to our credit (though not much---it's not hard to see through you).

I believe in evolution, most ID advocates believe in evolution.

Now see for you it's fair to say that you "believe in" evolution (it would normally be reasonable for us, too, but we can't due to the dishonesty of creos and IDists). That's because you have no evidence for any mechanism of evolution, thus it is only a "belief" for you. You accept the evidence for a certain kind of evolution (RM + NS +) as if it were evidence for any kind of evolution, or even worse, for successive creation events such as Behe believes in. I suppose the main reason I am writing is to discuss Behe's successive creation bit some more (and not for the ineducable Charlie). The fact is that he accepts a kind of "evolution" with minimal creation events, the necessary simultaneous mutations that he ignorantly believes are necessary. But what is actually different, substantively, between Behe's "evolution" with minimal creation, and successive creation? Either way, the "design" of the organisms is built upon earlier "models", the only "difference" is that in successive creation the "designer" simply copies the old information and morphologies while adding in some "mutations", or "designs" (at this point, there is no difference). With Behe, duplication continues via normal reproduction events, while the "designer" puts in some additional features and modifications with miraculous "mutations" or "designs". Well, what's the difference intellectually in the two models? There's a kind of "ontological" difference, since in Behe's model the apparent continuity of form and information reflects actual earthly continuity of form and information, while in successive creation it doesn't. Also, it gives a kind of concreteness to the constraints within which the "designer" worked, though without telling us why the "designer" bothered to work within apparently artificial constraints at all. But these differences are idle and meaningless, because this "designer" whose intents and purposes are obscure to us (Behe ventures some unevidenced claims for it, not paying attention to the recent dogma of IDists) could as easily have recreated forms and information in new creations as it could have interfered with existing models to update them. We have no idea why the "designer" would stupidly follow constraints of heredity that humans would not, so that neither model tells us anything about that. Furthermore, the continuity of form and information in organisms might be considered to be somehow better and higher if its continuity through time was maintained by God's mind itself, and not by mere reproduction. This, of course, is why ID is creationism. Not just because the "designer" has to intervene and create "designs" or "mutations", but because there is no epistemological nor epistemic difference between successive creationism and successive mutationalism. Scientifically, we have absolutely no preference for one over the other, as both are violations of the observed order (it's really not aliens, who'd be expected to create rational designs, not to mimic evolution), and any "designer" could create anew, or update old models, and the IDists give us no reason why one happened rather than the other. Let's cut to the chase here for once, though. A real designer responsible for organisms would be expected by us to operate like, well, something on the order of the God of Genesis 1 & 2 (it's important to note that there is no sense of common ancestry or the evidence for it there, so we'll disregard the evidence for evolution for this paragraph). Everything is made in reasonably short order (if it took a few years rather than a few days, no matter. What we've never seen is any sort of intelligent designer that thought a few billion years was soon enough), and nothing is made upon the basis of anything else. What's refreshing about Genesis is that it's not mealy-mouthed and it doesn't contort the "intelligent designer" into some bizarre unknowable being. No, while important differences exist (even the ancients knew what Behe doesn't, that animals are not machines, even machines with souls (souls are the corollary to ID that immediately shows that it's a religious doctrine)), the designer of early Genesis acts much like a human designer, though with additional magical abilities (he can breathe life into sculptures, for instance). That's an honest design hypothesis, if with unverifiable components, separate creation events not dependent upon past designs, and all done in a reasonable space of time. The fact that Behe tries to make 4 billion years of evolution into one long creation event changes nothing about its creationist nature, and makes his creation scenario absurd on the face of it.

NDE is [the] one theory that tries to explain evolution.

Fixed that for you, Charlie dolt. I didn't fix your mindless driveling use of "NDE" for current evolutionary theory, but I did fix your moronic implications that there is any theory other than the latter that fits the data in any convincing manner at all.

You can believe in evolution but disagree with the ND explanaation.

Yes, and since you have no regard for evidence, any magical belief is as good as a scientific theory.

I'm sure I will have to repeat this many more times.

I'm sure that you'll never come up with anything intelligent to say, hence in a psychological sense you'll have to repeat this many more times. This will shore up your idiotic belief that any old rubbish is the equal of well-considered and well-evidenced theory. Glen D http:tinyurl.com/35s39o

realpc · 26 June 2007

"Take, for example, Newtonian gravity. It works from the premise that the process involved in an object attracting another object is natural"

That's exactly what I mean! Objects attracting each other at a distance is defined as "natural" -- but why? Just because we can see that, obviously, gravity exists. It doesn't matter that science can't explain it.

The criteria for deciding that a phenonmenon is natural is simply that science accepts that it's real.

The implied contrast with "natural" is "supernatural." But no one bothers to define "supernatural." There's just an intuitive sense that supernatural is everything ignorant, non-scientific, people believe, and which has not been accepted by science.

I hope this isn't too confusing. It's really central to the whole ID debate, and many other important questions as well.

A "natural" explanation, as defined by current mainstream science, is an explanation that scientists generally accept as valid. It doesn't matter how strange or inconclusive the explanation, as long as the phenomenon has been shown to exist. Gravity exists, we can all observe it, so it's natural. We don't know how or why it exists, only that it does.

Well it's exactly the same with evolution! We see that evolution is a fact, so evolution is natural. But as with gravity, we have no real explanation for evolution.

Gravity is natural because science acknowledges its existence, and the same with evolution.

Something can be defined as "natural" whether or not it can be explained within materialist science.

There is absolutely no reason why the ID theory of evolution must be defined as "non-natural."

Neither ID nor ND have been demonstrated. We cannot observe the cause of evolution. Neither explanation is more natural than the other. But ND is a materialist explanation. By that I mean it uses only the substances, fields and forces already defined and accepted my science. It fits within the framework of current scientific philosophy.

harold · 26 June 2007

That's exactly what I mean! Objects attracting each other at a distance is defined as "natural" --- but why? Just because we can see that, obviously, gravity exists. It doesn't matter that science can't explain it.
Fine. Fundamental forces are observed, accepted, and defined as natural. But that's not a relevant reason to specifically oppose the theory of evolution.
The criteria for deciding that a phenonmenon is natural is simply that science accepts that it's real.
This is a possible colloguial, approximate way to define the word "natural" in some circumstances.
The implied contrast with "natural" is "supernatural." But no one bothers to define "supernatural." There's just an intuitive sense that supernatural is everything ignorant, non-scientific, people believe, and which has not been accepted by science.
You certainly haven't defined it. Again, it's not relevant to the question of evolution. Biological evolution can be explained in natural terms, down to the atomic level. If you reject the methodology of science you reject all science, not just the theory of evolution. If you accept science, you accept the theory of evolution.
I hope this isn't too confusing. It's really central to the whole ID debate, and many other important questions as well.
Please refer to my post #184679 directly above. Which parts do you disagree with, and why? This is important. I'd like to establish what it is that you think you're arguing against, in terms that other people can understand.

PvM · 26 June 2007

The implied contrast with "natural" is "supernatural." But no one bothers to define "supernatural." There's just an intuitive sense that supernatural is everything ignorant, non-scientific, people believe, and which has not been accepted by science.

The way ID defines super natural is quite straightforward and based on our ignorance. For instance Newton believed that God intervened periodically to keep planets in their orbits, just because he did not understand the concept of gravity and the mathematical implications thereof. It was his ignorance that led him to conclude 'designed' and to invoke the supernatural.. I also note that you are still mispresenting ID as having a theory of evolution. It doesn't beyond: science cannot explain X thus 'designed'.

PvM · 26 June 2007

Neither ID nor ND have been demonstrated. We cannot observe the cause of evolution. Neither explanation is more natural than the other. But ND is a materialist explanation. By that I mean it uses only the substances, fields and forces already defined and accepted my science. It fits within the framework of current scientific philosophy.

The mechanisms of ND have been demonstrated, ID has not been demonstrated. Simple as that. ID is based on our ignorance about particular examples of evolution.

realpc · 26 June 2007

"Biological evolution can be explained in natural terms, down to the atomic level."

Maybe adaptation, but not the origin of a new, more complex, species. But that leads us back to defining "complexity" again.

Science Avenger · 26 June 2007

Genes sometimes duplicate. This is demonstrable fact. It also makes the resultant descendent more complicated than its predecessor by any measure. After it mutates a few times, and duplicates some more, it is even more obviously so. Or is someone going to really try to claim that ATGATGA is just as complex as ATGATAGTGATTTAGTGGGA?

MSU bites the dust again.

Richard Simons · 26 June 2007

Realpc: What is this 'ID theory of evolution' that you keep referring to? How do you expect us to comprehend what you are driving at when you can't even clearly define your terms?

What do evolution-accepting IDists believe? Do you think that a god comes along and thinks 'Hmm. These mice are getting out of hand. I'll have to take this hawk and alter its DNA. If I move its eyes to the front and give it better hearing it can hunt mice at night. Perhaps I should give it soft feathers while I'm at it.' Is that how owls arose, do you think?

harold · 26 June 2007

realpc -
"Biological evolution can be explained in natural terms, down to the atomic level." Maybe adaptation, but not the origin of a new, more complex, species. But that leads us back to defining "complexity" again.
Unfortunately, a completely polite reply is not possible here. This is pre-school level oppositional back-talk, not a reasonable answer. Forget about "complexity" for the time being. Which part of post 184679 above do you disagree with, and why? (For the purposes of this discussion, gene duplication can be considered to be dealt with generally in part "3)".)

J. Biggs · 26 June 2007

Unfortunately all RealPC has ever proved is that he is a complete waste of time. He has driven multiple threads completely off topic with his inane repetitious drivel. This thread started out interesting but has become quite boring as a result of RealPC's trolling. I recommend moving RealPC's comments to the bathroom wall. You are welcome to move mine there as well since it is also off topic.

Glen Davidson · 26 June 2007

We're often enough told by IDists and creationists that Newton and other great scientists were Xians (as if we were opposed to these principled Xians), and then the attacks on "naturalism", coupled with illegitimate claims about what "naturalism is", ensue. But of course Xians like Newton were among those who gave us the principles of "naturalism" (no, I don't like the term, partly because it is a holdover from the era of artificial distinctions between the "natural" and the "supernatural", but the concept can still be made to work). So recently I ran across Newton's rules for science, and thought that they might be a good antidote to the maunderings of anti-science spokespersons that Charlie Wagner (realpc) and Mark Hausam repeat without comprehension or context. Here they are, the same principles that we uphold:

Rule I: We are to admit no more causes of natural things than such as are both true and sufficient to explain their appearances. To this purpose the philosophers say that Nature does nothing in vain, and more is in vain when less will serve; for Nature is pleased with simplicity and affects not the pomp of superfluous causes. Rule II: Therefore to the same natural effects, we must, as far as possible assign the same causes. As to respiration in a man and in a beast; the descent of stones in Europe and in America; the light of our culinary fire and of the sun; the reflection of light in the earth, and in the planets. Rule III: The qualities of bodies, which admit neither intensification nor remission of degrees, and which are found to belong to all bodies within the reach of our experiments, are to be esteemed the universal qualities of all bodies whatsoever.

That's the "naturalism" to which we adhere, the same sort that religious scientists have set out as the guiding rules of science. I especially like Rule II, since it's been a source of annoyance to me forever (and one I've commented upon several times) that IDists want to insist that while RM + NS + is responsible for the patterns of phylogeny and inheritance visible in human genealogy and in recent evolution, the exact same sort of patterns at the "higher levels of taxonomy" are caused by "design". Of course on the face of it such claims are pure BS, but they also violate the principles of science that Xian scientists esteemed by atheist and theist, evolutionist and creationist/IDist alike, have laid out as essential and utilized in their own work. Anyway, if Mark and Charlie must continually whine about scientific principles, they ought at least to have the decency to apply their whine evenly, and fault all science since, and including, Newton. Glen D http://tinyurl.com/35s39o

Glen Davidson · 26 June 2007

I forgot to reference Newton's Rules. And I guess I may as well include the fourth one as well, since IDists/creationists violate it regularly as well:

In experimental philosophy we are to look upon propositions collected by general induction from phænomena as accurately or very nearly true, notwithstanding any contrary hypotheses that may be imagined, till such time as other phænomena occur, by which they may either be made more accurate, or liable to exceptions. This rule we must follow, that the argument of induction may not be evaded by hypotheses.

All four of Newton's rules for doing science are all from volume 2 of Principia, and are called "Rules of Reasoning in Philosophy" (remember that science was called "natural philosophy" in Newton's day). Here's one address for these rules: http://members.tripod.com/~gravitee/rules.htm Glen D

Sir_Toejam · 26 June 2007

ID is based on our ignorance about particular examples of evolution.

more correctly, it's primarily based on its own supporters' ignorance about all examples of evolution.

George Cauldron · 26 June 2007

Realpc: What is this 'ID theory of evolution' that you keep referring to?

Far as I can tell, from following ID blogs for two years, it seems to go as follows: 1) Some stuff really looks designed 2) Darwin sucks. Hope that clears things up.

Sir_Toejam · 26 June 2007

1) Some stuff really looks designed

ya know, the other day I saw some ID nutter or ruther going on about how science has "abandoned" teleology. Probably while going through a thread here or on Pharyngula. I just thought I would point out that it seems to me that creationists are confusing actual teleology with perception bias instead. the application of the concept of "function" has certainly not been lost in science, and scientists are always careful to apply independent observation to avoid circularity. Moreover, early on the need for replicability was recognized in order to eliminate perception bias, especially from hypotheses that at least superficially appear teleological. This is something the creationists are simply incapable of doing. In fact, all of their "science" is entirely BASED on perception bias. Hence, the reason there ARE no replicable experiments generated by the oxymoronic "creation scientists". Their teleology arguments as applied to actual science are nothing more than the projection of their own perception bias.

Raging Bee · 26 June 2007

...But that leads us back to defining "complexity" again.

And that, in turn, reminds us that you've never attempted to do so. And that leads us to conclude that your General Theory of Unspecified Complexity and Stuff is still a load of insubstantial brown air, hanging around like a fart in a Russian space station, long after we've all got tired of smelling it over and over.

Go away, realpc. You don't belong at the grownups' table, and you bring nothing to it but the same old self-important word-salad, constantly interrupting conversations you don't comprehend.

realpc · 26 June 2007

"What do evolution-accepting IDists believe? Do you think that a god comes along and thinks 'Hmm. These mice are getting out of hand. I'll have to take this hawk and alter its DNA."

As I have explained before, there is a natural tendency in our universe for systems to evolve in the directlion of increasing complexity. That is more or less all that ID is proposing. Everything else -- gods that look like old men and zap things into existence, and who diapprove of homsexuality -- is added to the theory by its opponents.

The debate hinges on the concept of complexity, and we have no agreed-on definition.

Coin · 26 June 2007

there is a natural tendency in our universe for systems to evolve in the directlion of increasing complexity. That is more or less all that ID is proposing

That is not what ID is proposing at all.

Richard Simons · 26 June 2007

there is a natural tendency in our universe for systems to evolve in the direction of increasing complexity.
Why? Does this mean you are a Lamarckian?
The debate hinges on the concept of complexity, and we have no agreed-on definition.
Surely that is the fault of IDists? They are the only people who try to use the concept even though they have never bothered to define it or even proposed a possible way to measure it.

harold · 26 June 2007

realpc - People have tried to engage you, but you're incapable of being engaged. I just want to remind everybody that you are unique in that you not only know nothing about evolution, you also have no idea what "intelligent design" is all about. You're as clueless about Behe and Dembski as you are about real science.
As I have explained before, there is a natural tendency in our universe for systems to evolve in the directlion of increasing complexity.
So what if you say it? It doesn't mean anything.
That is more or less all that ID is proposing.
I honestly think that Dembski and Behe should sue your ass for misrepresenting them. This simple one-sentence slogan is all YOU are "proposing". It bears no resemblance to the crap they peddle. It's different crap, and while it looks no worse to me, it's much more naive and simplistic than the crap they peddle.
Everything else --- gods that look like old men and zap things into existence, and who diapprove of homsexuality --- is added to the theory by its opponents.
Of course ID is wrong on its own, as is your oversimplified and meaningless mantra, whether "opponents" "add" anything or not. Pretending not to understand the relationship between ID and YE creationism only makes you look dishonest or foolish. All YE creationists I know of claim to support ID and "Biblical Literalism". By doing so, they constitute the vast majority of ID supporters. Whether or not they think God looks like an old man, they are certainly adamant that he zaps things into existence and disapproves of homosexuality. I doubt if there are any actual ID advocates who would admit, in the prescence of YEC creationists, to opposing YEC creationism. If there are, they would by definition still claim that "the designer" zaps things into existence, and my money says that they would (claim to) disapprove of homosexuality, as well. How ironic that in your zeal to support ID, you contribute to its destruction. As the more clever rats leave the ship, the motley collection of crackpots left behind will increasingly contain a high proportion of random cranks, who bear no resemblance whatsoever to the right wing authoritarian rich "Fundamentalist Christians" that ID was designed to toady to. This will accelerate its spindown to oblivion. (Of course, remnants will survive for a long time, as I've said before.)

realpc · 26 June 2007

"Pretending not to understand the relationship between ID and YE creationism only makes you look dishonest or foolish.

All YE creationists I know of claim to support ID and "Biblical Literalism""

Maybe all YECists believe in ID, I have no idea. That says nothing about how many IDists believe in YEC (this should be in the first chapter of any intro to logic book).

harold · 26 June 2007

realpc-

Here's my real quote -

"All YE creationists I know of claim to support ID and "Biblical Literalism. By doing so, they constitute the vast majority of ID supporters."

And of course I also said -

"I doubt if there are any actual ID advocates who would admit, in the prescence of YEC creationists, to opposing YEC creationism"

Don't quote-mine when anybody can see the real quote right above. Any logic book ought to tell you that.

In fact, don't twist other peoples' words at all. Honestly address what they actually say.

HAHAHAHAHAHAHAHAHAHAHAHA! But warn me first. I don't want them to find me dead of shock in front of a computer screen.

Sir_Toejam · 26 June 2007

The debate hinges on the concept of complexity, and we have no agreed-on definition.

WE have several definitions in common use, assuming one actually is rational and applies the term in the larger context of information theory. YOU haven't even got a clue as to how to define wtf you mean wrt to information and complexity to begin with, so while technically correct, your statement is meaningless. It's like a flat earther saying we have no agreed-on definition for the word "round".

harold · 27 June 2007

Sir Toe_Jam -

In fact, all you have to do is look up "complex" in Wikipedia and you get this pretty quickly.

http://en.wikipedia.org/wiki/Complex_adaptive_systems

I guess realpc should retire.

I'm almost feeling bad for beating him up so much now, since I have no problem with goofy new age beliefs in general, many of which aren't even in conflict with science.

But he's now proven that he knows NOTHING about evolution, nothing about ID or creationism, AND nothing about complexity.

And since that stuff is all he ever talks about...

realpc · 27 June 2007

harold,

The page you cited says: "complexity is hard to quantify in biology." You probably know that's what I meant. Commenters here at PT have come up with some bizarre definitions and examples of complexity, which you may have missed. At PT, we have not agreed on any definition of biological complexity.

In addition, some PT commenters deny that biological complexity has increased since life began. We had many frustrating philosohical debates about this.

The ID position depends on the idea that complexity has increased, and that RM + NS cannot account for it. NDists perform mental contortions to avoid the ID conclusion.

As I have been saying, this has nothing to do with politics or teaching the Christian creation myth in public school. It doesn't matter what various ID supporters believe about religion or sexual morality, or global warming. None of that has any relevance to the central question.

The UD site is political. I have nothing in common with them aside from accepting the central premise of the ID theory of evolution.

pigwidgeon · 27 June 2007

There is no ID conclusion, moron. They have /asserted/ that evolution cannot account for increasing complexity, without saying why, or defining complexity. It's not a conclusion. It's a sleazy trick to undermine confidence in evolution without doing any work.

There is also no ID theory of evolution, but we've already told you that in this thread and I can't be bothered with your dumbass attempts at trolling. I will, however, take the opportunity to educate real people.

realpc · 27 June 2007

Sounds like you're getting worried pigwidgeon!

PvM · 27 June 2007

And despite lack of agreement on the term complexity, Realpc seems to believe that complexity in nature increases.
Of course, ID has nothing to do with complexity really, it's merely the null hypothesis or the set theoretic complement of chance and regularity.
Complexity as defined by ID merely is an indicator of our ignorance.
Some have been confused by these unusual terminologies to actual come to a belief that ID has a real theory.
It doesn't.

harold · 27 June 2007

realpc - I have no reason to think that you're a bad person, but I realize that we can't have a two way conversation, and that you can't help yourself from straw-manning other peoples' positions. My guess is that it's not conscious dishonesty. I won't waste our time arguing with your original statements again, but for the sake of third parties, I'll show where your characterizations of the views of others are somewhat inaccurate. Again, I'm not arguing with your original views, but with what you say others said.
The page you cited says: "complexity is hard to quantify in biology." You probably know that's what I meant. Commenters here at PT have come up with some bizarre definitions and examples of complexity, which you may have missed. At PT, we have not agreed on any definition of biological complexity.
It is technically true that there is no single definition of "complexity", but the series of articles under that topic in Wikipedia, including the one I linked, tersely summarize a number of scholarly fields that make use of the term in a defined, quantifiable, and scholarly way. Obviously it is very difficult to quantify biological complexity. I make reference to it below, but in a colloquial way.
In addition, some PT commenters deny that biological complexity has increased since life began. We had many frustrating philosohical debates about this.
I have never seen anyone make this claim. No contradictions, please - I said I have never seen it, not that it never happened. While it is uncontroversial to state that complex multicellular organisms evolved from simpler ancestors - indeed, it would be hard core creationism to deny this - it does not follow that evolution always procedes monotonically and invariably in the direction of greater complexity. There are many examples of the loss of complexity (under almost any definition) through evolution, for example the evolution of intestinal parasites. There are many examples of morphological stasis over long periods of times. Much of the biomass is composed of prokaryotes. Furthermore, even if we bother to argue that there has been a net statistical increase in "complexity", with many exceptions, which may be true, there is no need to invoke magic to explain it. In fact, the article I linked addresses that point.
The ID position depends on the idea that complexity has increased, and that RM + NS cannot account for it. NDists perform mental contortions to avoid the ID conclusion.
This misrepresents the views of others on many levels. Putting aside that it does not accurately describe ID, you have been told over and over and over again that modern evolutionary theory does not depend on a simple mantra of what you call "RM and NS". In fact, in post 184679 above, I outlined some of the major known natural phenomenae that drive evolution, and asked you to comment. You chose to ignore the post. There is no such thing as an "NDist". There is no need for mental contortions to see that ID is nonsense.
As I have been saying, this has nothing to do with politics or teaching the Christian creation myth in public school. It doesn't matter what various ID supporters believe about religion or sexual morality, or global warming. None of that has any relevance to the central question.
The terminology "intelligent design" was first promoted by, and is strongly associated with, Behe, Dembski, and other Discovery Institute figures. They are the ones who invented ID, they are the ones who get to say what it means. They would not and do not endorse your ideas, which is nothing to be bothered by, so stop using their terminology.
The UD site is political. I have nothing in common with them aside from accepting the central premise of the ID theory of evolution.
Then stop using their terminology. UD is the official site of one of the most prominent architects of ID. A few comments of my own on some issues - For the record, I have no problem with the untestable idea that some kind of higher intelligence of consciousness had something to do with the "beginning" of the universe or whatever. Although I don't consider myself an atheist, I don't personally hold such a view in an affirmative way, but I have no problem with it. I am highly sympathetic to personal quests for spiritual enlightenment through meditation and ethical behavior, and believe that such activities "work", but I don't pretend to know whether anything more or less than healthy changes in brain chemistry are the explanation. Although it is reasonable to make a weak statement that some fraction of the biomass present at any time has gradually become more complex as a result of evolution, or even that the second law of thermodynamics implies that the universe will experience a very gradual net increase in complexity over time (although not necessarily in the way you mean), it is not reasonable to state that there is a monotonic or invariant tendency toward greater complexity in either case.

PvM · 27 June 2007

Perhaps Realpc can explain how he has gone from the foundation of ID to his interpretation thereof?

CJO · 27 June 2007

realpc couldn't explain ice to an Inuit.

Sir_Toejam · 27 June 2007

At PT, we have not agreed on any definition of biological complexity.

que Inigo Montoya.

realpc · 27 June 2007

"it is not reasonable to state that there is a monotonic or invariant tendency toward greater complexity in either case."

harold,

The system as a whole, not individual species, becomes more complex. I don't think we can assume our species will evolve into something more complex, for example. And the system could not survive without its base of primitive organisms.

My perspective is holistic, by the way, and I think of systems in terms of levels of organization. So when I say complexity is increasing, I am talking about the biosphere in general, or some level higher than the species.

And by the way, human civilization is an example of this tendency to evolve toward complexity. Although our biological evolution may have slowed or stopped, our cultural evolution has taken off.

Pastor Bentonit, FCD · 27 June 2007

The system as a whole, not individual species, becomes more complex.

— realCharlie Wagner:
Great. Now, what makes you think that? Be specific.

My perspective is holistic, by the way, and I think of systems in terms of levels of organization. So when I say complexity is increasing, I am talking about the biosphere in general, or some level higher than the species.

— realCharlie Wagner further:
(emphasis mine) Please then, in specific terms, explain the relevance of this to speciation.

And by the way, human civilization is an example of this tendency to evolve toward complexity. Although our biological evolution may have slowed or stopped, our cultural evolution has taken off.

— realCharlie Wagner further:
Please then, in specific terms, explain the relevance of this to speciation.

Henry J · 27 June 2007

I'd think that level of complexity (if that means anything) of the system as a whole would be mainly related to the number of current species, which I would expect to level off when the rate of extinction equals the rate of new species appearing.

As for complexity of the most complex of species, I'd expect that to level off when it reaches the point of diminishing returns; i.e., when even more complexity would cost more to maintain than it would produce in benefit.

Although as I'm not a biologist, my inferences could be wrong.

Henry

harold · 27 June 2007

realpc
The system as a whole, not individual species, becomes more complex. I don't think we can assume our species will evolve into something more complex, for example. And the system could not survive without its base of primitive organisms. My perspective is holistic, by the way, and I think of systems in terms of levels of organization. So when I say complexity is increasing, I am talking about the biosphere in general, or some level higher than the species. And by the way, human civilization is an example of this tendency to evolve toward complexity. Although our biological evolution may have slowed or stopped, our cultural evolution has taken off.
Although I don't endorse this, there is nothing here that is strongly at odds with science or the theory of evolution, nor that resembles ID. While it is obvious that there is no montonic or invariant tendency for individual lineages to evolve greater "complexity" by any reasonable standard, it would certainly be amiss for me to claim that I know whether or there is an overal statistical tendency for some measure of the overall "complexity" of the biomass to increase over time. It doesn't strike me as a very interesting question, but some may find it so. There is, of course, a huge difference between claiming that evolution, as it is understood, has this overall, statistical effect, versus denying that the theory of evolution explains evolution. The relationship between cultural "evolution" and biological evolution would seem to be merely that one can be used as an imperfect analogy to describe the other. Of course the human brain had to evolve to the point that we have culture, but now, cultural evolution is mainly driven by learning. If you put some kind of spiritual significance on the idea that some measure of the "complexity" of the biomass of the earth might show a statistical tendency to increase over time, well, it's a free country.

realpc · 27 June 2007

"There is, of course, a huge difference between claiming that evolution, as it is understood, has this overall, statistical effect, versus denying that the theory of evolution explains evolution."

First, NDE should not be called "The" theory of evolution, because that implies IDE is not a theory of evolution, and that there has never been any theory of evolution except ND. There have been other theories, and some of them came along before Darwin's. Lamarck's theory, for example, has been discounted but never disproven.

Increasing complexity of the biosphere is central to this debate. Can RM + NS adequately explain it, or not? We don't know.

All the pro-evolution evidence supports evolution in general, not NDE specifically.

NDE was enthusiastically accepted because it is the only theory of evolution that eliminates purpose and intelligence from nature. Natural purpose and intelligence are not the kind of things modern scientists like to deal with.

But alternate theories were discarded too readily. How did they supposedly disprove Lamarckianism, for example? I'm not saying Lamarckianism is correct (although I suspect some aspects of it are partially correct). My point is that NDE won the beauty contest before the other contestants ever got on stage.

As more is learned about complexity, NDE starts to look a little faded. Maybe something is missing after all.

The problem is that Dembski and Behe are radical revolutionaries, with respect to scientific naturalism. They aren't just criticizing some aspects of NDE, they are criticizing the philosophical foundation of current mainstream (non-holistic) science.

ben · 27 June 2007

First, NDE should not be called "The" theory of evolution, because that implies IDE is not a theory of evolution...
Please state the "IDE" theory as you understand it, including some predictions this theory makes, some evidence which would falsify it, and without referring to the supposed inadequacies of any other theory.

ben · 27 June 2007

....some evidence, if found, would falsify it...

Science Avenger · 27 June 2007

The troll is quotemined thusly: NDE should ... be called "The" theory of evolution... IDE is not a theory of evolution... there has never been any theory of evolution except ND. Darwin's... theory, for example, has been discounted but never disproven. Increasing complexity of the biosphere ...? We don't know. All the ...evidence supports evolution in general... NDE was enthusiastically accepted ... it is the only theory of evolution...from nature. Natural...things modern scientists like to deal with. As more is learned ....complexity...starts to look a little faded. Maybe something is missing after all. The problem is ... Dembski and Behe. They aren't just criticizing ... NDE, they are criticizing the ... mainstream ... science.

pwe · 28 June 2007

The problem is that Dembski and Behe are radical revolutionaries, with respect to scientific naturalism. They aren't just criticizing some aspects of NDE, they are criticizing the philosophical foundation of current mainstream (non-holistic) science.

— realpc
Excuse me for asking, but are you being serious here? Radical revolutionaries?Because they claim that if they can show that something is necessarily designed, there is necessarily a designer? Dembski and Behe aren't saying anything (Dembski makes some farting noises, though), and they have prove of even less. Sorry, but that's the plain and simple truth. - pwe

Nigel D · 28 June 2007

Realpc, I note first that you address only a very small minority of the points raised against your position. In contrast, several of the rest of us have addressed every statement in some of your posts. In what way do you adopt a holistic view, exactly? Second, you keep using the abbreviation "ND" or "NDE" as if it were relevant to anything. If you wish to use an abbreviation to represent the modern form of evolutionary theory accepted by the scientific mainstream, please use "MET", which actually has some meaning relevant to a discussion taking place in the 21st century.

"There is, of course, a huge difference between claiming that evolution, as it is understood, has this overall, statistical effect, versus denying that the theory of evolution explains evolution." First, NDE should not be called "The" theory of evolution, because that implies IDE is not a theory of evolution, and that there has never been any theory of evolution except ND.

— realpc
You are the only person using the term "NDE" in the first place (qualification - others may have used it in answering your posts but I can't be bothered to check). There is only one theory of evolution that has satisfied the scientific peer-review process to explain the combination of similarity and diversity that we see in the biological world. Thus, while this theory comprises several mechanisms by which evolution occurs, it is right and proper that it be called "the" Theory of Evolution.

There have been other theories, and some of them came along before Darwin's. Lamarck's theory, for example, has been discounted but never disproven.

Yes, there have been other theories. Some have led to modifications of the prevailing view of evolutionary theory at the time. The others have all failed, some because they could not explain the evidence we find as well as MET does, some on the grounds of logic, some on the grounds of mechanism, and some for combinations of these. And, please, if I could be bothered, it would take me no more than a day to design an experiment that would disprove Lamrackian evolution, and most of that time would be spent researching the actual predictions of Lamarckian evolution. I am fairly sure that Lamarckain evolution has been disproved by virtue of the fact that it does not agree with the evidence.

Increasing complexity of the biosphere is central to this debate.

On the contrary, complexity as a concept is pretty much irrelevant to this debate. What is relevant is what has been observed to occur in the various biological sciences, and what is observed to have occurred in paleontology. Complexity is only a word that scientists use within strict definitions, except perhaps in casual conversation. It has no sufficiently precise meaning to be of any use in biology in any technical sense.

Can RM + NS adequately explain it, or not? We don't know.

Again, this is your strawman. It does not matter if RM+NS can or cannot explain any increaes in complexity. MET contains significantly more than RM+NS. What we do know is that MET provides us with a logical, consistent and universally-applicable explanation of how modern organisms arose from precursor species.

All the pro-evolution evidence supports evolution in general, not NDE specifically.

Are you deliberately ignoring what has preceded in this debate? MET is supported by a wealth of evidence. There is no challenger.

NDE was enthusiastically accepted because it is the only theory of evolution that eliminates purpose and intelligence from nature.

No, no, no. MET is accepted by science (and Darwin's original theory of evolution) because it explains relationships that cannot be satisfactorily explained in any other way. You can blather on about purpose and intelligence aas much as you like, but you will not change the fact that there is no evidence to support the hypothesis that organisms were designed by a purposeful intelligence. Since this hypothesis, in the absence of supporting evidence, violates the guideline of parsimony, it is rejected. Every claim made by Dembski, Wells, Behe et al. that there is evidence that supports the "design hypothesis" has been shown to be false. Behe's Irreducible Complexity has been shown to be an illusion; but even if it were a useful tool for biological scientists, IC has been shown to be a prediction of MET, so there is no challenge here. Dembski's Complex Specified Information, has been shown to be improbability by another name (in Dembski's own definitions); and yet Dembski's calculations of improbability are performed with a breathtaking chutzpah for ignoring any biological relevance whatsoever.

Natural purpose and intelligence are not the kind of things modern scientists like to deal with.

On the contrary, finding purpose in nature is a field of endeavour within MET: but the purpose is nothing more than the accumulation of survival or reproductive advantages. It has been pointed out elsewhere that, using Dembski's definition of design, MET represents a design process. As for intelligence, how would we ever tell, in principle? How would we distinguish good purposeful design that arose through the mechanisms described by MET from good purposeful design that arose by the action of some mysterious intelligence? Fortunately, there are other things we know. We know that much of nature shows poor design, jury-rigging, and the turning of old morphologies to new purposes. We know that we are the only intelligence on this planet that changes our environment and builds tools from many different components. We also know that what we have done in the past leaves evidence that can be found now. What has happened to the multitude of organisms in Earth's biosphere has left evidence that we can read now. Yet nowhere is there any evidence that any species on this planet that preceded us possesses what we would call intelligence. So your point about the likes and dislikes of scientists is irrelevant. Scientists are people; we are all different; we all like and dislike different things. I know some scientists who hate spiders. But, there are scientists studying spiders.

But alternate theories were discarded too readily. How did they supposedly disprove Lamarckianism, for example? I'm not saying Lamarckianism is correct (although I suspect some aspects of it are partially correct).

Really? What aspects of Lamarckism do you consider to be correct? Please, go into detail.

My point is that NDE won the beauty contest before the other contestants ever got on stage.

Sadly, science is not a beauty contest. You don't get to vote for your favourite theory. Science relies on evidence, and on logical conclusions drawn from the evidence. The theory that wins is the one that does the best job of explaining the evidence. When a new theory is proposed, it will only replace the old theory if it does a better job of explaining the evidence.

As more is learned about complexity, NDE starts to look a little faded.

As I pointed out many posts earlier, Neo-Darwinism is about 70 - 80 years out of date. MET is looking as fresh as a daisy, what with new dinosaur-bird intermediate fossils cropping up in China, and new phylogenetic studies coming from molecular biological data (and probably many other things of which I am not aware).

Maybe something is missing after all.

Well, I'm starting to suspect your reading comprehension skills...

The problem is that Dembski and Behe are radical revolutionaries, with respect to scientific naturalism.

What they propose is radical. The "evidence" they put together to support it is rather feeble, and easily demolished. Their reasoning is flawed. Yet they demonstrate no respect for science, naturalistic or otherwise. A scientist, when presented with a substantive objection to his / her pet theory, will seek more evidence and will attempt to adress the criticism. None of the pro-ID authors have done this. Consequently, they repeat the same tired, already-refuted arguments.

They aren't just criticizing some aspects of NDE,

Actually, the bulk of what they do is attempt to criticise MET, yet they do not accept that their critiques are flawed and fallacious. Most commonly, they do what you have done in this thread, and critique a strawman of MET.

they are criticizing the philosophical foundation of current mainstream (non-holistic) science.

Unfortunately, they do not actually address the philosophical foundation of modern science. This has been examined by philosophers of science (who have actually bothered to understand how the science works) over the last 40 years or so. In what way is mainstream science non-holistic? What could be more holistic than General Relativity, or Quantum Theory, or Evolutionary Theory?

Pastor Bentonit, FCD · 28 June 2007

For the general audience: realpc AKA Charlie Wagner is the second (only to the legendary John A. Davidson) largest crank ever to have "blessed" this forum with his presence. He is completely and utterly uneducable. As a consequence, he also believes that if there is something he doesn´t know - and man-o-Manischewitz there´s plenty - then we don´t know either.

zilch · 28 June 2007

realpc- I, too, am curious about which aspects of Lamarckism you suspect to be partially correct, and what you would consider to constitute a "disproof" of Lamarckism. As far as I recall, August Weissmann did a pretty good job of disproving it in 1889. Or perhaps Lamarckist effects are still hiding somewhere, along with leprechauns and irreducible complexity?

realpc · 28 June 2007

"MET is looking as fresh as a daisy, what with new dinosaur-bird intermediate fossils cropping up in China,"

Yeah, that's what I keep trying to tell you. The evidence is always for evolution, not for the currently accepted explanation of evolution. Evolution is already an established fact. So there's more evidence for it? Ok, how does that support the RM + NS theory (and that IS the currently accepted theory)? It doesn't. There is no evidence for RM + NS only as the explanation for the origin of new species.

It's difficult or impossible to prove that the current theory, what you call MET, is wrong. You can always use the standard reply -- given enough time, anything is possible.

It might also be impossible to disprove IDE. Maybe the question won't be answered. But it is an important and interesteing controversy, and trying to silence the dissenters is a mistake.

PvM · 28 June 2007

There is no evidence for RM + NS only as the explanation for the origin of new species.

But there is: we observe that variation is "random" and that natural selection is a real mechanism. In other words, RM&NS is a real theoretical explanation. While ID is basically reduced to the same argument from ignorance you seem to propose "there is no evidence for RM + NS only" as the explanation for the origin of new species. Certainly, as I have shown, there is no evidence for ID as a scientific explanation because it is based on ignorance.

But it is an important and interesteing controversy, and trying to silence the dissenters is a mistake.

On the contrary, letting the 'dissenters' speak shows sufficiently how vacuous the concept of ID really is. It's not about silencing dissenters at all... But you are right that ID is all about negative arguments .

PvM · 28 June 2007

Increasing complexity of the biosphere is central to this debate. Can RM + NS adequately explain it, or not? We don't know.

We do know that RM_NS can explain increasing complexity quite simple. Schneider, Adami all have shown this. Now I can understand that you may not be aware of their work but the fact that 'you don't know' is no argument against RMNS. Just ask..

PvM · 28 June 2007

NDE was enthusiastically accepted because it is the only theory of evolution that eliminates purpose and intelligence from nature. Natural purpose and intelligence are not the kind of things modern scientists like to deal with

I am glad that realpc agrees that purpose and intelligence is just a synonym for the supernatural deity. In fact, RMNS explained teleology in nature, not eliminated it.

Richard Simons · 28 June 2007

realpc, June 25, #184571
No they claim that RM + NS is not adequate to explain evolution.
Nigel D, June 25, #184585
Have you never heard of genetic recombination, neutral genetic drift or sexual selection? These are other processes that form a part of modern evolutionary theory.
realpc, June 25, #184590
NDE states that RM and NS alone can account for the origin of species.
slang, June 26, #184654
why do you continue to say "NDE states that RM and NS alone can account for the origin of species." when Nigel just explained that to be a strawman, as have many others before?
realpc, June 27, #184811
The ID position depends on the idea that complexity has increased, and that RM + NS cannot account for it.
harold, June 27, #184860
modern evolutionary theory does not depend on a simple mantra of what you call "RM and NS".
realpc, June 27, #184907
Can RM + NS adequately explain it, or not?
Nigel D, June 28, #184976
MET contains significantly more than RM+NS.
realpc, June 28, #184988
Ok, how does that support the RM + NS theory (and that IS the currently accepted theory)?
Pastor Bentonit, FCD on June 28, #184985
realpc AKA Charlie Wagner is the second (only to the legendary John A. Davidson) largest crank ever to have "blessed" this forum with his presence. He is completely and utterly uneducable.
Pastor Bentonit, you may have a point there.

steve s · 28 June 2007

I don't know if he's charlie wagner, but whoever realpc is, Richard makes it clear he has a learning disability.

J. Biggs · 28 June 2007

I don't know if he's charlie wagner, but whoever realpc is, Richard makes it clear he has a learning disability.
I vote for anterograde amnesia. Do I have a second?

J. Biggs · 28 June 2007

Really RealPC, just about everyone here has told you that your whole, "NDE which is RM+NS is the currently accepted theory." is a straw-man of what the currently accepted theory (Modern Synthesis) really is.

You haven't even heralded any evidence(from the literature or otherwise) to support the primary premise on which you base all of your argumentation. You criticize the logic of others but it seems you are the only one using circular logic here. Please go away until you have some real insight to offer other than your whole NDE can't explain complexity crap.

Glen Davidson · 28 June 2007

The problem is that Dembski and Behe are radical revolutionaries, with respect to scientific naturalism. They aren't just criticizing some aspects of NDE, they are criticizing the philosophical foundation of current mainstream (non-holistic) science.

Excuse me for asking, but are you being serious here? Radical revolutionaries? Sure, Charlie's serious. He doesn't know the difference between reactionaries and revolutionaries. It is radical (but only in a way), of course, to say that ID and astrology count as science. But it's the usual with apologists, they want to destroy other disciplines, and not their own. Has anyone heard a peep from the egregious Behe about how chemistry ought to give way before alchemy, that the two should be used and taught side by side? Of course not, he's all for destroying biology, astronomy, and cosmology, not chemistry. This is why he's not revolutionary, and even his "radicalism" is bizarre. Charlie's too stupid, of course, to recognize that Behe has no interest in destroying chemistry, but he doesn't. Behe doesn't know or value biology and astronomy, however, so he flails away at them. True, Dembski, Paul Nelson, and many others who know almost nothing about science (certainly not as practiced and understood in a useful manner, at least), are completely willing to destroy whatever science it takes to make way for their predicted theological triumphs (Waterloo!). They're not aiming at chemistry and Newtonian physics, but they'd likely to plenty of collateral damage to both, as they don't know these sciences nor care about them. But they're not about to give up relying upon their own specialized "knowledge", which in fact cannot survive a wholesale attack on empiricism either. Dembski uses applied mathematics, whose axioms and postulates only "apply" due to their empirical "truth". Never mind, though, Dembski isn't going to give up on the "soundness" of using math in this world, hence he does rely upon empiricism. To be sure, Dembski's attacks on "naturalism" (Charlie's also too stupid, craven, and dishonest to answer Newton, who I posted not too long ago) are thereby self-refuting, since if empiricism is fundamentally flawed, he can say nothing about the empirical world using his mathematics. But like Charlie, there is no intellectual honesty or decency in his methods.

Because they claim that if they can show that something is necessarily designed, there is necessarily a designer?

As I noted above, all of their claims are self-refuting. Either empiricism works, or they can say nothing using their own methods which rely on empirical observations.

Dembski and Behe aren't saying anything (Dembski makes some farting noises, though), and they have prove of even less. Sorry, but that's the plain and simple truth.

Charlie knows nothing about truth. That's why he makes the equivalent of farting noises, including on forums like this one from which he has been formally banned. Glen D http://tinyurl.com/35s39o

Glen Davidson · 28 June 2007

Or, wait, has Charlie been banned or not?

I guess I think of him as having been banned, because he's violating the rules by switching names, at least without informing that he has done so (I assume, don't know, that he hasn't).

Anyhow, it's like Pastor Bentonit says, he's one of the worst trolls on these forums, never learning, repeating the same nonsense, and ignoring whatever he doesn't understand, which is nearly everything above 8th grade level.

Glen D
http://tinyurl.com/35s39o

Mike Elzinga · 28 June 2007

Maybe realpc thinks he is doing the "Messin' With Sasquatch" thing. He appears to have about the same dopey "mentality" as those guys in the Beef Jerky ad on TV.

Torbjörn Larsson, OM · 28 June 2007

harold: Sorry for late response, trying to catch up now.
I see three distinct relationships with science.
Well, I see two. ;-) I certainly don't think that everything we do or think is rational or can be rationally motivated. In a world with fuzzy access to data and no good models, we have to do our best. I do think however that there is a practical, qualitative difference between justified beliefs and beliefs.
For me, any creationist claim, broadly defined (any strong claim that natural processes can not explain the evolution of cellular and post-cellular life, or any strong claim that life could never haver originated naturally) renders the claimer a "creationist" (and thus dishonest or ill-informed), rather than a theistic evolutionist.
I could go with this philosophical distinction. However, society push another definition on us. For example, the pope is apparently to be considered as theistic evolutionist in spite of his belief in creative gods. That is why I did the qualification above, there most TE's actually are creationists (by your definition), and this is the slippery slope. [I'm writing "creative", because creative agents by definition must create (shape or design). The "interventionist" definition of philosophy is too vague here.] Btw, I place Miller on the creationist side because he claims that his gods may be able to influence evolution by quantum effects et cetera. He is adding unnecessary, unproven creative agency to evolutionary theory. Let me also add that you have written one of the best and considered statements on theistic evolution I have seen. I especially liked your non-interventionist (as I understood it) description. all: On realpc/charlie wagner (To distinguish him from sane sometimes commenter Charlie Wagner), wouldn't charlie when cornered by him refuting himself from earlier comments start to proclaim how he have taught children (shudder) and therefore must 'know' things? But otherwise, yes, a carbon copy of charlie. The type will troll indefinitely in discrete comments - it is a member of the class of countable active, unbounded trolls.

realpc · 28 June 2007

"any strong claim that life could never have originated naturally renders the claimer a "creationist" "

And that statement hinges on the word "naturally." By "naturally," you probably mean in accordance with your preferred view of reality.

"Supernatural" is also used without a definition in these debates. I think there are higher order dimensions, which are hypothesized in physics, but which science really knows nothing about. So would those higher levels belong to "nature" or to "super-nature?" What if, as David Bohm believes, lower levels unfold from higher levels? What if evolution on our level is guided somehow by processes on some higher level? That doesn't seem far-fetched, but it would be compatible with ID.

There is no point using the word "natural" if you never indicate what you mean by it.

harold · 28 June 2007

realpc - You lifted this from a post that I addressed to someone else... "any strong claim that life could never have originated naturally renders the claimer a "creationist" " Although it's true in that form, here's the real quote.
For me, any creationist claim, broadly defined (any strong claim that natural processes can not explain the evolution of cellular and post-cellular life, or any strong claim that life could never haver originated naturally) renders the claimer a "creationist" (and thus dishonest or ill-informed), rather than a theistic evolutionist.
A major distortion - my quote clarified and defended the position of theistic evolutionists, you tried to distort into something else. Incidentally, your "cherry picking" of tiny "soundbites" that you think you can address, while you ignore the substance of posts, makes you look really, really silly. And that's before you edit them. Are you even fooling yourself?
And that statement hinges on the word "naturally." By "naturally," you probably mean in accordance with your preferred view of reality.
This is a meaningless statement. By a "natural" or "scientific" explanation, I mean one that can be accepted by sane, honest people, not like you, across a wide range of views, as long as they accept some basic axioms the underly science. For example, I've worked with religious Mormons in a scientific context.
"Supernatural" is also used without a definition in these debates.
When you accuse others of using words that they can't or don't define, it's an example of projection. You do that, others don't. Here's a decent discussion of the term "supernatural" http://en.wikipedia.org/wiki/Supernatural Why don't you cherry pick out one phrase from it and set up a silly sixth grade level "contradiction" to it? That'll show 'em.
I think there are higher order dimensions, which are hypothesized in physics, but which science really knows nothing about. So would those higher levels belong to "nature" or to "super-nature?".
Obviously, almost all physicists would say that everything studied by physics is part of "nature". In fact, they wouldn't call it "physics" if that weren't the case, would they?
What if, as David Bohm believes, lower levels unfold from higher levels?
I believe you may have it backwards, but unlike you, I won't risk grossly misrepresenting David Bohm. None of David Bohm's work is considered to be at odds with mainstream science, and he was not a creationist nor evolution denier. http://en.wikipedia.org/wiki/David_Bohm
What if evolution on our level is guided somehow by processes on some higher level?
Again, if this kind of spiritual and philosophical conjecture is made in a way that does not deny observed reality, I have no problem with it. It's just non-testable conjecture. However, there is no NEED to conjecture any specific magic interfering with the evolution of life - we can explain it without that.
That doesn't seem far-fetched, but it would be compatible with ID.
No, it wouldn't. ID would still be wrong. The bacterial flagellum, malaria parasite, and blood clotting system can be explained naturally. Just because a bird's nest was designed by a bird doesn't mean that living cells were designed in the same way.

PvM · 28 June 2007

And that statement hinges on the word "naturally." By "naturally," you probably mean in accordance with your preferred view of reality.

Probably not

ben · 29 June 2007

There is no point using the word "natural" if you never indicate what you mean by it.
There's no point in yammering on about "Intelligent Design Theory" if you refuse to ever state what that thoery is or direct us to a place where someone else does. Here's my theory of ID, succinctly stated: There is no ID theory.

KL · 29 June 2007

Interesting that realpc considers Dembski a revolutionary, yet doesn't find anything of use on uncommon descent, his main blog. (??)

David B. Benson · 29 June 2007

Technically, realpc has violated the PT posting rules, and so is banable, for having posted also using the names realPC and realpc2. Or so I think. An administrator would have to check the IP addresses attached to these nom-de-blog...

Coin · 29 June 2007

Things seem a bit died down here, so I'd like to ask for some opinions on a minor technical point. This discussion contains a pretty good example of something I frequently see come up in evo vs creo flamewars, which is the question of whether "RM + NS" is the same thing as "evolution". Here this takes the form of: RealPC:

[ID supporters believe that] RM + NS is not adequate to explain evolution

Response:

First off, let me straighten you out on some terminology. "Random" mutation and natural selection are two of several mechanisms that form a part of meodern evolutionary theory. When I use the term "evolution", and in most of the contexts in which I see that term, it means "modern evolutionary theory". It has a second meaning, that of "change over time", in which it is also used. However, for the sake of simplicity, I use it only in its first meaning in discussions such as this one.

The second comment is an argument I usually see made when an anti-evolutionist attempts to cast evolution as "RM+NS". But while I understand the spirit behind this comment-- no, RM+NS is not all there is to evolution, our understanding of evolution has increased since the Harding administration and there are indeed other "mechanisms" at work in the evolutionary process-- depending on how it's worded I'm sometimes not sure I strictly agree with it, since it seems to me the "other mechanisms" are not actually separate from RM+NS, but examples of RM+NS at work. As far as I can tell, the other systems at work in evolution-- genetic recombination, sexual selection, punctuated equilibrium-- are all emergent mechanisms, side effects of RM+NS which are built entirely on top of RM+NS. The only exceptions (lateral gene transfer by viruses, perhaps), the things which are not fundamentally based on RM+NS, are minor effects generally negligible to the process of speciation. For this reason (though I would disagree with any wording of this idea, such as that used by RealPC, that implies that the "theory of evolution" consists only of the study of these two things), I would absolutely agree with the idea that random mutation plus natural selection is sufficient to explain the complexity of life on earth. Would anyone disagree with this, and if so, why?

realpc · 29 June 2007

"random mutation plus natural selection is sufficient to explain the complexity of life on earth."

Yes, exactly -- that is the current standard theory. And ID says it isn't sufficient. That is the essential debate.

Science Avenger · 29 June 2007

Coin, when I read the word "mutation" I think of point mutation. Is gene duplication really a mutation? It seems like the definition of "mutation" has to be made too broad to do what you suggest. What do the biologists in the audience say?

As for sexual selection, I always considered that a completely different form of selection from natural selection, the latter being concerned with survival. Am I being too narrow?

CJO · 29 June 2007

Sexual selection is a subset of natural selection in which the fitness landscape is highly skewed in favor of a trait reinforced by mate choice (usually female choice). It's important to remember that the "environment" that does the selecting always includes one's conspecifics.

It gets interesting, of course, in cases of "runaway" sexual selection, where the trait of interest might actually be highly deletrious were there not the strong pressure toward mating success, and this is where people perceive a conflict between sexual and what might be termed "pure" natural selection. But, as we've learned, fitness landscapes are always multi-dimensional. It's important as well to keep in mind that the female's choosiness is also a product of evolutionary pressure. All evolution is co-evolution.

Coin · 29 June 2007

Science Avenger: Those are really good points. I'd personally tend to use both "mutation" and "natural selection" in the most general senses, i.e. "mutation" meaning any error in the genome and natural selection being any preferential representation of phenotypes in a new generation; but I of course would not say these are the only or necessarily even the preferable definitions of these words. So I'm not really sure what the best way to word things would be...

CJO · 29 June 2007

I would say, additionally, to Science Avenger, that natural selection is really not concerned with survival, except in the obvious sense that some duration of survival is a necessary condition of reproduction. How long that duration needs to be varies greatly across the biosphere, from about a half an hour to a decade or more, of course, so among us megafauna survival to reproductive maturity is unusually salient. But reproductive success is the only variable selection has to work with when it's all said and done.

Torbjörn Larsson, OM · 29 June 2007

As far as I can tell, the other systems at work in evolution--- genetic recombination, sexual selection, punctuated equilibrium--- are all emergent mechanisms, side effects of RM+NS which are built entirely on top of RM+NS.
I think the point is that these other, emergent or elaborated mechanisms, are either easy to forget because they behave differently than strong "RM+NS" (such as neutral drift), or difficult to derive directly from "RM+NS" (being emergent). So for practical reasons you list them all. Sort of like when you discuss physics. Sure, it is QM in the bottom. But without some descriptions of emergent phenomena you would have a hard time modeling, say, our solar system. Also, depending on philosophy, AFAIU "RM" isn't enough to explain the variation that selection acts on. I believe the environment affects how much variation "RM" contributes at any specific time, as well as how "NS" works on it. For example, hair insulation is more or less effective depending on temperature. Maybe you want to soak this description up into "RM", but it seems unnatural to me.

Henry J · 30 June 2007

As far as I can tell, the other systems at work in evolution--- genetic recombination, sexual selection, punctuated equilibrium--- are all emergent mechanisms, side effects of RM+NS which are built entirely on top of RM+NS.

Except for recombination, I'd agree those other things are special cases of the most general sense of RM and NS. Recombination strikes me as a highly evolved form of horizontal transfer. Henry

PvM · 30 June 2007

"random mutation plus natural selection is sufficient to explain the complexity of life on earth." Yes, exactly --- that is the current standard theory. And ID says it isn't sufficient. That is the essential debate.

ID claims that our ignorance is evidence of complexity. Yet we know that at least in principle RMNS is able to explain the complexity. Lacking much of any positive argument, ID is reduced to. Well but we don't know... Real science is moving on, ID is hiding.

christorvik@yahoo.com · 30 June 2007

"It's all so funny really. It is refreshing to step back and see that we are all still such children, haggling over what something is or isn't. As a young child we picked up and tried to discern, with our limited database of knowledge, what objects were. Though we cannot recall the emotional feeling of 'awed wonder', we are delighted when we see it reflected on the face of our young.

To me it seems very clear.

But first let's set the stage here.

First we have the EVOLUTIONISTS. They say evolution is the only way to go because some viruses, bacteria etc. have been found to mutate into changing their number of chromosomes, i.e. become ANOTHER SPECIES entirely, by our chromosomal spe-cial definition.
They say, if the viruses can mutate into another species, then so can everything.

Then there are the CREATIONISTS. They say NO EVOLUTION! Everything was created with the wonderous, miraculous powers of God. And they would as soon hang you as a heretic, than listen to you even consider suggesting that GOD is an ALIEN.

Though the CREATIONISTS HAVE SOFTENED A BIT THESE LAST FEW YEARS, EITHER OF THE ABOVE TWO CAMPS SCOFF AT ANY THEORY THAT ENCOMPASSES BOTH IDEAS.

To me - it seems pretty clear.

Yes, viruses and bacteria can mutate, even to the point of the new generations being different species, by our cromosomal count standard.

However, where is the proof that anything higher than a crustacean has done this?

- - - - - -

THE WAY I SEE IT, THERE IS A MORE ADVANCED PERSON(S) - OR ENTITY (IES). CALL HIM OR THEM "GOD", IF YOU LIKE. THEY HAVE LEARNED THE INS AND OUTS OF DNA COMPLETELY. THEY ARE COMPLETE MASTERS OF THE SUBJECT.

THEY CREATED US. THE BUILDING BLOCKS THEY USED ARE THE SAME, AND SOME PARTS ARE SIMILAR - HOWEVER NO "LINK" CAN BE FOUND BECAUSE THERE IS NONE. SIMILARITIES CAN GIVE HOPE TO A "LINK', BUT WHO NEEDS A LINK?

To clarify:
WHEN YOU WERE A KID AND YOU PLAYED WITH YOU ERECTOR SET DID YOU CHANGE YOUR BUILDING JUST ONE PIECE BY ONE PIECE AT A TIME? MAYBE SOMETIMES YOU DID, BUT USUALLY YOU TORE IT DOWN AND CREATED ANOTHER ONE. SOME FACETS WERE THE SAME, BUT A 'MISSING LINK' WAS CERTAINLY NOT EVER TO BE FOUND IF SOMEONE WANTED TO RECREATE BOTH MODELS.

AS WE GOT OLDER WE BECAME MORE COMPLEX IN OUR ERECTOR DESIGNS. SOME OF US LOST INTEREST. OTHERS WENT ON TO BECOME ARCHETECTS AND BECAME QUITE PROFICIENT AT CREATING IN THE 3RD DIMENSION AT THE FOURTH DIMENSION.

Perhaps DNA is 5th dimensional.

To me it's obvious that we did not entirely evolve from thunder and sunshine, like a computer cannot just 'come to be'. It takes an intelligent design somewhere along the line. A basic law of physics states that, "Any system without work gets more chaotic."

I suppose it would be possible to creat a simple organism that would grow into a mammal over generations - as long as it was encoded in the DNA to do that. However, from the evidence of the dinasaurs, and what our "folklores" tell us, God created us "in his image", knowing full well that we could happen upon this "tree of life" (The Human Genome Project - the "Human Tree of Life".) Our lore tells us that God did not want us to do this, just as a parent doesn't want a child to do something that can harm him; and believe me, the potential for harm when speaking of genetic creation, is expontentially larger than we would first contemplate. (So far, we didn't forsee "chimera viruses" - opps!)

But God gave us Pokeymon to practice with, and tv came from somewhere, in part, to sedate our minds."

KL · 30 June 2007

posting three times and using capitals does not make your argument any stronger

David Stanton · 30 June 2007

This JERK already dumped this LOAD OF CRAP on another thread. Anyone interested in examples of speciation can go there to see my reply. As for the intermediate form CRAP, here is a partial list of some intermediates between major vertebrate groups (references available at the web site listed):

Fish 12
Amphibians 18
Reptiles 19
Birds 12
Mammals 30
Whales 11
Horses 25
Elephants 11
Humans 11

talkorigins.org/faq/transitions

Longhorn · 1 July 2007

Coin wrote: "For this reason (though I would disagree with any wording of this idea, such as that used by RealPC, that implies that the "theory of evolution" consists only of the study of these two things), I would absolutely agree with the idea that random mutation plus natural selection is sufficient to explain the complexity of life on earth.

Would anyone disagree with this, and if so, why?"

I strongly disagree with it. For one thing, sexual reproduction contributed to some of the organisms on earth being as complex as they are; for there is a hugely significant correlation between the evolution of sex and, on average, greater complexity among organisms than what occurs without sex. Put it this way: Had sex not evolved, there would not be organisms on earth that are as complex as elephants and humans. Sex contributed to the differences among many organisms. Look at how different asexually reproducing organisms are from each other, and look at how complex they are. Now look at how different mice, T-rexes, flowering plants, dolphins, elephants, giraffes, brontosauruses, eagles, Toucans and humans are from each other. They are as different as they are partly because sexual reproduction evolved.

Vast numbers and combinations of organisms sexually reproducing did not, by itself, cause a population of fish to evolve into elephants. Obviously the events we call mutations were important as well. But vast numbers and combinations of organisms sexually reproducing contributed to fish evolving into elephants.

Here is a quote from Ernst Mayr:

"Evolution in sexually reproducing organisms consists of genetic changes from generation to generation in populations, from the smallest local deme to the aggregate of interbreeding populations in a biological species. Numerous processes, particularly mutation, contribute to these genetic changes to supply the phenotypic variation needed by selection. The most important factor is recombination, which is largely responsible for the virtually inexhaustible supply of new genotypes in every generation. Selection, then, is responsible for the elimination of all but on the average two parents. Those individuals that are best adapted to the abiotic and biotic environment have the greatest chance to be among the survivors. This process favors the development of new adaptations and the acquisition of evolutionary novelties, thus leading to evolutionary advance, as stated in the language of evolutionary biology" (What Evolution Is, p. 157).

What features of sex have been important in contributing to differences among some organisms? Well, one thing: it is a great way of combining helpful DNA sequences in organisms. For example, there are a number of genes that contribute to skin color in humans. Sex can put those genes in organisms and help the organism live and reproduce. There may be other features of sex that have contributed to the differences that some organisms share. But that is one.

Sex (without mutations) did not cause a population of fish to evolve into humans. But sex, mutations, and varying levels of reproductive success were kind of events that were, at the very least, hugely important in causing a population of fish to evolve into humans.

Longhorn · 1 July 2007

An interesting aspect of sex is this: It sometimes causes the existence of an organism that has a trait that is more accentuated than the trait is in any other member of the population. For example, humans have been breeding sugar beets for some time. In the early 1800s the sugar beet had about 5% sugar content by weight. In comparison, today's beets have about 20% sugar content. Sexual reproduction can put together all the genes that can contribute to an increase in sugar content. So let's say there are 11 genes in the sugar beet population that tend to increase sugar content. But not all 11 of those genes are in any one beet. You can cross various beets to get all 11 genes in some beets. Now there may have been mutations to some sugar beets that occurred after 1800 that contributed to the increase in the amount of sugar content in the beets. But there may not have been. It might have been that, simply by crossing certain beets, humans increased the sugar content of beets so that the sugar content of some of the beets was higher than it was in any member of the population before the breeding began. Moreover, if there were new mutations that occurred after 1800 that tended to increase the sugar content, all those mutation could, via sexual reproduction, be combined in some organisms to increase the sugar content of some members of the population. So, mutations that occurred after 1800 may have helped increase the sugar content. So, for example, beet A may have come into being with a new mutation that tended to increase A's sugar content. Five years later, beet B may have come into being with a new mutation that tended to increase B's sugar content. By crossing beets A and B, we could have brought about a beet that had even greater sugar content than beets A or B.

Moreover, the same process was at work with giraffe's necks. Because certain giraffes reproduced with each other, it contributed to their necks getting longer and longer. Now there is going to be a limit to how long the neck can get without new mutations that affect neck size occurring in the population. But just putting all the "neck-size increasing" genes together through sex can contribute to a member of the population having a longer neck than any other member of the population. This accentuation of traits occurs in sexual reproduction at least because sex puts the maximum number of genes that produce a certain protein together in members of the population. So, if there are 11 genes in a population that tend to produce lighter skin color, sex can eventually put all those genes together in some members of the population. And let's say a gene mutates so that it tend to produce a greater amount of a particular protein than do other versions of the same gene. The organism that has the mutation can produce offspring that inherit the mutation. These offspring can reproduce with each other, so that some of them have two copies of the mutation. This might contribute to an accentuation of the trait.

A final point: diet and activity (for instance, exercise) are other kinds of events that contributed to greater complexity in some organisms. For example, organisms that are poorly nourished tend to be less complex in certain ways than other members of the population, for example, in terms of brain development, size and musculature. And consider the muscle mass on professional body builders. It is partly the result of diet, exercise and, in some cases (unfortunately) anabolic steroids. On how interactions between an organism and its environment affect diversity and complexity, I recommend Richard Lewontin's book The Triple Helix.

Now if one gets in excellent condition through diet and exercise, one will not be able to directly pass this trait down in the same way that one passes down a gene. However, the diet and exercise can affect the quality and quantity of one's sperm, which can affect one's ability to produce viable and complex offspring. Moreover, it might be that high levels of stress tend to increase the likelihood of mutations to gametes. Most mutations are neutral or harmful. But some mutations are reproductively beneficial. Finally, if organism X gets in good shape through diet and exercise, it can increase the number of members of the opposite gender that are willing to reproduce with X. This can enable one to reproduce with a more fit and interesting member of the population, which can contribute to offspring that are better able to flourish.

Longhorn · 1 July 2007

I wrote: "An interesting aspect of sex is this: It sometimes causes the existence of an organism that has a trait that is more accentuated than the trait is in any other member of the population."

Along these same lines, sex sometimes contributes to the existence of organisms that are able to do relatively well in a particular environment. For example, by crossing red carnations with white carnations, I can get pink carnations. By crossing certain sugar beets, I can increase the sugar content in some beets. Finally, when Michael Jordan's mother reproduced with his father, it contributed to the existence of Michael Jordan.

Nigel D · 3 July 2007

The second comment is an argument I usually see made when an anti-evolutionist attempts to cast evolution as "RM+NS". But while I understand the spirit behind this comment--- no, RM+NS is not all there is to evolution, our understanding of evolution has increased since the Harding administration and there are indeed other "mechanisms" at work in the evolutionary process--- depending on how it's worded I'm sometimes not sure I strictly agree with it, since it seems to me the "other mechanisms" are not actually separate from RM+NS, but examples of RM+NS at work. As far as I can tell, the other systems at work in evolution--- genetic recombination, sexual selection, punctuated equilibrium--- are all emergent mechanisms, side effects of RM+NS which are built entirely on top of RM+NS.

— Coin
OK, Coin, I'll try to clarify what I meant. To my mind, the term "mutation" refers to an unpredictable chemical change of DNA. This may or may not occur during DNA replication, but it requires the intervention of no special enzymes (other than the normal DNA replication machinery) and occurs through simple mechanisms. Thus, examples would include a base substitution mutation (in which one base changes for another); a deletion or insertion (where one base is simply missed out or where a surplus base is added in to the sequence); or a gene duplication (wherein two copies of a gene are incorporated end-to-end in the new DNA). Note that a base substitution will have little or no impact on the resulting protein, whereas insertions or deletions may cause "frame shifts". If a frame shift occurs, the protein encoded by the gene may undergo a radical change in primary structure. There are other mechansims that give rise to genetic variation. One of these is recombination, in which, during cell division, as each pair of chromosomes lines up, the two chromosomes of a pair may swap stretches of DNA. These could include whole genes, in which case the daughter cell simply has a novel arrangement of alleles; however, it is possible that sections of corresponding genes may be swapped, which would potentially form a new allele for that gene. Recombination requires a set of proteins to control the process (although I could not go into more detail without a bit of research). Another mechanism that can give rise to new genetic variation is one for which I do not know the precise term, but it involves the insertion of another piece of DNA into a gene. This could occur during the migration of a retrotransposon, or when a virus incompletely inserts its genome into the cellular genome. This mechanism has the potential to severely disrupt the sequence of a gene; it is possible that this could give rise to an entirely novel gene sequence. This also requires the intervention of enzymes that cut and re-ligate the DNA at appropriate positions. So, I consider the latter two mechanisms to be sources of variation without being "mutations" as such. This is because one is an evolved mechanism of the organism itself, while the other is a consequence of infection of a cell by certain types of virus. Now, on to selection. Natural selection is a process entailing competition between individuals of a species, of which the end result is a survival advantage. Sexual selection is often treated distinctly from NS, because it can lead to the enlargement of features that represent a survival disadvantage. Examples would include the brightly-coloured plumage of some birds (which makes the bird easier for a predator to spot) or the antlers of deer (which costs the stag a great deal of energy each year). These features, however, confer a reproductive advantage by virtue of increasing that individual's chances to mate successfully. So, although I see that sexual selection can indeed come under the heading of natural selection, I often consider it to be something rather separate, because it leads to a reproductive advantage, not to a survival advantage. I do agree, however, that punctuated equilibrium as a mechanism emerges from variation + NS + an environment that is constant for much of the time, but punctuated by rapid changes.

The only exceptions (lateral gene transfer by viruses, perhaps), the things which are not fundamentally based on RM+NS, are minor effects generally negligible to the process of speciation.

Well, I think the significance of such events to speciation is very difficult to measure. They may well be minor mechanisms, but they may also have played significant roles in speciation events in the past.

For this reason (though I would disagree with any wording of this idea, such as that used by RealPC, that implies that the "theory of evolution" consists only of the study of these two things), I would absolutely agree with the idea that random mutation plus natural selection is sufficient to explain the complexity of life on earth. Would anyone disagree with this, and if so, why?

I think it all depends on how much detail you wish to get into. I consider mutation to be one of several sources of variation; it may or may not be the most important one. I think it often is, but will not in every case be the most important source of variation. Similarly, different selection pressures will be more or less important for different populations at different times. Distinguishing different mechanisms from one another enables (I think) a deeper understanding of the processes by which evolution occurs (and this time I mean it in the sense of "change over time").

Nigel D · 3 July 2007

It's all so funny really. It is refreshing to step back and see that we are all still such children, haggling over what something is or isn't. As a young child we picked up and tried to discern, with our limited database of knowledge, what objects were. Though we cannot recall the emotional feeling of 'awed wonder', we are delighted when we see it reflected on the face of our young.

— christorvik@yahoo.com
Interesting idea. Tell me, how is this analogy applicable to the debate at hand? It seems to me that the debate is over the validity of an evidence-based world view when compared with non-evidence-based world views.

But first let's set the stage here. First we have the EVOLUTIONISTS.

Ah, well, you're wrong there. There is no such thing as an evolutionist. Possibly you refer to people who accept the validity of evidence?

They say evolution is the only way to go because some viruses, bacteria etc. have been found to mutate into changing their number of chromosomes, i.e. become ANOTHER SPECIES entirely, by our chromosomal spe-cial definition.

No. Rational people say that MET explains the origin of species because that is where all the evidence leads. And there's a hell of a lot more evidence than you seem to suggest. Oh, and one small point: generally, all bacteria have only one chromosome. They do not mutate by changing chromosome number.

They say, if the viruses can mutate into another species, then so can everything.

No, they say "Here is a mechanism that may explain the mixture of diversity and similarity we observe in biology and in the fossil record. Let's test it. Oh, look, it makes predictions that can be verified. Is it the best explanation we have? Oh, yes, so it is."

Then there are the CREATIONISTS. They say NO EVOLUTION! Everything was created with the wonderous, miraculous powers of God. And they would as soon hang you as a heretic, than listen to you even consider suggesting that GOD is an ALIEN. Though the CREATIONISTS HAVE SOFTENED A BIT THESE LAST FEW YEARS, EITHER OF THE ABOVE TWO CAMPS SCOFF AT ANY THEORY THAT ENCOMPASSES BOTH IDEAS.

On the contrary, most scientists either believe in God or accept that a god is possible, but a philosophical rather than a testable hypothesis. Most creationists, on the other hand, feel sufficiently threatened by the idea that mankind does not inhabit some special position in the cosmos that they feel the need to deny common descent.

To me - it seems pretty clear.

Do tell!

Yes, viruses and bacteria can mutate, even to the point of the new generations being different species, by our cromosomal count standard. However, where is the proof that anything higher than a crustacean has done this?

Erm ... everywhere? And if bacteria can mutate, what's to stop all other life forms from mutating in the same way?

THE WAY I SEE IT, THERE IS A MORE ADVANCED PERSON(S) - OR ENTITY (IES).

On what evidence do you base this assumnption?

CALL HIM OR THEM "GOD", IF YOU LIKE. THEY HAVE LEARNED THE INS AND OUTS OF DNA COMPLETELY. THEY ARE COMPLETE MASTERS OF THE SUBJECT.

How do you know? What evidence is there to support this claim?

THEY CREATED US.

How do you know? What evidence is there to support this claim?

THE BUILDING BLOCKS THEY USED ARE THE SAME, AND SOME PARTS ARE SIMILAR

Why is it, then, that there are so many differences and similarities between all organisms? If the "parts" are similar, why are there so many differences between corresponding "parts" of different organisms? Why, then, do all land vertebrates have pentadactyl limbs, for example? Yet how is it that those limbs, for all their underlying similarity, show a vast range of diversity?

- HOWEVER NO "LINK" CAN BE FOUND BECAUSE THERE IS NONE.

What is the basis for this claim? Surely, if organisms appear to have related structures, the simplest explanation is that they are related. Occam's razor requires that, if we are to reject the simplest explanation, we must have a good reason to do so. Take haemoglobin as an example. Why is human haemoglobin more similar to chimpanzee haemoglobin than it is to cow haemoglobin or to dog haemoglobin? Why is it that we find molecular and developmental similarities in organisms that have anatomical similarities? And vice versa: why is it that organisms with different anatomy have different patterns of development and protein sequence? These questions are not even addressed by your assumption, yet they are very satisfactorily explained by MET.

SIMILARITIES CAN GIVE HOPE TO A "LINK', BUT WHO NEEDS A LINK?

Not so. Similarities require that we consider the possibility of a link. You are asking the question the wrong way round: it is the creationists who have a need for there not to be a link.

To clarify: WHEN YOU WERE A KID AND YOU PLAYED WITH YOU ERECTOR SET DID YOU CHANGE YOUR BUILDING JUST ONE PIECE BY ONE PIECE AT A TIME? MAYBE SOMETIMES YOU DID, BUT USUALLY YOU TORE IT DOWN AND CREATED ANOTHER ONE. SOME FACETS WERE THE SAME, BUT A 'MISSING LINK' WAS CERTAINLY NOT EVER TO BE FOUND IF SOMEONE WANTED TO RECREATE BOTH MODELS.

And this is relevant how?

AS WE GOT OLDER WE BECAME MORE COMPLEX IN OUR ERECTOR DESIGNS. SOME OF US LOST INTEREST. OTHERS WENT ON TO BECOME ARCHETECTS AND BECAME QUITE PROFICIENT AT CREATING IN THE 3RD DIMENSION AT THE FOURTH DIMENSION.

I have no idea what you're talking about now.

Perhaps DNA is 5th dimensional.

Based on what?

To me it's obvious that we did not entirely evolve from thunder and sunshine, like a computer cannot just 'come to be'.

Yeah? well, to me it's obvious you have no clue what you're talking about. Have you studied any biology at all? And a computer is not a valid analogy (the old "tornado in a junkyard" argument). Biological systems are made from components that can change. And they came to be as they are now incrementally, not in one fell swoop.

It takes an intelligent design somewhere along the line.

Come on, then. Back up your claim with some evidence. First: how would you distinguish design in nature from the mechanisms described by MET? Remember that, under Dembski's definition of design, NS is a design process. Second: where is the evidence to support your position?

A basic law of physics states that, "Any system without work gets more chaotic."

No, it doesn't. If you are referring to the second law of thermodynamics, it states that "the entropy of a closed system will increase over time". I've got some news for you: the Earth is an open system.

I suppose it would be possible to creat a simple organism that would grow into a mammal over generations - as long as it was encoded in the DNA to do that.

What? But if it has the DNA to be a mammal, why would it start out as something simpler? Do you actually have any idea how life on Earth actually works, or are you just visiting?

However, from the evidence of the dinasaurs, and what our "folklores" tell us, God created us "in his image",

What have dinosaurs to do with Genesis? And, if we were all created in "his image", why do we all look different from one another (except identical twins, whose resemblance is explained by genetics)?

knowing full well that we could happen upon this "tree of life" (The Human Genome Project - the "Human Tree of Life".)

That is utterly meaningless.

Our lore tells us that God did not want us to do this,

What lore? Seriously, read back what you wrote. It makes no sense unless I accept your starting assumption of special creation. An assumption for which you have supplied no evidence.

just as a parent doesn't want a child to do something that can harm him;

And how is this relevant when it comes to assessing the evidence and making logical deductions from that evidence?

and believe me, the potential for harm when speaking of genetic creation, is expontentially larger than we would first contemplate. (So far, we didn't forsee "chimera viruses" - opps!)

What if I choose not to believe you? You are making claims here for which there appears to be no basis in fact. Believe me, if you want to be taken seriously, you should (a) try to make some logical connections between your statements; and (b) support your claims with reference to actual evidence.

But God gave us Pokeymon to practice with, and tv came from somewhere, in part, to sedate our minds."

Go on, then. On what do you base this supposition? It seems to me that your mind is in need of no further sedation. Oh, and if I've never actually watched or played Pokemon, does that mean I get to practice with real life?

Nigel D · 3 July 2007

"random mutation plus natural selection is sufficient to explain the complexity of life on earth." Yes, exactly --- that is the current standard theory.

— realpc
Well, I still dispute that RM + NS are actually considered to be "it" in MET, but let's leave that for the time being...

And ID says it isn't sufficient. That is the essential debate.

Well, that's a tough one. ID is using the "liar, liar, pants on fire" argument. Seriously, you have about summed up the entirety of ID. All it says is that "RM + NS are not sufficient". Unfortunately, depending on how you consider the formulation of MET, it would appear that these mechanisms actually are sufficient to explain what we find. ID postulates no alternative to replace MET. ID is backed up by plenty of rhetoric, but not by any arguments that have any scientific relevance or merit. All of the arguments used by ID proponents have been refuted several times over (e.g. IC and CSI). This leaves us with no debate. MET explains how modern species have arisen from their precursor species. MET's mechanisms have been observed in the lab and in the field. MET explains how the modern diversity of life arose from primitive ancestors. It is supported by the fossil record. It is suported by DNA sequence data. It is supported by anatomical studies. It is supported by developmental biology. It is supported by data from biochemical pathways. MET makes predictions that allow for its falsification. For example, common descent predicts a nested hierarchy of related species. This is what we have found. If we did not find these nested hierarchies, this would indicate that MET had flaws. However, we do find these nested hierarchies. With each new fossil described, with each new extant species reported, the potential exists for MET to be challenged. However, to date all of the data support MET.

ben · 3 July 2007

ID says it isn't sufficient. That is the essential debate.
Can you think of any accepted theory, in any field, which is formulated strictly in terms of, "theory X is insufficient to explain the phenomenon, therefore explanation Y is confirmed?" Just one example. There's a reason you can't provide one. Your formulation isn't and cannot be a theory, on the mere basis of logical form. You guys can't seem to even frame your pet idea in the proper form for scientific consideration. I know the reason for that, and I'd hope you'd give it a little thought. Hint: If ID were true, the scientists would have beat you to it already--there's a reason real science is done mostly by scientists and very little by retired engineers, law students, non-practicing mathematicians, part-time property managers, or some guy living in his parents' basement in New Hampshire. The reason is that scientists know how to propose theories, test them, and they're willing to modify or reject their theories based on the results of testing. If you're not willing to propose a true theory and test it (because, I think, you can't stand the metaphysical implications of the potential results), you don't get to play. Call ID whatever you want, but it ain't science and won't be until you do a whole lot of work you're not willing to risk the outcomes of.

Glen Davidson · 3 July 2007

THE WAY I SEE IT, THERE IS A MORE ADVANCED PERSON(S) - OR ENTITY (IES). CALL HIM OR THEM "GOD", IF YOU LIKE. THEY HAVE LEARNED THE INS AND OUTS OF DNA COMPLETELY. THEY ARE COMPLETE MASTERS OF THE SUBJECT. THEY CREATED US. THE BUILDING BLOCKS THEY USED ARE THE SAME, AND SOME PARTS ARE SIMILAR - HOWEVER NO "LINK" CAN BE FOUND BECAUSE THERE IS NONE. SIMILARITIES CAN GIVE HOPE TO A "LINK', BUT WHO NEEDS A LINK? To clarify: WHEN YOU WERE A KID AND YOU PLAYED WITH YOU ERECTOR SET DID YOU CHANGE YOUR BUILDING JUST ONE PIECE BY ONE PIECE AT A TIME? MAYBE SOMETIMES YOU DID, BUT USUALLY YOU TORE IT DOWN AND CREATED ANOTHER ONE. SOME FACETS WERE THE SAME, BUT A 'MISSING LINK' WAS CERTAINLY NOT EVER TO BE FOUND IF SOMEONE WANTED TO RECREATE BOTH MODELS. AS WE GOT OLDER WE BECAME MORE COMPLEX IN OUR ERECTOR DESIGNS. SOME OF US LOST INTEREST. OTHERS WENT ON TO BECOME ARCHETECTS AND BECAME QUITE PROFICIENT AT CREATING IN THE 3RD DIMENSION AT THE FOURTH DIMENSION.

See, I thought everything you wrote was infantile garbage, until you started using caps. Then I was sure that you were a genius. Trouble was, then you reverted to normal writing, you know, like scientists and reasonable folk do, and then I knew once again that you hadn't been using caps because you're God or a genius or some such thing, as it appeared. I guess you really are an idiot. Damn, and you really had me going for a while there. Glen D http://geocities.com/interelectromagnetic

Science Avenger · 3 July 2007

Ben said: Can you think of any accepted theory, in any field, which is formulated strictly in terms of, "theory X is insufficient to explain the phenomenon, therefore explanation Y is confirmed?" Just one example.
Excellent point. Adding to that, has there ever been an accepted theory in any field that was categorically rejected as crapola by every related field? Revolutionaries would be expected to squabble with the reigning theory of the day, but other fields tend to be pretty silent on the matter. Did mathematicians, for example, pan Einstein?

Nigel D · 5 July 2007

Going back to original blog entry, I spotted this...

The Council of Europe may justly be renamed as "The European Council for the Advancement of Atheism."

— Dembski
Given that I'm pretty sure the Vatican has representation on this council (being, you know, a part of Europe), I think that means Dembski just called the Pope an atheist. Now, my theology is mostly second-hand so I may have this wrong, but I was under the impression that one of the main qualifications for being Pope was something to do with belief in God.

Flint · 5 July 2007

I was under the impression that one of the main qualifications for being Pope was something to do with belief in God.

This happens when words are too loosely defined. If we're willing to grant multiple gods, then the pope and Dembski believe in different gods. If there's only one, then Dembski believes in it, but the Pope only believes he believes in it. These distinctions can be subtle.

Henry J · 5 July 2007

Re "These distinctions can be subtle."

Oh, you mean there might be two separate Gods who were both the sole creator of the same universe, independently of each other? :D

Henry

Nigel D · 6 July 2007

This happens when words are too loosely defined. If we're willing to grant multiple gods, then the pope and Dembski believe in different gods. If there's only one, then Dembski believes in it, but the Pope only believes he believes in it. These distinctions can be subtle.

— Flint
Oh, I see. So the DI have their God - erm, I mean Designer whose identity we shall not specify - and Christians all over the rest of the world have theirs. Is it...?