Luskin and the ID movement on immunology: immune to evidence

Posted 19 September 2008 by

Over on the opposingviews.com website, Casey Luskin of the DI tries to rebut the Kitzmiller decision by re-fighting Behe's spectacular implosion on the issue of the evolution of the vertebrate immune system. To review, in his 1996 book Darwin's Black Box, Behe claimed that:
"As scientists we yearn to understand how this magnificent mechanism came to be, but the complexity of the system dooms all Darwinian explanations to frustruation." (Darwin's Black Box, p. 139) "We can look high or we can look low, in books or in journals, but the result is the same. The scientific literature has no answers to the question of the origin of the immune system." (Darwin's Black Box, p. 138)
As the debate over "irreducible complexity" developed in the next decade, the most detailed arguments would go basically like this:
ID: Gradual evolution by natural selection can't produce IC structures because any structure missing a part would be nonfunctional Evo: You are ignoring cooption of structures with different functions, which has a been a major feature of the evolutionary explanation of complex structures ever since the Origin of Species. ID: Cooption explanations are too improbable. Evo: Why? ID: Because we say so. Evo: But homology evidence shows that "IC systems" lacking parts can still have other functions, and therefore your claim that structures missing parts would be nonfunctional is wrong ID: OK well I don't have a comeback on that point, so instead I will claim that evolutionary cooption explanations aren't detailed & tested enough to satisfy me. Evo: Here's a bunch of detailed & tested research papers on the evolution of system X. ID: Not detailed enough. I need every single mutation & selection pressure before I admit that evolution produced this IC system rather than ID.
At this point the ID proponent has abandoned the original argument and therefore lost, even though he won't admit it. Knowing all of this before the Kitzmiller trial, we devised ways to bring this point to the attention of the judge. The most famous example was the fabled "immune system cross". A large amount of evidence was submitted that showed how the key feature of the vertebrate adaptive immune system, rearranging immune receptors (antibodies), evolved. The adaptive immune system produces diverse antibodies by recombination of different immunoglobin (Ig) domains. In Darwin's Black Box, Behe argued that the gradual evolution of this system was impossible because the three crucial parts (antibody genes, recombination signal sequences, and recombination-activating genes (RAGs)) could not provide minimal function unless they were all assembled at once:
"In the absense of the [RAG] machine, the parts never get cut out and joined. In the absense of the signals, it's like expecting a machine that's randomly cutting paper to make a paper doll. And, of course in the absence of the message for the antibody itself, the other components would be pointless." (Darwin's Black Box, p. 130).
The scientific literature on the origin of this system was well-known in the evolution/ID-creationism debate, primarily because various PT posters like Matt Inlay and Andrea Bottaro had been waving it in the faces of the ID guys for several years. The responses of Dembski ("ID is not a mechanistic theory, and it's not ID's task to match your pathetic level of detail in telling mechanistic stories") and Behe were pitiful, always involving retreating to an impossible, unscientific requirement for infinite evolutionary detail before evolution was accepted and ID rejected. So, in court in the Kitzmiller case, the obvious thing to do was take Behe through the above steps of the immune system argument, and when he reached the point of asserting there was not enough detail -- and confirming that he still believed his 1996 statements about how the literature had "no answers" on the evolution of the immune system -- a large body of literature on just this question was presented to Behe. Behe hemmed and hawed -- he couldn't just dismiss a pile of peer-reviewed research in top journals, but he also couldn't admit that it was good enough to answer his question because then his whole position was sunk. So he asserted that the literature was not detailed enough. Telling himself this tale may have helped Behe get to sleep that night, but to any objective observer this was a ludicrous and laughable response. If hundreds of pages of peer-reviewed research specifically on the origin and evolution of the vertebrate immune system, proposing, testing, and verifying a detailed model (called the transposon model) for its origin, was not enough for Behe, then clearly nothing could ever be enough and Behe was only maintaining his position by a stubborn refusal to seriously deal with the data (and he still has not dealt with the evolutionary immunology literature in any detail). Basically, Behe's verbal victory worked in his own head but was a spectacular defeat in the eyes of anyone with a vaguely rational view of what appropriate standards of evidence in science might be (that is: when you propose and test hypotheses you have good science, when you demand impossible levels of proof before accepting anything you are engaging in pseudoscience). When this was coupled to Behe's nonanswers to questions like "Well, Dr. Behe, where is the detailed, testable ID explanation for the origin of the immune system?" it was all over. The details are here. Well, this particular point, more than almost anything else except perhaps the discovery of the cdesign proponentsists, really really stung the ID guys. The fact that it made it into the Kitzmiller decision and numerous books, articles, and the Nova reenactment only made it worse. It is just too painful for them to contemplate it unemotionally and admit that they lost on a crucial scientific point, so occasionally ID advocates will pop up with pitiful responses that try to fix the damage. What follows is one that was really pitiful. Casey Luskin has developed a line of argument that he thinks is clever and serious, but is actually a product of the very same problem that afflicted Behe: a failure to engage seriously with the literature on evolutionary immunology and deal with the massively inconvenient facts. In the opposingviews.com essay, Casey Luskin writes (a fair bit down the page; the opposingviews format is pretty confusing so I reproduce the relevant bit here),
In another finding which was both wrong and irrelevant, Judge Jones ruled that "Dr. Miller presented peer-reviewed studies refuting Professor Behe's claim that the immune system was irreducibly complex."(24) Moreover, Judge Jones found that Behe's claims that the immune system was irreducibly complex were refuted by a large stack of papers dumped upon him during cross-examination: "[O]n cross-examination, Professor Behe was questioned concerning his 1996 claim that science would never find an evolutionary explanation for the immune system. He was presented with fifty-eight peerreviewed publications, nine books, and several immunology textbook chapters about the evolution of the immune system."(25) Yet Behe never claimed that no papers or books are "about the evolution of the immune system"--indeed in Darwin's Black Box, Behe wrote that "[t]here are other papers and books that discuss the evolution of the immune system."(26) On the contrary, Behe actually testified: "These articles are excellent articles I assume. However, they do not address the question that I am posing. So it's not that they aren't good enough. It's simply that they are addressed to a different subject."(27) Thus, what Behe actually requested was, "a step-by-step mutation by mutation analysis" of the evolution of the immune system, for Behe said he is "quite skeptical" that the papers in the literature dump "present detailed rigorous models for the evolution of the immune system by random mutation and natural selection."(28) Judge Jones misquoted Behe and twisted his views about the state of evolutionary literature on the origin of the immune system. One of the 58 articles dumped on Behe was an authoritative article published in Nature the year before the Kitzmiller trial which conceded that there were major questions about step-by-step accounts of the evolution of the adaptive immune system. In that recent and authoritative paper, Max Cooper, one of the fathers of immunology, wrote that the evolutionary origin of one of the most important components of the higher vertebrate "adaptive immune system," the immunoglobulin (IG) domain containing antibody, is currently "untraceable": "In contrast, the deployment of immunoglobulin domains as core components of jawed vertebrate recombinatorial lymphocyte receptors represents an intriguing although as yet untraceable evolutionary innovation, as immune recognition of pathogens and allografts by means of immunoglobulin superfamily members have been shown only in the jawed vertebrates."(29) IG domains perform a primary structural function in antibodies of the "adaptive immune system" used by all jawed vertebrates (such as sharks, reptiles, birds, and mammals). The paper discovered that the antibody-equivalent in the lamprey (a jawless vertebrate fish) is highly dissimilar, both in structure and how they are assembled. In fact, the lamprey uses a completely different type of protein domain for its antibody-equivalent structures. This paper therefore calls the origin of anitibodies that utilize IG domains presently "untraceable." Furthermore, when these authors say that the usage of IG domains is "untraceable," they are not asking the question "from what were these materials co-opted during evolution?" IG domains are found throughout biology from bacteria to humans and thus it is simple to imagine where higher vertebrates might have co-opted such domains. Rather, this paper is talking about the type of deeper question Behe raises: by what Darwinian pathway did IG domains evolve into the type of IG domain used by antibodies in the adaptive immune system of higher vertebrates? This paper had no answer to that question, yet Judge Jones claimed that Miller provided evidence demonstrating that "[b]etween 1996 and 2002, various studies confirmed each element of the evolutionary hypothesis explaining the origin of the immune system."(30) Did Judge Jones read these 58 papers plus books and other literature dumped during the trial to verify his claim? I highly doubt it. After all, Judge Jones' discussion on the immune system was copied nearly verbatim from an ACLU brief.(31) But a cursory look at one of those papers reveals that Judge Jones' finding was a bluff, and Behe's arguments were never refuted. In the end, most of Kenneth Miller's arguments about the evolution of the immune system were based upon observing mere sequence similarity or functional similarity between proteins used by our immune system and some found in lower organisms. In other words, some of the starting material might be crudely present elsewhere in biology, but Miller did not testify about any step-by-step Darwinian pathways as Behe requested, nor did Miller testify about the vast differences between our adaptive immune system and immune systems used by lower organisms like the Lamprey.(32) Behe was never refuted, and Judge Jones' strong findings based upon such hypothetical arguments demonstrate his uncritical acceptance of the plaintiffs' literature-dump bluffs. These episodes provide vivid illustrations why it is dangerous for courts to try to settle these scientific debates. Legal scholars agree with this basic point. [...] (24) Kitzmiller 400 F.Supp.2d at 741. (25) Id, at 741. (26) Michael J. Behe Darwin's Black Box, pg. 138. (27) Transcript of Testimony of Michael Behe 19 Kitzmiller, No. 4:04-CV-2688 (M.D. Pa., Oct. 19, 2005). (28) Id. at 19, 23 (29) Nature, Vol. 430: 174-180 (July 8, 2004) Z. Pancer, Z., C. T. Amemiya, G. R. A. Ehrhardt, J. Ceitlin, G. L. Gartland, M. D. Cooper, "Somatic diversification of variable lymphocyte receptors in the agnathan sea lamprey" (30) Kitzmiller 400 F.Supp.2d at 741. (31) A Comparison of Judge Jones' Opinion in Kitzmiller v. Dover... (32) Transcript of Testimony of Kenneth R. Miller "The significant similarity between the transib transpases and RAG core, the common structure of these transpases and others, as well as the similar size of these basically catalyzed by these enzymes directly support the 25-year-old hypothesis of a transposon related origin of the VDJ machinery." 30-31, Kitzmiller, No. 4:04-CV-2688 (M.D. Pa., Sept. 26, 2005).
A shorter version of this argument is provided in a law review article coauthored by Luskin (David K. DeWolf, John West, Casey Luskin. "Intelligent Design will Survive Kitzmiller v. Dover," 68 Montana Law Review 7 (Winter, 2007)):
Judge Jones ruled that a pile of fifty-eight papers dumped upon the witness stand during Behe's cross-examination refuted the claim that "science would never find an evolutionary explanation for the immune system." Kitzmiller v. Dover Area Sch. Dist, 400 F. Supp. 2d 707, 741 (M.D. Pa. 2005). Judge Jones provided no reference for that claim. Behe merely requested a reasonable standard of evolutionary proof of "detailed rigorous models for the evolution of the immune system by random mutation and natural selection." Transcr. of Procs. Afternoon Sess. at 23 (Oct. 19, 2005), Kitzmiller, 400 F. Supp. 2d 707. Did the fifty-eight papers meet that standard? One of the papers, an authoritative article recently published in Nature, reveals the answer is "no," as it clearly discussed the lack of step-by-step accounts of the evolution of key components of the immune system: "In contrast, the deployment of immunoglobulin domains as core components of jawed vertebrate recombinatorial lymphocyte receptors represents an intriguing although as yet untraceable evolutionary innovation, as immune recognition of pathogens and allografts by means of immunoglobulin superfamily members [IG domains] have been shown only in the jawed vertebrates." Z. Pancer et al., Somatic Diversification of Variable Lymphocyte Receptors in the Agnathan Sea Lamprey, 430 Nature 174, 179 (2004) (emphasis added). Immunoglobu lin (IG) domains are a common structure in proteins found throughout biology from bacteria to humans. Id. at 174. When the paper found that the evolution of IG domains is "untraceable," it was therefore not asking "from what might these structures have been borrowed during evolution?" It was asking the deeper question Behe raises: by what detailed, step-by-step pathway did IG domains come into their critical function in the adaptive immune system? Judge Jones said "each element of the evolutionary hypothesis explaining the origin of the immune system" had been "confirmed." Kitzmiller, 400 F. Supp. 2d at 741. Yet Pancer's recent, authoritative paper reveals that Judge Jones's finding merely recapitulated the plaintiffs' literature-dump bluff, and that Behe's actual arguments were never refuted. (pp. 36-37)
When this came out, I noted its sillyness in private, but no one ever got around to rebutting it in public, so apparently Luskin figured he'd made a good point and put even more weight on it in the opposingviews.com debate. (An aside: if you're not up on your evolutionary immunology, antibodies are basically Y-shaped receptors made up of a series of Ig-domains; different domains get switched around via V(D)J recombination to generate zillions of different antibodies that can bind almost any invader; the transposon hypothesis suggests that V(D)J recombining receptors evolved from non-recombining receptors by insertion of a transposon that would snip itself out, rejoining the receptor segments in different ways. Duplication & elaboration of this basic system produced the modern system. See the figures/discussion here and here) Luskin's argument doesn't make sense even if his facts were right Here's the short version of Luskin's argument: Luskin claims that Pancer et al. (2004) showed there was a big gap in the origin of the vertebrate immune system -- that is, where did an Ig domain involved in immune recognition come from? This question wasn't answered by 2005, claims Luskin, and therefore (this argument resembles the "Underpants Gnomes" business plan from South Park) Judge Jones was wrong to rule that "various studies confirmed each element of the evolutionary hypothesis explaining the origin of the immune system" and therefore "Behe's arguments were never refuted." Again, this sort of thing makes the ID proponent feel better and lets them sleep at night, but it's wrong on several levels as a scientific argument. 1. First of all, the "as yet untraceable" remark in Pancer et al. 2004 was just an aside from the main point of the paper, which was about how lampreys have their own adaptive immune system which is different from the adaptive immunity of jawed vertebrates. Evolution is used throughout the methods and analysis of the paper, so it is rather strange to attempt to use it as evidence against evolution. The paper did not do a thorough search for Luskin's "missing" Ig domain, it just mentioned as an aside that it had not been found yet. 2. Second, it is not clear exactly what Pancer et al. actually meant in their parenthetical remark. They cite Kaufman (2002), which reports on the discovery of V-type domains in Amphioxus, but notes various differences which indicate that that particular molecule was not a super-close relative of the non-rearranging ancestor of the V(D)J receptor. So a possible interpretation, the one which Luskin adopts, is that they are still searching for a close relative of a non-rearranging V-type receptor. But Pancer et al. might merely have been saying that they didn't detect VDJ recombination in lampreys, which is unsurprising because the system much have originated at some point, and the common view has always been that it originated after jawed vertebrates diverged from lampreys. The whole point of the transposon model is to explain how that system originated. 3. Third, even if it were true that the origin of an Ig domain with an immune function was (currently) untraceable, Luskin admits that Ig domains with other functions are well-known and widespread, so there is not really much of a "leap" left. There is no requirement in the scenario that the ancestor of the rearranging antibody had an immune function as opposed to some other binding function, although probably most immunologists thought that this was the most likely option, being a particularly gradual pathway. As previously mentioned, not just Ig domains, but specifically V-type domains were discovered in Amphioxus in 2002 (see: Kaufman, J. (2002). "The origins of the adaptive immune system: whatever next?" Nature Immunology 3(12): 1124-1125. This article was in the Kitzmiller immune system exhibit, so there is a summary in the Annotated Bibliography). 4. Fourth, even in 2005 it wasn't true to say that non-rearranging V-type Ig domains, with immune functions, in organisms diverging before jawed vertebrates, were unknown. PT poster Ian Musgrave comments:
Even by 2004 several Ig-like molecules had been identified in amphioxus and sea squirts that could play the role of the ancestor of Ig. In sea squirts there are Ig fold proteins (nectin and Junctional Adehesion Molecules) with an Ig fold and a Constant-Variable domain architecture just like the immunoglobulins. Also in amphioxus there is an Ig protein which is used in innate immunity (the Variable Domain Chitin Binding proteins) that was known in 2002 (in 2006 a protein that is a very similar to the TCR and is involved in innate immunity was found in the amphioxus, but here I'm dealing with 2004 knowledge).
The most one can say is that, in 2004, non-rearranging V-type Ig domains, with immune functions, had not yet been found specifically in lampreys. 5. Fifth, nothing about a missing Ig receptor impeaches any of the other evidence that was discovered in the literature and presented at trial. To wit: * the VVVVVVV DDDDDD JJJJJJ arrangements found in the genomes of bony fish and land vertebrates, and the VDJ VDJ VDJ VDJ VDJ VDJ VDJ VDJ arrangements found in sharks and relatives, indicated that the common ancestor was a much simpler VDJ arrangement that was elaborated by duplication. * the hypothesis that the recombination genes (RAG) were descended from a transposon was dramatically confirmed by the discovery of just such a transposon in the wild, a transposon which we had no reason to suspect existed, except for the transposon hypothesis for the origin of recombination. * numerous other discoveries mentioned here The transposon model for the origin of the vertebrate immune system was literally standard textbook material by 2005 and was strengthened even further by several discoveries in 2005. As with any complex historical process there will always be various gaps in our knowledge, but none of this weakens the major collection of positive scientific discoveries supporting the transposon model. All of the positive evidence is still there whether or not a particular gene has yet been discovered in a particular organism. Only ID proponents think that they can turn ignorance into scientific support for their position. 6. Sixth, in 2005 we didn't even have a genome sequence for lampreys and other relevant early-diverging organisms. Claiming that a missing homology is a problem is particularly dumb if the relevant sequencing hasn't even been accomplished yet. It gets worse for ID So Luskin's argument is excruciatingly bad even if he had his facts right. But as it turns out, he didn't have his facts right. As Luskin noted, Pancer et al. (2004) said, in an article coauthored by "Max Cooper, one of the fathers of immunology", that:
"immune recognition of pathogens and allografts by means of immunoglobulin superfamily members have been shown only in the jawed vertebrates"
Luskin and other ID proponents seem to think that such ignorance, once admitted in science, is permanent and irrevocable, and is forever a stain on an evolutionary model for a particular system. Unfortunately for them, though, science doesn't stay still. Have a look at this paper:
Cannon, J. P., Haire, R. N., Pancer, Z., Mueller, M. G., Skapura, D., Cooper, M. D. and Litman, G. W. (2005). "Variable Domains and a VpreB-like molecule are present in a jawless vertebrate." Immunogenetics 56(12): 924-929. (PubMed | DOI | Journal | Google Scholar)
Yes, those coauthors include the very same Pancer who was the lead author on Luskin's favorite paper, as well as "Max Cooper, one of the fathers of immunology." And what do they say?
Abstract Immunoglobulins (Igs) and T cell antigen receptors (TCRs) that undergo somatic diversification have not been identified in the two extant orders of jawless vertebrates, which occupy essential positions in terms of understanding the evolution of the emergence of adaptive immunity. Using a single motif-dependent PCR-based approach coupled with a vector that allows selection of cDNAs encoding secretion signal sequences, four different genes encoding Ig V-type domains were identified in the sea lamprey (Petromyzon marinus).
Whoops. It appears that once someone had a good hard look for V-domains in agnathans, they found them. Who would have thunk it? In the conclusion, the paper also notes:
The recent description of a non-rearranging single copy gene sequence in lamprey that can be modeled to a TCR V suggests that other molecules that are related to the combinatorial antigen binding receptors may exist in jawless vertebrates (Pancer et al. 2004b).
What's that? A homolog to another V-domain was discovered in 2004 as well? The referenced paper is:
Pancer Z, Mayer WE, Klein J, Cooper MD (2004b) Prototypic T cell receptor and CD4-like coreceptor are expressed by lymphocytes in the agnathan sea lamprey. Proc Natl Acad Sci USA 101:13273-13278
Hey look, our buddies Pancer and "Max Cooper, one of the fathers of immunology" again! And what do they say in this 2004 paper? If "prototypic T cell receptor" wasn't clear enough for you, here's the abstract:
All jawed vertebrates have highly diverse lymphocyte receptors, which allow discrimination between self and nonself antigens as well as the recognition of potential pathogens. Key elements of the anticipatory recombinatorial immune system in jawed vertebrates are the TCR, Ig, and MHC genes, but their ancestral genes have not been found in more basal vertebrates. In this study, we extended our analysis of the transcriptome of lymphocyte-like cells in the lamprey to identify the TCR-like and CD4-like genes. The structural features of these genes and their preferential expression in lymphocytes make them attractive candidates for ancestral TCR and CD4 genes. The TCR-like gene contains both V (variable) and J (joining) sequences in its first exon and exists as a single-copy gene that is invariant. Thus, the TCR-like gene cannot account for the receptor diversity that is required for the immune responses reported for lamprey, but it could have been easily modified to serve as an evolutionary precursor of modern TCR and Ig genes.
So basically, the authors answered Luskin's question in an article published in the research literature in the very same year as the paper which Luskin has been citing at opposingviews.com, in a comprehensive pro-ID law review article, and probably elsewhere. But, how could poor Casey Luskin have known about this discovery? I mean, after all, he is not "one of the fathers of immunology," is he? (say, I wonder what a father of immunology would say about Behe's argument?) Well, as it happens, Cannon et al. 2005 is sitting right there in the friggin list of articles given to Behe! Pancer et al. 2004b is not (an oversight on the part of the Kitzmiller plaintiffs' team -- we beg forgiveness: there is so much evolutionary immunology literature, it was hard to get even a decent sample of it together!), but it was cited by Cannon et al. (2005). Conclusion Earth to Luskin and ID guys: you screwed up. Your very best (and basically only) scientific counterargument to Behe's immune system debacle fell apart as soon as someone took a mildly close look at the situation. You relied on scientific ignorance to maintain some smidgen of credibility for the ID movement's rejection of massive positive evidence for evolution, and, predictably, you got burned. Again. Good job. (Even worse, we had to catch the mistake for you, proving (again) that within the entire ID community there is no one with the knowledge/gumption/scientific spirit to read just a few measly articles on evolutionary immunology to double-check a key Luskin assertion.) Credits Thanks to Ian Musgrave, Andrea Bottaro, and the PT crew for helpful comments.

2696 Comments

gabriel · 19 September 2008

Behe / Luskin = seriously pwned. nice work.

one small quibble: you make it sound like V(D)J recombination swaps entire Ig domains around to create antibody diversity. V, D and J segments are subdomains of the variable Ig domains found at the antibody tips.

Vince · 19 September 2008

Luskin's scientific understanding and knowledge of the literature is even worse than implied - particularly if one considers the literature on invertebrates:

Si-Ming Zhang, Coen M. Adema, Thomas B. Kepler, Eric S. Loker (2004).
Diversification of Ig Superfamily Genes in an Invertebrate. Science 305(5681):251-254.

Bryan · 19 September 2008

Thank you for a wonderful article. Several years ago I had the opportunity to give two lectures in an evolutionary biology course on the evolution of the immune system. One lecture on the evolution of the innate immune system, the second on the adaptive.

It amazes me that creationists can say "it can't have evolved" with a straight face - looking across the animal phyla there is a clear, and obvious progression from simple "barrier" immunity, to simple macrophage-like cells, to a diversified "granulocyte" immune system, to the vertebrate system with its diversified adaptive and innate immune systems.

If anything, the immune system is a prime example of how evolution can produce an irreversibly complex system.

Which I guess is why Behe et al. are asking for every mutation along the road; that's about all the ground they got left.

Draconiz · 19 September 2008

Frat job on the article Nick, thank you

Vince · 19 September 2008

jobby said: looking across the animal phyla there is a clear, and obvious progression ... well sure there is a progression. but was in caused by NS?
Jobby: Feel free to offer evidence in support of a different testable hypothesis to explain this "progression". Remember: "God-did-it' is no different than "My little Blue Devil living in my back pocket did it" - neither of these are capable of being refuted so neither will suffice in the world of science.

Paul Burnett · 19 September 2008

jobby said: looking across the animal phyla there is a clear, and obvious progression ... well sure there is a progression. but was in caused by NS?
Propose an alternate hypothesis - test it - publish your results - see what happens. In the meantime, in spite of your fondest hopes, your question provides no evidence (much less proof) for creationism.

Stanton · 19 September 2008

Paul Burnett said:
bobby/goff/jacob/balanced/hamstrungjobby said: looking across the animal phyla there is a clear, and obvious progression ... well sure there is a progression. but was in caused by NS?
Propose an alternate hypothesis - test it - publish your results - see what happens. In the meantime, in spite of your fondest hopes, your question provides no evidence (much less proof) for creationism.
In earlier responses, jobby/bobby/jacob/balanced/hamstrung claimed to be a supporter of Intelligent Design, not Creationism. Either way, he has never bothered to show any evidence for anything, otherwise.

rpsms · 19 September 2008

Isn't this the point in the trial where he was forced to admit he never actually read any of the literature presented to him but that he didn't have to because the papers didn't refute his arguments?

Shirley Knott · 19 September 2008

But "jobby" honey,
NO ONE is answering "Darwin did it".
No one but your strawman, that is.

Do try to keep up.

no hugs for thugs,
Shirley Knott

iml8 · 19 September 2008

In reference to the mindset of Mr. Luskin, Ms. O'Leary, and
their kindred ...

When reading the work of an evo scientist who rabidly hates
Darwin-bashers and blasts them at length, even if the
all the venting is edited out, usually there's plenty of
interesting substance left. Donald Prothero's recent
book EVOLUTION was an excellent example: "Good book,
professor, but you might have cut back on the tirades
somewhat."

If you take the work of the O'Luskins of the world, if
you edited out the complaints and denunciations,
there would be nothing left. I've always seen their
most blatant weakness as their complete lack of
curiosity about how things work -- how anything works,
not just evo science, how a battery works, how concrete
is made, whatever.

All people who honestly like the sciences are intensely
curious. If you consider the works of Dawkins (his
science writings at least), you see a person of intense
and perceptive curiosity, who loves to figure out how
things work. Yes, he does vent and editorialize, but
mostly as asides and footnotes, and even he has admitted
he needs to tone that stuff down at least a bit.

Point this out to the O'Luskins and the only result is
a blank stare. It is beyond their comprehension.

White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

John Kwok · 19 September 2008

Dear jobby: You can't be serious in making this rather inane remark:
jobby said: ... I am not a supporter ID nor Creationism nor Darwinism. I am a supporter of the scientific method however and do not feel that faith systems should be taught as science.
If you are really a "supporter of the scientific method", then you'd recognize that evolutionary theory relies upon the scientific method in making testable hypotheses - including predictions - regarding the evolution of the immune system in invertebrates and vertebrates. Indeed, inspite of its numerous flaws, contemporary evolutionary theory does a decent job in explaining the history and current structure of Planet Earth's biodiversity. Neither Behe nor Dembski have offered any evidence period in explaining how and why Intelligent Design creationism could provide a viable scientific alternative to evolution in explaining both the history and current structure of our planet's biodiversity. Meanwhile I trust you'll continue enjoying your membership in the Dishonesty Institute's IDiot Borg Collective. Live Long and Prosper (as a DI IDiot Borg drone), John Kwok

snex · 19 September 2008

one has to wonder why, if these counter arguments are so powerful, they weren't brought up in court when they would have mattered the most. i guess next time luskin should do the lawyering himself.

Science Avenger · 19 September 2008

jobby said: ... well sure there is a progression. but was in caused by NS?
Until an alternative is established to exist and given the same falsifiable testing the mechanisms of modern evolutionary have gone through, they are the best candidates. Your argument is akin to wondering if the cat drank the milk when I come home to a locked house, an empty bowl that was full when I left, and a happy cat. It's the only solution available at the moment, so that's the working theory until we get a better one. One your insinuation that MET can't be falsified is yet another ignorant lie. BTW, wasn't this useless waste of DNA supposedly permanently banned, again?

Wheels · 19 September 2008

snex said: one has to wonder why, if these counter arguments are so powerful, they weren't brought up in court when they would have mattered the most. i guess next time luskin should do the lawyering himself.
They basically were brought up, because Behe said he hadn't read all those articles but was sure they didn't matter: they didn't give a complete and monstrously detailed picture of every single mutation that allowed it to happen. Same thing, really. It's funny how these arguments seem to be completely backwards from Dembski's original proposal, where you eliminate (whatever) and then arrive at the Design conclusion. It looks to me like they're sticking Design way out in front and then demanding that (whatever) measure up to that (in their minds) first.

Paul Burnett · 19 September 2008

Stanton said: In earlier responses, jobby/ bobby/ jacob/ balanced/ hamstrung claimed to be a supporter of Intelligent Design, not Creationism.
Contrary to Dishonesty Institute official protestations, there is no difference:
Judge John Jones said: We have concluded that intelligent design is not science, and moreover that intelligent design cannot uncouple itself from its creationist, and thus religious, antecedents. - Harrisburg, PA, December 20, 2005.
Stanton continued: Either way, he has never bothered to show any evidence for anything, otherwise.
...thus proving he/she/it is a cdesign proponentsist.

snex · 19 September 2008

Wheels said: They basically were brought up, because Behe said he hadn't read all those articles but was sure they didn't matter: they didn't give a complete and monstrously detailed picture of every single mutation that allowed it to happen. Same thing, really.
im no lawyer, but i think i watch enough law & order to know that this is absolute incompetence on the defense's part. they should have known that these papers existed and either forced behe to read and critique them in detail, or not call him as an expert witness at all.

william e emba · 19 September 2008

Do not feed the trolls. Panda versus Jobby

fnxtr · 19 September 2008

One last poke at the twit-of-many-names before it's erased: I thought it had finally admitted when cornered on a previous blog that it was a Von Danikenite. Or was that one of the other little annoyances that show up around here occasionally. It's so hard to tell the idiots apart.

mark · 19 September 2008

So, does all that Katzenjammer from the Discomfited Institute mean that they are again looking for a school district to mandate teaching of Intelligent Design Creationism as if it were science? Or will the search be left to the Sword and Shield for People of Faith again?

eric · 19 September 2008

jobby said: OK what would we see if NS is not the mechanism that causes complex organisms to come from simpler ones
We would presumably see the "real" mechanism at work. But you don't ever describe that mechanism. Until you do, we'll keep doing research on natural selection. After all, we can't very well do research on an idea that you refuse to share, can we?

Draconiz · 19 September 2008

jobby said: OK what would we see if NS is not the mechanism that causes complex organisms to come from simpler ones
jobby, bobby, hamstrung, balanced is that you, Mr. sock puppet? Finding a transitional fossil that doesn't fit with it ecological niche? Say, instead of finding the Tiktaalik we find a rabbit instead?

Kevin B · 19 September 2008

A thought.

If MET really isn't falsifiable, is Prof Behe wasting his time?

Science Avenger · 19 September 2008

jobby said: making predictions and see those observations is easy. its predicting what would be seen if the theory is not true that is difficult
There's your nomination for bass-ackward statement of the month. nd he wonders why we say he doesn't have the slightest understanding of science.

pough · 19 September 2008

Luskin and other ID proponents seem to think that such ignorance, once admitted in science, is permanent and irrevocable, and is forever a stain on an evolutionary model for a particular system.
Thank you for this sentence. It is - to me - one of best descriptions of a defining characteristic of creationists.

Paul Burnett · 19 September 2008

pough said:
Luskin and other ID proponents seem to think that such ignorance, once admitted in science, is permanent and irrevocable, and is forever a stain on an evolutionary model for a particular system.
Thank you for this sentence. It is - to me - one of best descriptions of a defining characteristic of creationists.
That's because in the cdesign proponentsist universe, once theological truth is revealed, it is permanent and irrevocable. They have no concept of the scientific model of continuous improvement, and simply cannot wrap their minds around it. They go with what they know.

Nick (Matzke) · 19 September 2008

one small quibble: you make it sound like V(D)J recombination swaps entire Ig domains around to create antibody diversity. V, D and J segments are subdomains of the variable Ig domains found at the antibody tips.
Good point, I didn't make that clear. A good diagram is here: http://www.pnas.org/content/102/1/169/F1.large.jpg

Nick (Matzke) · 19 September 2008

I meant to say, also here:
http://www.talkdesign.org/faqs/evimmune/ei_figure005.jpg

Stanton · 19 September 2008

I almost forgot:

In A Living Bay: The Underwater World of Monterey Bay by Lovell and Libby Langstroth, it's discussed that echinoderms, or at least starfish, have their own immune system which, at least in the case of predatory starfish, enable them to digest otherwise toxic sea anemones by neutralizing the preys' venom, in that a starfish that ate strawberry anemones for the very first time took about 72 hours to a week to digest them, versus a starfish that ate strawberry anemones on a regular basis, which ate and digested the little buggers within a few hours.

But I digress: what I'm driving at is that

1) Perhaps one of the original functions of the immune system of the ancestor of echinoderms and chordates was to aid in digestion, or to neutralize potentially toxic proteins that were ingested,

and

2) Does anyone know what starfish immunoglobins look like?

Henry J · 19 September 2008

To disprove NS, just find cases in which the varieties that produce more offspring don't increase their numbers faster than the other varieties.

Alternately, find another mechanism that might produce new interacting structures in organisms, but that does so in a way that can be distinguished from natural selection (and that might have happened prior to human genetic engineering), and that can be used to explain the existing data just as well as the current theory.

Henry

Science Avenger · 20 September 2008

Or more generally, find cases where all genetic variations in a population produce the same average number of fertile adult offspring.

This is one of those rare cases where ID idiocy can produce an interesting thought experiment which, once understood, would greatly enhance the understanding of evolutionary theory for someone new to the topic.

Vince · 20 September 2008

Stanton said: Does anyone know what starfish immunoglobins look like?
My specialty is molluscan immunology, but to my knowledge echinoderms, like all invert's, do not have antibody-like immunoglobins (although other members of the immunoglobin family of molecules are present). In short, invert's in general do not have antibodies and lack the adaptive immune response present in vert's. Hope this helps. Vince

Vince · 20 September 2008

Vince said:
jobby said: looking across the animal phyla there is a clear, and obvious progression ... well sure there is a progression. but was in caused by NS?
Jobby: Feel free to offer evidence in support of a different testable hypothesis to explain this "progression". Remember: "God-did-it' is no different than "My little Blue Devil living in my back pocket did it" - neither of these are capable of being refuted so neither will suffice in the world of science.
jobby said:
Vince said:
jobby said: looking across the animal phyla there is a clear, and obvious progression ... well sure there is a progression. but was in caused by NS?
Jobby: Feel free to offer evidence in support of a different testable hypothesis to explain this "progression". Remember: "God-did-it' is no different than "My little Blue Devil living in my back pocket did it" - neither of these are capable of being refuted so neither will suffice in the world of science.
And you should feel free to offer evidence in support of a your hypothesis to explain this "progression". Remember: "Darwin-did-it' is no different than "My little Blue Devil living in my back pocket did it" - neither of these are capable of being refuted so neither will suffice in the world of science.
Nice third grade response Jobby! Nevertheless, I'll take the bait and oblige your request. Testable Hypothesis: Giving antibiotics will result in selection for specific resistance in bacteria. Prediction: advent of the use of a new antibiotic will result in the spread of a new variant with resistance to the antibiotic. Test: Well, we can do two types of test here - historical (review the literature on antibiotic resistance and tabulate the occurrence of resistance) or set up current monitoring of resistance either in the lab or in the field. Results: Read the literature Bobby (Hint: start with the history of penicillin and the advent of resistance within a few years of widespread use following WWII and continue through the data on MRSA and Extreme MRSA). Alternatively, you can actually set up your own experiment and monitor the use of some of the newer antibiotics, but I'm pretty sure you won't bother (Hint, that's OK, its already being done). Conclusion: New variations arise and are selected for as the result of the use of Antibiotics. Next, we'll ask ourselves a question based upon our conclusions: Is the knowledge gained from this test useful and important? Answer: Yes - based upon an understanding of selection for resistance we can (1. Work to ID the specific variants and modes of resistance so that we can develop new treatments (already being done); (2. We can train Health Professionals to curb the overuse of antibiotics to reduce selective pressure for the evolution of resistance; & (3. We can use our knowledge to look at other effects of selection on the evolution of antibiotic and drug resistance in other systems (think "effects of sub-therapeutic doses of antibiotics or coccidiostats in animal feed and their effects"). Now, please address my original request. To help you I'll outline the process (just fill in the Blanks - you can use extra space, it's OK). Jobby's Testable Hypothesis on ID: ______________________________________. Jobby's prediction: __________________________________________. Jobby's Results: _____________________________________________. Jobby's Conclusions: _________________________________________. Extension and usefulness of Jobby's findings to the real world ______________. I await your response (no dithering allowed). Yours, Vince

Stanton · 20 September 2008

Vince said:
Stanton said: Does anyone know what starfish immunoglobins look like?
My specialty is molluscan immunology, but to my knowledge echinoderms, like all invert's, do not have antibody-like immunoglobins (although other members of the immunoglobin family of molecules are present). In short, invert's in general do not have antibodies and lack the adaptive immune response present in vert's. Hope this helps. Vince
After retrieving my copy of the book from the hinterlands inside my closet, the page they had on the leather star, Dermasterias imbricata, says that echinoderms have an immune system comparable/analogous to those of vertebrates: In one experiment, the scientists grafted tissue from one individual star into another star, which was eventually rejected in about 200 days. Apparently, the tissue was infiltrated and attacked by "defensive cells," leading to the graft dying and being rejected. Grafting more tissue from the same donor into the same recipient lead to an accelerated rejection response, which was about 8 days by the third grafting attempt. (Karp and Hildemann. 1976. Specific allograft reactivity in the seastar Dermasterias imbritica. Transplantation. (Baltimore) 22 (5): 434-439) To clarify about the Corynactis versus Leather star experiment, the experiment documented that the venom of Corynactis induces paralysis in leather stars, which which feed on small, aggregating anemones such as Corynactis. In the laboratory, a leather star feeding on Corynactis for the first time took about 46 hours to eat a polyp. Later that week, the same star took only 90 minutes to eat another Corynactis polyp presented to it. It was surmised that starfish do have immune systems, but, apparently, are also prone to immunological amnesia, as, when the same star was fed its next Corynactis polyp one month later, it, again, took about 46 hours to eat it. I guess I was reading too into the page in assuming that echinoderms have immunoglobins, but they do apparently have an immune system. (Willard. 1981. The role of adaptive immunity in the predatory behavior of Dermasterias imbritica. M.S. thesis, California State University, Hayward.)

Dave Lovell · 20 September 2008

jobby said: Jobby’s Testable Hypothesis on ID: ... it is likely that if aliens introduced changes into the DNA they would have left a signature. experiment: search DNA for signature just as we search space for signals from aliens
When searching space we can look for patterns of signals that can not be explained by our current scientific understanding of the universe. What objective criteria would you use to distinguish between between a DNA "signature" and a random DNA sequence?

David Stanton · 20 September 2008

Guys, with all due respect, you are just wasting your time with this troll. It has demonstrated repeatedly that it is absolutely immune to any evidence of any kind and completely lacks the reasoning skills to follow even the most rudimentary argument.

Notice how this troll has already hijacked this thread away from the real topic, the evolution of the immune system, and now has everyone discussing macroevolution and selection instead. Ask yourself, why did it do this? Now ask yourself. why should I play along? This twit is never going to answer your questions. This is the reason it has been banned. Just ignore it and it will go away.

Now if hand jobby can demonstrate that it has read the paper on the evolution of the immune system and cares to have a real discussion on the topic of this thread, I'm sure that it can be obliged. Until then, another flush cycle is in order.

David Stanton · 20 September 2008

Hate to say I told you so, but here we go again. Troll tactic 21 - try to get you to answer your own question for it.

Science Avenger · 20 September 2008

jobby said: To disprove NS, just find cases in which the varieties that produce more offspring don’t increase their numbers faster than the other varieties. ... you missed the point: of course evolution and NS happen. But does NS cause complex structures to evolve from simpler ones. show me the test
No, he nailed the point, but you are too ignorant to understand it, and of course played the troll game of moving the goalposts (from asking for a test to disprove NS to asking for a test that demonstrates NS produces more complexity). You are a pathetic liar handjobby, and you do nothing but demonstrate over and over again the intellectual dishonesty of Intelligent Design. Your mental masterbation is deadly dull. And I'll say again: the mechanisms of MET are all we've got. To reject them as the causes of everything we see in the evolutionary bush you must get off your ignorant lazy ass and demonstrate the existence, and necessity, of some other mechanism. Saying "I don't see how MET can account for that, therefore Goddidit" is exactly the same sort of argument as "I don't see how the Egyptians could have built the pyramids, therefore aliens did it". FIRST you must demonstrate the existence of aliens/god, THEN you must demonstrate in a testable way that they were involved in the process in question.

Scott · 20 September 2008

jobby said: To disprove NS, just find cases in which the varieties that produce more offspring don’t increase their numbers faster than the other varieties. ... you missed the point: of course evolution and NS happen. But does NS cause complex structures to evolve from simpler ones. show me the test
I'm no expert, but I can follow a train of logic. Let me try this one. First, no jobby, you missed the point of your own post. You claimed that there was no way to refute NS, therefore (you claimed) NS was no better than "Darwin-did-it". A means to refute NS was offered. Rather than address the proposed refutation, you moved the goal posts: "No, I really meant somethine else." By your failure to address the question, we must conclude that you admit that NS can be refuted as demonstrated, and that NS is therefore probably better than "Darwin-did-it". Second, "God-did-it", "Darwin-did-it", "The-little-blue-demon-in-my-back-pocket-did-it", "Aliens-did-it", are all the same thing. Just saying who did it is not sufficient. For the explanation to be useful, you have to say how and when. "Aliens-did-it" might work to explain a single observed example of transition that we (incorrectly?) attribute to NS. But if "Aliens-did-it" is your only answer, then "Aliens-did-it" must work for all instances where we attribute NS. Remember, a new scientific explanation must explain all of the evidence better than the existing explanation. "Aliens-did-it" doesn't do that. Did aliens come down, undetected, and through an unknown means indistinguishable from NS introduce nylon eating bacteria? (BTW, maybe we should start calling it the "Explanation of Evolution", rather than the "Theory of Evolution". That would avoid the canard, "It's only a theory".) Third, yes we can detect the signature of "designers" in the DNA that they produce. Scientists have already done that. Google "Craig Venter". Fourth, (to answer your new question) NS (by itself) does not cause complex structures to evolve from simpler ones. Mutations cause biological structures to change. Sometimes complex structures change into simpler ones. (BTW, that's even more desirable, as it is more efficient.) Sometimes simple structures change into other simple structures. The changes are not directed or guided (even by NS) from simple to complex. Typically, complex structures can do more things, and so are more likely to be able to do something different, something more useful that NS can act upon. (Remember that NS acts on function, or effect. It's mutation that acts on DNA.) Therefore, most of the time NS does lead to an increase in complex structures, simply because complex structures are more selectable, more evolvable than simpler ones. Capish? For everyone else, I agree feeding the trolls is not good, but (as someone else pointed out), sometimes a troll comes up with a good question that highlights a point where an honest learner can be diverted. And (if you'll permit) it allows a lurker to exercise ones debating skills, even if it's restating the obvious. Thanks for your patience.

stevaroni · 20 September 2008

Actually, there are some circumstances where you can see the results of "un"natural selection, notably in those animal and plant species that are the end result of selective breeding programs.

In these cases, humans have overridden the normal "survival of the fittest" criterion to artificially guarantee survival and breeding opportunities for "intelligently designed" traits.

Sadly, these traits are almost universally optimized for the benefit of the selector, not the animals. Examples abound of laboratory mice so ill-suited for the life outside that they die when the door is left open and turkeys with breasts so enlarged that they can no longer balance well enough to mate (oddly, this doesn't seem to be much a problem in the human species, just look at Pamela Anderson).

Speaking of blond celebrities who make sex tapes, (nice segue, huh?) I couldn't help but note in yesterdays news that Paris Hilton was inconsolable over the demise of two of her chihuahuas (an intelligently designed species), lost when coyotes (a natural selected species) got into her backyard and ate them. Natural selection back at work again in the Hollywood hills.

Stanton · 20 September 2008

Well, you have to realize that the chihuahua was originally bred by Mexican Indians, including the Aztecs, to be eaten, and that women celebrities often face selection and pressure against being intelligent.

stevaroni · 20 September 2008

Well, you have to realize that the chihuahua was originally bred by Mexican Indians, including the Aztecs, to be eaten

Makes for funny looking buns, though.

Stanton · 20 September 2008

stevaroni said:

Well, you have to realize that the chihuahua was originally bred by Mexican Indians, including the Aztecs, to be eaten

Makes for funny looking buns, though.
Depending on the occasion, they used either very large tortillas, or very large taco shells, actually.

stevaroni · 20 September 2008

Well, you have to realize that the chihuahua was originally bred by Mexican Indians, including the Aztecs, to be eaten

That makes for an interesting question, though. Just when did dogs make it to the new world? Is the chihuahua a descendant of dogs the Spaniards brought in the 1600's or did its ancestors come over the land bridge way before that and get independently domesticated? The later seems improbable, but the image of packs of ancestral chihuahuas stalking bison on the plains is wonderfully amusing.

D. P. Robin · 20 September 2008

stevaroni said:

Well, you have to realize that the chihuahua was originally bred by Mexican Indians, including the Aztecs, to be eaten

That makes for an interesting question, though. Just when did dogs make it to the new world? Is the chihuahua a descendant of dogs the Spaniards brought in the 1600's or did its ancestors come over the land bridge way before that and get independently domesticated? The later seems improbable, but the image of packs of ancestral chihuahuas stalking bison on the plains is wonderfully amusing.
Evidence suggests that dogs were first domesticated in East Asia, possibly China,[15] and some of the peoples who entered North America took dogs with them from Asia.[15]
http://en.wikipedia.org/wiki/Dog#Origins

Science Avenger · 20 September 2008

Repeating a point-missing idiocy doesn't make it any more intelligent than it was the first time. Try again.

Science Avenger · 20 September 2008

jobby said: ... I capish that is the theory. now show me how that has been tested.
It's like having a conversation with a guy sitting in an airport, refusing to look out the window, and insisting that heavier-than-air flight hasn't been demonstrated.

Steve · 20 September 2008

jobby said: I am simply asking for the test that shows that complex structures evolved from simple ones by means of NS.
Well, from a physical model like this, from very simple rules, a "complex structure" can arise - look at the sand in an hour glass form a perfect cone - clearly more complex than the grains of sand randomly raining down on it, but formed purely BY the grains of sand, and some physics. The sand has no knowledge of the shape it will form, but that cone will still exist. Steve

stevaroni · 20 September 2008

jobby said: I am simply asking for the test that shows that complex structures evolved from simple ones by means of NS.

Actually, we thrashed this out thoroughly in August (back when you were still Bobby) on this thread http://pandasthumb.org/archives/2008/08/the-evolution-o-7.html#comments. Around pages 14-16 we spent several dozens of comments talking about evolutionary algorithms and "Dawkins Weasel Generators", programs that allow us to investigate a slow-moving process like natural selection quickly and with some ability to control the myriad of environmental variables in even the simplest ecosystems. We also pointed out that these are not theoretical constructs, evolutionary algorithms are at work every day solving fiendishly complex problems that defy standard analytical methods. Gee, I'm surprised you don't remember that, you took part enthusiastically. Of course, it's not nearly so easy to play the martyr once you admit that all your questions were patiently explained the first time you asked them.

Eric · 20 September 2008

jobby said: I am simply asking for the test that shows that complex structures evolved from simple ones by means of NS. I am waiting.
A few threads ago you claimed to have read the abstract of a Wong and Mi article cited by PvM and found it unconvincing. You lied. You also showed by your lie that you have no intention of reading any article we give you. Heck, you don't even bother to look up the reference to see if its real. And you also showed that you have a predetermined opinion that you have no intention of changing. So I'm not going to waste my time giving you citations that you will lie about reading. But I would like to thank you for your comedy value. I lauged my butt off at how you embarassed yourself the last time. And I plan on bringing up the Wong and Mi article in every PT thread where you show yourself.

Paul Burnett · 20 September 2008

jobby said: look at the sand in an hour glass form a perfect cone ... the hour glass was designed.
Forget the hourglass. Dribble a stream of sand from any small orifice onto an infinitely large flat plane perpendicular to the flow stream - it will form a cone. No hourglass necessary.

Paul Burnett · 20 September 2008

jobby said:
A few threads ago you claimed to have read the abstract of a Wong and Mi article cited by PvM and found it unconvincing. You lied. You also showed by your lie that you have no intention of reading any article we give you. ... And I plan on bringing up the Wong and Mi article in every PT thread where you show yourself.
Please paraphrase the parts of the article that validate your point.
Read this very carefully: There is no article. Therefore it is not possible to paraphrase parts of it. But you said you read it. You lied. That is the fact that Eric and I and others will remember and "paraphrase" back to you: You lied.

David Stanton · 20 September 2008

Booby the Goof Poe (aka hand jobby),

There are links to two papers about the evolution of the immune system above. Why don't you read these papers and tell us in your own words about their implications for ID? That is the topic of this thread you know.

And don't forget, no one is going to take your word that you have read the papers this time, we will require, what was that word again, oh yea, evidence.

In the meantime, I suggest that Nick follow the example set by PvM and initiate another flush cycle for the troll of many names.

stevaroni · 20 September 2008

Foul! I call goalpoast move! (actually, he's trying to hide the entire field, but that's not a recognized foul). Why - I'm shocked! Shocked! and I say that with all the Claude Rains sincerity I can possibly muster. Let's review the ref's call, shall we?

at 7:45 AM, jobby wants to know... (natural selection) is useful. but it does not prove that complex structures can evolve from simpler ones thru NS.

Scott answers him.

at 4:08 PM, jobby moves the goalpost to... what I am asking is for you to show me the test that validates that NS causes complex structures to come from simpler ones.

Jobby apparently figures out that this point has already been addressed, so...

at 4:14 PM the goalpost inches out to... what I am asking is for you to show me the test that validates that NS causes complex structures to come from simpler ones.

I give him some real-world examples. Places where NS is not just observed but actually applied.

at 7:25PM … a computer model is not a valid test of a theory, sorry.

and finally

at 7:27PM (an experiment using sand in an hour glass demonstrates nothing because…) … the hour glass was designed.

We've gone from * "give me an explanation" - Oops we did that. So the demand rolled to... * "I meant give me an example" - Did that, so we moseyed over to... * "I meant give me an answer for all cases" - To.. * "give me an example except that I don't arbitrarily reject for no good reason" - To ... * "I can reject any answer ever observed because experiments are by definition designed" So jobby, while I'm usually fairly tolerant of trolls, if only for the sake of the lurkers, I think I've demonstrated enough patience that I can now defend myself from the "Mommy! He won't answer me!" martyr stance you try to develop after you're shot down about half a dozen times. So I'm not going to address you any more until you answer a simple question. You seem to have some inexplicable stance that evolution happens but natural selection is not a driving cause. If not, just what do you propose is moving the machine forward, and just where the hell do I look? You give me a test to support your supposition. To paraphrase the words of a certain troll

I am simply asking for the test that shows that complex structures didn't evolve from simple ones by means of NS. I am waiting.

stevaroni · 20 September 2008

Paul tries to reason with jobby Forget the hourglass. Dribble a stream of sand from any small orifice onto an infinitely large flat plane perpendicular to the flow stream - it will form a cone.

Unless the surface or the sand is infinitely slippery. Since intelligence is required to select experimental items that do not have zero coefficient of friction, and therefore violate no physical laws, the experiment is invalid. Also the experiment must be observed in order to yield any data. Without observation, we don't actually know what happened and it's just Schrodinger's sandbox. Observation requires intelligence. Q.E.D.

Science Avenger · 20 September 2008

jobby said: ... a computer model is not a valid test of a theory, sorry.
Why not? Don't dare answer "because the computer is intelligently designed", that would expose you as an ignoramus.

Eric · 21 September 2008

All experiments are simulations. They hold some variables constant that aren't constant in nature, introduce some variable that doesn't occur (or rarely occurs) in nature, or they eliminate some factors which would normally be important.

Computer simulations are no different. The only difference between a computer simulation and a real life experiment is that in a computer simulation:
(i) you can do things much faster (good)
(ii) you can study things very difficult/expensive to do in RL (good)
(iii) you have to worry about your code correctly representing the parts of reality its standing in for (bad).

But the short answer is yes, in some cases a computer simulation can prove a hypothesis. For instance, here's a classic: computer simulations have proven that the flocking of birds and the schooling of fish requires no complex genetics or design, just a simple instinct to stay close to the animals on the other side.

Wolfhound · 21 September 2008

Um...we are still tolerating the previously banned, lying, uneducable, sockpuppet troll WHY?

rossum · 21 September 2008

jobby said: You really do not understand science if you believe a simulation is a scientific test. Ask your comrades here it they feel a simulation of a concept is a scientific validation.
You had better inform Professor Behe then. You have read Behe and Snoke (2004) haven't you. It uses the results from a computer simulation to make its point. rossum

Frank J · 21 September 2008

Note to lurkers:

Please don't give up on PT just because they can't or won't ban the troll.

Just ask yourself what jobby's alternate "theory" might be, and how he would test it. Ask yourself whether it might be the same as Behe's, which happens to be the only one that I'm aware of that has been endorsed (however tepidly) by any DI person. That would be that a cell was designed - and constructed - ~4 billion years ago containing all the "information" necessary for its descendants, including us and the tree outside. A pseudogene for the VDJ system in that tree's cells might be compelling evidence for that alternate "theory," and bad news for "Darwinism" - even Darwinian evolution.

If a real creationist shows up - note how they almost never do when a troll takes over - you might want to ask them whether they agree with Behe, and if not what they propose instead, and why they don't challenge Behe with the same passion that they challenge "Darwinism". But I wouldn't waste your time "feeding" jobby.

Science Avenger · 21 September 2008

jobby said: You really do not understand science if you believe a simulation is a scientific test. Ask your comrades here it they feel a simulation of a concept is a scientific validation.
You sound like Sarah Palin, pretending you know the answer to question and hoping no one notices that nowhere in your prattle does one appear. Try again phony, explain why a computer simulation cannot be a scientific test. Since you have put yourself up as an authority on what constitutes science, it should be a piece of cake. Or you could be a coward again and refuse to answer because I accurately identified you as a phony. You've already displayed your ignoramus credentials with your "the hour glass was designed" quip. You really don't understand how stupid that makes you look, do you?

Science Avenger · 21 September 2008

jobby said: Are you posters seriously telling me that the Dawkins Weasal program proves Darwinism?
No one here ever claimed that, which means you re either lying again (shocker), or you're just an idiot. All the original Dawkins weasel program demonstrated was the power of cumulative selection versus a random match. That's all it was ever presented as doing, but creationists lied about it (again, shocker), and then ignoramuses like yourself parroted their lies. It seems to be a novel concept to you that we don't have to prove everything at once. We prove A, you scream "where's the proof for B?" We prove B, you bellow "But that doesn't prove A!" It would be amusing if we were 12 like you.

Science Avenger · 21 September 2008

jobby said: there have been a plethora of computer models for stock trading. no one knows if they really work until you actually make trades.
You idiot, just because there are bad computer models doesn't mean there aren't good computer models! You are falling below even your low standards!

Science Avenger · 21 September 2008

jobby said: there have been a plethora of computer models for stock trading. no one knows if they really work until you actually make trades. you really do not think the Weasel program proves Darwinism??
This is actually a double dose of idiocy, since stock models are not the same kind of computer models as those that simulate evolutionary processes. I'll add computer simulations as yet another thing you don't know shit about.

Science Avenger · 21 September 2008

Moron, you couldn't teach a 3rd grade class. Fact is computer simulations are common tools in science, in a wide variety of fields, which you'd know if you knew, well, anything.

Science Avenger · 21 September 2008

jobby said: You are looking like a complete idiot to the observers here.
Funny how the only observers who actually post think you are the idiot, and for good reason, as you demonstrate the ignorance required for ID support in spades. And yes, btw, your arguments DO amount to saying Goddidit, regardless of how much you lie and say otherwise. Go work for McLiars campaign, you'll fit right in.

Science Avenger · 21 September 2008

jobby said: just because there are bad computer models doesn’t mean there aren’t good computer models! ... absolutely!
But you just argued that computer models couldn't be scientific because there were bad computer modals. You're masterbating in public again. Your mother would not approve. And btw idiot, I'm one of the people here who actually uses computer models in his work, so what you so blithely theoretically dismiss is refuted, as usual, by the facts of the real world. Now go get a new magazine, yours is no doubt sticky by now.

Science Avenger · 21 September 2008

jobby said: simulations are common tools in science, ... did i ever say there were not? Can you read? they are tools to develop the hypotheses which are then tested in the real world. please read some of the literature on this.
No moron, they are tools which TEST hypotheses in a simulated environment, just like lab experiments do, as has already been explained to your lying ass. Literature? You mean the stuff you got caught red handed lying about reading?

Science Avenger · 21 September 2008

For any lurkers who may not have experience with computer simulations, here is a simple example.

Let's say someone proposed the hypothesis that, in a roll of two standard, fair, six-sided dice, the likelihood of getting a roll of 12 was equal to the likelihod of getting a 7. We could test this hypothesis scientifically by setting up a simulation which chooses two values at random between 1 and 6, adds them together to form a roll value, and repeating this process a few hundred thousand times, recording the results, and applying the appropriate statistical tests. In doing so, we could scientifically demonstrate, within a certain statistically confidence, that the hypothesis is false.

Handjobby would have you believe these results are not scientific because we didn't take the time to roll physical dice. But this argument is nonsense. To discredit a computer simulation, one would need to show that the parameters are not correct. Otherwise, it is just as valid as the physical version, as Behe and Snoke, and the rest of the scientific world, would attest.

Stanton · 21 September 2008

jobby said: Now go get a new magazine, yours is no doubt sticky by now. ... your mind truly is in the gutter. I am glad I reported this as a porn site to some nanny programs.
Then why do you keep coming here if you feel that this is a porn site?

Science Avenger · 21 September 2008

jobby said: ... your mind truly is in the gutter. I am glad I reported this as a porn site to some nanny programs.
You really think that matters, don't you? Since it would take anyone two seconds to see that this isn't a porn site, that would only increase the population of people who think you are an idiot.

Science Avenger · 21 September 2008

jobby said: ... Sorry that is not what the peer reviewed articles in scientific periodicals ( the literature) say.
Really? Site a few, and quote a brief relevant section from them. Or are you going to dodge and weave and lie about not wanting to teach people (a great laffer) to hide the fact that you are barking out of your bunghole.

Stanton · 21 September 2008

jobby said:
Stanton said:
jobby said: Now go get a new magazine, yours is no doubt sticky by now. ... your mind truly is in the gutter. I am glad I reported this as a porn site to some nanny programs.
Then why do you keep coming here if you feel that this is a porn site?
I reported it as a porn site so children will not see your vulgar remarks.
If you actually ever bothered to read any of the responses to you, I'm not the one making vulgar remarks, Troll, it's Science Avenger. Furthermore, if you think that everyone is vulgar, why do you insist on demanding answers that you never bother to look at? Did you ever stop to think that Science Avenger would be far less hostile to you if you tried to engage people here in intelligent conversation instead of dismissing all of the answers and responses that you demanded, or repeating the same stupid questions that you keep asking? If you think that the Theory of Evolution is so faulty, then how come you have never bothered to submit a superior alternative explanation?

Science Avenger · 21 September 2008

jobby said: n a roll of two standard, fair, six-sided dice, ... big assumption: the dice are fair. circular logic:
Nothing circular about it, since the fairness of the dice is not in question. The question is the proportion of 7's to 12's given two fair dice.
you are saying that we can predict what pair of fair dice will do. well of course we can.
No, I'm saying we can simulate what a pair of dice will do with a computer program, which is exactly what you've been claiming we can't do. We don't have to predict anything, just input the parameters and let 'er rip. No actual rolling of dice necessary.
by definition if the dice do not do what the program predicts the dice are not fair.
Non sequitor. The prediction, in this case, was that the number of 12's and 7's would be equal. The program makes no predictions, and in fact will not do what the theory predicts, since 7's are far more likely than 12's.
give me that ole time ‘circular logic’
Contrary to common usage in creationist circles, "circular logic' does not mean 'any assumption with which I disagree'. It means that the point to be proved in one's argument is one of the presumptions of the argument. That is not the case here. I'll be sure to add "circular logic" to the evergrowing list of terms you don't understand.

Science Avenger · 21 September 2008

jobby said:
Science Avenger said:
jobby said: ... Sorry that is not what the peer reviewed articles in scientific periodicals ( the literature) say.
Really? Site a few, and quote a brief relevant section from them. Or are you going to dodge and weave and lie about not wanting to teach people (a great laffer) to hide the fact that you are barking out of your bunghole.
no you have to gopher it yourself. not here to do your work for you. if there are lurkers they can research this themselves.
Yep, just as I suspected, lying again. Get therapy Handjobby.

stevaroni · 21 September 2008

Taking up SA's aside to any lurkers out there...

Don't forget, Computer simulations don't exist in a vacuum, we live in a world where we can and regularly do verify that computer simulations are accurate.

Once upon a time, mathematical models were abstract things. People designed boat sails by trial and error, not with calculus, and even if Newton got his sums wrong,the planets were going to ignore him and keep spinning.

But today engineers deal with entire design fields where their work is waaay too complicated to attack without good models and simulations. Examples include new aircraft, like the 7E7, a machine whose aerodynamics are so subtle that Boeing proudly brags that it was designed and tweaked for years in a computer before it ever saw the inside of a wind tunnel.

Or take my field, digital logic design.

I type this on a processor chip that has maybe 40 million gates. The only way to manage this kind of design is synthetically. no matter how good the engineer, managing all those signals and logic states running around a chip, moving charge with them and interacting with all the other signals, is simply an insurmountable task without the help of gate-level simulations which methodically track all those signals and their interactions.

Without a good, accurate, quantum model of semiconductors, processors like the one you're using now are not merely difficult to build, they are actually so difficult, they simply wouldn't exist.

Without good, accurate, aerodynamic models, the new Boeing wouldn't ever get off the ground.

Without good, accurate, models of celestial mechanics, space probes would never get to their targets. How could they? Navigating a probe to a landing on a comet requires accounting for every significant source of gravity in the solar system (all of which are moving - and interacting with each other - all the time) to a level of accuracy somewhere in the parts-per-trillions.

The fact is, computer simulations simply do work, and we know they work because in many walks of life we use them to find the answers first, then we go out and verify it.

Science Avenger · 21 September 2008

jobby said: The program makes no predictions, and in fact will not do what the theory predicts, since 7’s are far more likely than 12’s. ... only if the dice are fair and how can we determine that the dice are fair and not weighted?
And you have the audacity to accuse others of having reading difficulties? Let me spell it out nice and clear so that even you can't miss it: THE FAIRNESS OF THE DICE IS NOT AT ISSUE The issue is, GIVEN a pair of fair dice, do 12 and 7 appear with equal frequency? They do not, and we can SCIENTIFICALLY demonstrate this with a computer simulation of many rolls of 2 simulated dice. We don't (as your position mandates) have to roll real, physical dice to determine this. If you can't follow this very simply example, it's clear you can't come close to understanding any of the actual simulations used.

Science Avenger · 21 September 2008

jobby said: Yep, just as I suspected, lying again. Get therapy Handjobby. ... well i just read the article here is the authors last name in code (simple substituion i didnt want to make it too hard for you): uwoogtu now you can search for the article and look up the last name and decode what i put here. (if you have the ability). then you can see that i did indeed read the article and it does say that computer simulation cannot replace actual real life experimentation do some homework for once and not be lazy
OK, now I'm convinced, he's one of us fucking with us. No one could be that obvious and that stupid.

Sylvilagus · 21 September 2008

Science Avenger said:
jobby said: The program makes no predictions, and in fact will not do what the theory predicts, since 7’s are far more likely than 12’s. ... only if the dice are fair and how can we determine that the dice are fair and not weighted?
And you have the audacity to accuse others of having reading difficulties? Let me spell it out nice and clear so that even you can't miss it: THE FAIRNESS OF THE DICE IS NOT AT ISSUE The issue is, GIVEN a pair of fair dice, do 12 and 7 appear with equal frequency?
The problem is that jobby either does not read at a high school level or does not understand the meaning of "given" as used in logical arguments, or both.

Sylvilagus · 21 September 2008

Science Avenger said:
jobby said: Yep, just as I suspected, lying again. Get therapy Handjobby. ... well i just read the article here is the authors last name in code (simple substituion i didnt want to make it too hard for you): uwoogtu now you can search for the article and look up the last name and decode what i put here. (if you have the ability). then you can see that i did indeed read the article and it does say that computer simulation cannot replace actual real life experimentation do some homework for once and not be lazy
OK, now I'm convinced, he's one of us fucking with us. No one could be that obvious and that stupid.
Two other options: jobby is a junior high student and/or jobby has a personality disorder... "you do it! No YOU do it... ad nauseum." I suspect the latter though of course he will predictably deny it.

Dale Husband · 21 September 2008

jobby said:

If you think that the Theory of Evolution is so faulty, then how come you have never bothered to submit a superior alternative explanation?

... If had the grant money I might be able to. But I do know that NS has never been experimental proven to be able to evolve complex structures. I think some honesty is needed here. Show me the study.
We already know that nothing presented to explain how evolution could have generated complex structures over millions of years could satisfy you, so why bother? However, I will offer this essay:

http://circleh.wordpress.com/2007/09/16/the-possible-role-of-nondisjunction-in-evolution/ A common objection to natural selection as the mechanism for evolution is that while it may act as an editor, it cannot be an author. That is, it may change genetic information through mutation, but it cannot cause genetic information to increase. And they are right, but genetic information can still increase across the generations of organisms through a process called nondisjunction. This occurs when an unequal amount of genetic material is passed on to two daughter cells after the process of a cell dividing. One cell will have slightly less genetic material, and the other will have slightly more. The most famous example of nondisjunction is the kind that causes Down’s Syndrome, when a human embryo receives three 21st chromosomes from its parents rather than the normal number of two. But nondisjunction can occur regarding any chromosome in any organism and may not even involve chromosomes at all, such as in the case of bacteria. Let us imagine that three billion years ago, a bacterial cell was dividing, but because of a chemical malfunction, slightly less genetic material ended up in one daughter cell, and slightly more in the other. The cell with less material will probably end up smaller, while the cell with more material may end up larger, because a greater amount of genetic material can produce a greater amount of proteins, the molecules that provide the structural basis for all organisms. Larger cells (assuming the reproductive potential of the different cells was the same) would have an advantage over smaller cells in the race to gain food, thus natural selection would favor larger cells. If this process was repeated many times, then it is possible that over a billion years a bacterial cell would have emerged that had hundreds of times more genetic material than the first primitive organisms that arose on Earth about four billion years ago. And that would have enabled the evolution of more complex organisms than bacteria…including us!

The only honest question you should ask is, "Does this explanation violate any known laws of chemistry or physics?" If not, then you have no legitimate objection to it, scientifically speaking. The alternative claim, that a Designer from out of nowhere made all organisms in more or less their current form, does violate known laws of chemistry and physics.

Sylvilagus · 21 September 2008

Frank J said: Note to lurkers: Please don't give up on PT just because they can't or won't ban the troll. Just ask yourself what jobby's alternate "theory" might be, and how he would test it. Ask yourself whether it might be the same as Behe's, which happens to be the only one that I'm aware of that has been endorsed (however tepidly) by any DI person. That would be that a cell was designed - and constructed - ~4 billion years ago containing all the "information" necessary for its descendants, including us and the tree outside. A pseudogene for the VDJ system in that tree's cells might be compelling evidence for that alternate "theory," and bad news for "Darwinism" - even Darwinian evolution. If a real creationist shows up - note how they almost never do when a troll takes over - you might want to ask them whether they agree with Behe, and if not what they propose instead, and why they don't challenge Behe with the same passion that they challenge "Darwinism". But I wouldn't waste your time "feeding" jobby.
Don't worry. I'm a lurker and all jobby does is make intelligent design and creationism look very stupid to me. I find it laughable that he thinks he can lecture the various professional scientists here on what is and is not scientific when he is so obviously operating at a sub par level intellectually.

Stanton · 21 September 2008

jobby said: If you think that the Theory of Evolution is so faulty, then how come you have never bothered to submit a superior alternative explanation? ... If had the grant money I might be able to.
Did it ever occur to you that you need a proposal before an institution will deign to give you grant money?
But I do know that NS has never been experimental proven to be able to evolve complex structures.
The only way you've attempted to prove this is by ignoring what we've said and ignoring that experiments have been done. If you really want us to take you seriously, propose your alternative explanation for the formation of complex biological structures.
I think some honesty is needed here.
Says the guy who's a sock-puppeteer troll
Show me the study.
Why should we? We've consistently shown you examples that you have demanded, and you have consistently ignored all of them.

Stanton · 21 September 2008

jobby/jacob/balanced/hamstrung/balanced is a perfect example of what happens when a person immunizes him or herself to evidence and logic.

Science Avenger · 21 September 2008

jobby said: SCIENTIFICALLY demonstrate this with a computer simulation of many rolls of 2 simulated dice. ... and how is that programmed? by using the previously calculated math formula. you really dont need a program to do that and a program would never be used in that instance. you are really, really talking out of your ass
Jesus, talk about talking out of your ass, you (or rather, this dement character you are playing) display your ignorance more and more with every post. Now you are just making shit up. The programming of the computer is not at issue, any old functioning computer will do. The only math formulas involved are the one that adds the two random simulated dice values, and the one that adds up how many simulated rolls fit the test criteria. It sounds like you are doing the reflexive creationist denial of claiming the answer was frontloaded. Sorry, won't work, clearly not the case here. Whether you need a computer to do this is irrelevant. As to whether a computer would ever be used in this manner, you are again completely ignorant, since I use something very similar in my insurance work (just substitute insurance claim values for the dice values). Making shit up isn't going to work when the people you are talking to actually do what you can only hypothesize about.

David Stanton · 21 September 2008

Over 120 posts and not one word about the immune system or the articles that were cited above. Way to go hand jobby. You have once again proven that you are emotionally exhausted and morally backrupt.

Nick, you should really flush all of this off-topic nonsense. PvM doesn't let this troll derail his threads anymore, why should you? I really don't see why anyone responds to this adolescent twit, but if you just have to, at least try to keep the bastard on topic.

Stanton · 21 September 2008

David Stanton said: Over 120 posts and not one word about the immune system or the articles that were cited above. Way to go hand jobby. You have once again proven that you are emotionally exhausted and morally backrupt. Nick, you should really flush all of this off-topic nonsense. PvM doesn't let this troll derail his threads anymore, why should you? I really don't see why anyone responds to this adolescent twit, but if you just have to, at least try to keep the bastard on topic.
Well, I did try to steer the conversation towards echinoderm immune systems and comparisons with vertebrate/chordate immune systems, but, everyone but Vince ignored that in favor of pointing out jobby/bobby/jacob/hamstrung/balanced's bullshit.

Rolf · 21 September 2008

I am simply asking for the test that shows that complex structures evolved from simple ones by means of NS. I am waiting.

I am waiting for proof that it is gravity that keeps me from falling off into space. I won't be satisfied with "What keeps you from falling off into space is gravity."

Science Avenger · 21 September 2008

Hey, I got to talk about my simulator, that made it all worth it.

Science Avenger · 21 September 2008

jobby said: ... you forgot the forumala that actually produces virtual random events. is it seeded or a true random. might make a difference.
I didn't forget anything, because it doesn't matter. One could do the simulation without the random generator simply by having the computer run through every dice combination. Does the phrase "grasping at straws" mean anything to you?

stevaroni · 21 September 2008

Two other options: jobby is a junior high student and/or jobby has a personality disorder…

Personally, I suspect that he's a grad student working on a thesis paper about how long people will stay engaged, trying to set the record straight in the face of an obvious lie, even when he lie is blatant, the argument so insipid it's hardly worth answering and they know that the moment they give up and go back to their lives, the liar will publicly declare victory anyway no matter how patiently they've labored. Such research could be invaluable to politicians in an election year, and I suspect that he's selling information to all the major political parties.

David Stanton · 21 September 2008

Booby the Goof Poe (aka hand jobby),

Are you emoitionally incapable of telling the turth about anything? Just look at my comment of 9/20/08 at 9:09 PM. I begged you to comment on the papers about the immune system and somehow you managed to trash up the thread with nonsense about just about everything but the immune system.

I'll make you a deal fool. I will am willing to state that there is no paper published anywhere that will saatisfy you about the role of natural selection in evolution if you promise to go away and never come back (including any alias you might try to use).

Science Avenger · 21 September 2008

jobby said: ... DUH!!! its completely frontloaded!
Oh yeah? Show me the frontloading: T = 0. S = 0 Add random integer 1-6 to random integer 1-6 If total is 12, then T = T + 1 If total is 7, the S = S + 1 repeat 100,000 times Is S/T outside the 95% conf. int. for S = T? Go ahead. Show me the frontloading of the answer that S is greater than T. Your a liar, because it clearly isn't there.
jobby said: ... where do you get for instance the probability that a man who is 60 will live till 65? from a simulation?? hahahah!
Yes ignoramus, you could if you had a mortality distribution. Just keep digging that hole.

Dale Husband · 21 September 2008

Note that jobby didn't see fit to comment on my essay that I posted earlier. Maybe he didn't understand it.

SWT · 21 September 2008

jobby said: The only math formulas involved are the one that adds the two random simulated dice values, and the one that adds up how many simulated rolls fit the test criteria. ... you forgot the forumala that actually produces virtual random events. is it seeded or a true random. might make a difference.
If one is truly concerned about the distribution of the simulated rolls, it is easy enough to tally sufficient information to establish the distribution of the simulated rolls, test for possible time correlations of the simulated rolls, and check for correlation between the simulated rolls of the two simulated dice.

SWT · 21 September 2008

jobby said: If you think that the Theory of Evolution is so faulty, then how come you have never bothered to submit a superior alternative explanation? ... If had the grant money I might be able to. But I do know that NS has never been experimental proven to be able to evolve complex structures. I think some honesty is needed here. Show me the study.
Indeed, some honesty is needed here. "jobby" is actually not representing the ID position accurately. These discussions tend to focus of ID-ers insisting of "proof" that evolution occurred in the manner described by MET. However, one of the core assumptions of ID is not that the evolution does not occur as described by MET, but rather that evolution cannot occur as described by MET. This stronger assertion is necessary, since there's an enourmous amount of objective evidence supporting MET. Here's the thing: If the latter assertion -- that evolution cannot occur as described by MET -- can be demonstrated to be false in any instantiation of an evolutionary process, a core assumption of ID is overturned and the remainder of the design argument falls apart. Results obtained using Tierra and Avida are sufficient to demonstrate that "complex" systems can evolve from simpler systems; I suggest that these results explain ID-ers resistance to accepting simulation results.

Henry J · 21 September 2008

These discussions tend to focus of ID-ers insisting of “proof” that evolution occurred in the manner described by MET.

Not to mention their frequent insistence on proof that a particular lineage was caused by variation + selection. There isn't such proof for individual cases; what supports the theory is that the overall pattern matches what would be expected from those processes over time.

Nick, you should really flush all of this off-topic nonsense.

But part of the thread title says "immune to evidence", so couldn't a thorough demonstration of that condition be considered to be at least somewhat on topic? :p Henry

David Stanton · 21 September 2008

Good point Henry. I guess someone who refuses to read the relevant papers is indeed a very good example of someone who is immune to evidence. As I have noted before, this is exactly the same behavior that got Behe and Luskin in trouble in the first place.

There is no evidence whatsoever that this jerk has ever read a single scientific publication or even watched an educational video, even when links have been provided. There is even less evidence that it has ever understood any reasonable argument. It has been repeatedly demonstrated to be absolutely wrong and has never admitted it. It has repeatedly been caught in lies and has never admitted that either.

Of course that will only be obvious if we all try to keep the troll on topic and avoid letting it derail the thread, even when it tires the juvenile "I know you are but what am I" argument.

Stanton · 21 September 2008

So now can we finally get back to talking about immune memory and amnesia in starfish?

stevaroni · 21 September 2008

Science Avenger says... Oh yeah? Show me the frontloading:

You know, Avenger, I don't know whether you planned it this way, but you've given jobby an opportunity to demonstrate his rare form of genius for picking exactly the wrong argument, by allowing him to rail against one of the rare computer models that actually can be mathematically verified. Since dice have 6 possible values, there are exactly 36 possible outcomes. The solution space for any given roll is exactly one of 12 possible values. Given fair dice, we can unambiguously calculate the odds of the probability of any of the 12 possible outcomes. For instance, the solution space has 6 possible outcomes yielding the number 7. The odds of rolling a 7 with fair dice are exactly 6/36 or 0.1666666666.... The system is completely determinate. Assuming your number generator is truly random (and there are known ways of ensuring that) your program can easily be verified to match reality. All we have to do is run large numbers of iterations and compare your results to the known probabilities. Your program will either work, or not, and we will know unambiguously. Jobby has managed to pick out one of the rare examples in this field that actually are readily testable, and rail against it all afternoon, displaying what can only be described as his personal style of brilliance. But regardless, this does bring up an interesting point. Like most computer models, the model you're proposing isn't useful because it allows us to roll a pair of dice. We can do that just fine without a computer. Your model is useful because it allows you to roll a pair of dice a billion times in one afternoon. That's the real magic of computer models. Most of them don't allow us to do anything we couldn't do by other means, they allows us to do things much, much faster by sifting a myriad of possibilities, bringing impossible tasks down to a reasonable timeline. It's not that they're off doing our thinking for us, it's that we use them to think a lot faster. That why they're so useful to studies of natural selection, they do time-lapse; they allow you to speed up the process so you can actually see it.

Science Avenger · 21 September 2008

stevaroni said: That's the real magic of computer models. Most of them don't allow us to do anything we couldn't do by other means, they allows us to do things much, much faster by sifting a myriad of possibilities, bringing impossible tasks down to a reasonable timeline. It's not that they're off doing our thinking for us, it's that we use them to think a lot faster. That why they're so useful to studies of natural selection, they do time-lapse; they allow you to speed up the process so you can actually see it.
Yes, I think that is part of Handjobby's problem. He seems to think computer simulations are big complicated things, instead of very simple things repeated a massive number of times. I must say I found it highly amusing to be challenged to prove as possible something that I do routinely at work. I suppose next he'll declare all hammers useless as tools of carpentry, and claim there is a pro-hammer bias among professional carpenters.

Science Avenger · 21 September 2008

stevaroni said: You know, Avenger, I don't know whether you planned it this way, but you've given jobby an opportunity to demonstrate his rare form of genius for picking exactly the wrong argument, by allowing him to rail against one of the rare computer models that actually can be mathematically verified.
I won't claim it was a conscious choice, but it was one of the inevitable by-products of my choice to use an example so simple that there was no way he could, ahem, weasel out of the implications. Watching him flail was mightily amusing. "What if the dice aren't fair?" Why not ask what if they were coins instead of dice while you're at it. It's another example of the "but we are not rocks", "that isn't my sister" lines of reasoning we've experienced.

Vince · 22 September 2008

Stanton said: So now can we finally get back to talking about immune memory and amnesia in starfish?
Much of the problem with gaining an understanding of invert immunity lies with the fact that most folks approach it from the viewpoint and baggage of vertebrate immunity. They are, for example, typically shocked to find out that invert's don't have antibodies, probably because most Immunology texts do a piss poor job of overviewing invertebrate "immunity" in the first place. In short, "Immunity" to most implies adaptive immunity, which to date has not been shown to occur in invert's, likely as the result of their typically short life span. In my opinion, the outcome of this is that many vertebrate evolutionary biologists therefore approach invertebrate immunology with the preconceived notion that they'll find some sort of linear progression of precursor mechanisms leading directly to the vertebrate immune system. Moreover, once one invert mechanism is identified (e.g., melanization) it is often incorrectly thought that all invert's utilize that mechanism. The different modes of internal defense in invert's, and our comparatively poor understanding of their modes of action at both the functional and molecular level in most invertebrate groups (apologies to my mosquito, snail, and oyster co-workers) hasn't helped, although progress is being made in this direction. What's being found out is that some vertebrate molecules integral to vertebrate immunity have precursors in invert's that may or may not function in "immunity" (more properly termed "Internal defense") in the invert (Toll-like molecules, cytokines, and Ig family molecules). Much more work needs to be done in this area, which IMO is deserving of more support, not just because of the importance of invert's as disease vectors and food sources. My guess is that we'll ultimately end up with a diverse set of internal defense systems and that not all of the mechanisms will be precursors to the vertebrate adaptive immune response. Sorry about the rant, I'm probably not the best at explaining this area but I'm ecstatic to see some attention being paid to the subject. Vince

SWT · 22 September 2008

jobby said: that evolution cannot occur as described by MET – can be demonstrated to be false ... you really need to study the theory. Nowhere does ID theory say evolution cannot occur. Of course it occurs. Every day, every minute.
Then you agree that evolution can occur as described by MET?

eric · 22 September 2008

Personally I think the former. This is a blatant generalization so I'll apologize in advance for offending anyone, but the style of his response (very short, no editing) resembles texting. And that to me says "young." eric
Sylvilagus said: Two other options: jobby is a junior high student and/or jobby has a personality disorder... "you do it! No YOU do it... ad nauseum." I suspect the latter though of course he will predictably deny it.

Dave Lovell · 22 September 2008

jobby said: I feel some goal posts shifting here.
Yes, yours to keep out the own goal!

Vince · 22 September 2008

jobby said: Then you agree that evolution can occur as described by MET? .. well to properly answer that I would have to know what you mean 'as described by MET' I feel some goal posts shifting here.
Yeah right! The goal posts are shifting and they are being carried off the field by Jobby, whom we will note, when given an example to support his query about NS as a driving force in evolution and whom was then asked to provide a counter example of ID doing the same did not answer. You've had plenty of time to get the data Jobby, so I'll repeat the challenge: Just fill in the Blanks and you can use extra space, it’s OK. Jobby’s Testable Hypothesis on ID: ______________________________________. Jobby’s prediction: __________________________________________. Jobby’s Results: _____________________________________________. Jobby’s Conclusions: _________________________________________. Extension and usefulness of Jobby’s findings to the real world ______________. I am still awaiting your response. Vince

SWT · 22 September 2008

jobby said: Then you agree that evolution can occur as described by MET? .. well to properly answer that I would have to know what you mean 'as described by MET'
Futuyma's description of the Modern Synthesis will do as a brief description of what I mean by MET (modern evolutionary theory).
I feel some goal posts shifting here.
Don't worry -- I will be vigilant to make sure that you don't shift them.

jobby · 22 September 2008

well to properly answer that I would have to know what you mean ‘as described by MET’ I feel some goal posts shifting here.

... well I guess you guys love when those goal posts are movable cuz you wont even answer the above.

typical Dimwitists

jobby · 22 September 2008

Vince said:
jobby said: Then you agree that evolution can occur as described by MET? .. well to properly answer that I would have to know what you mean 'as described by MET' I feel some goal posts shifting here.
Yeah right! The goal posts are shifting and they are being carried off the field by Jobby, whom we will note, when given an example to support his query about NS as a driving force in evolution and whom was then asked to provide a counter example of ID doing the same did not answer. You've had plenty of time to get the data Jobby, so I'll repeat the challenge: Just fill in the Blanks and you can use extra space, it’s OK. Jobby’s Testable Hypothesis on ID: ______________________________________. Jobby’s prediction: __________________________________________. Jobby’s Results: _____________________________________________. Jobby’s Conclusions: _________________________________________. Extension and usefulness of Jobby’s findings to the real world ______________. I am still awaiting your response. Vince
Already answer this and my post was then erase about 10 minutes after I posted it.

SWT · 22 September 2008

jobby said: Already answer this and my post was then erase about 10 minutes after I posted it.
Since you've already worked out an answer, it shouldn't be too hard to reconstruct it. This time, why not save your work? I suspect this won't be the last time you'll be asked to respond to these questions.

stevaroni · 22 September 2008

Since you’ve already worked out an answer, it shouldn’t be too hard to reconstruct it. This time, why not save your work?

Because if he did that he couldn't hide behind the "martyr defense".

eric · 22 September 2008

Jobby, No, what you said was that you think aliens manipulated DNA. I'll give you a bit of credit - this is one small step up from providing no alternative at all. However, you have NOT answered Vince because this is not enough to qualify as a hypothesis. For that we need to know how to distinguish manipulation from natural DNA sequences. Which means we need some idea of what sort of signal to look for. Until we get that, your suggestion remains a variation of ID's typical "somewhere, sometime, somebody did something" claim. Its untestable and unfalsifiable. You would get even more credibility if you provided a complete scenario rather than just grudgingly giving up minimal information. When were they here? For how long? What species did they manipulate? What corroborating archaeological evidence of them can we expect to find, and where is it? One last thought. We already have more than 180 fully sequenced genomes. Biologists study them intensly for sequence-function relationships. There's been no indication of any alien manipulation. Why not?
jobby said:
Vince said: Jobby’s Testable Hypothesis on ID: ______________________________________. Jobby’s prediction: __________________________________________. Jobby’s Results: _____________________________________________. Jobby’s Conclusions: _________________________________________. Extension and usefulness of Jobby’s findings to the real world ______________. I am still awaiting your response. Vince
Already answer this and my post was then erase about 10 minutes after I posted it.

Robin · 22 September 2008

I find it remarkable that Bobby (et aliases) has developed a valid ID hypothesis and test when none of the major ID proponents, particularly those with actual backgrounds in science, have been able to do so. It is a wonder that Bobby's concept and contributions have not made international news...

jobby · 22 September 2008

Since you’ve already worked out an answer, it shouldn’t be too hard to reconstruct it. This time, why not save your work? I suspect this won’t be the last time you’ll be asked to respond to these questions.

... if my comments are so much in demand maybe they should not be erased.

jobby · 22 September 2008

For that we need to know how to distinguish manipulation from natural DNA sequences.

... signatures. just as we distinguish a degas from a monet other than by the style

jobby · 22 September 2008

There’s been no indication of any alien manipulation. Why not?

... they havent been looking for it.

Henry J · 22 September 2008

Now somebody needs to define "signature" as it would apply to a strand of DNA.

jobby · 22 September 2008

Henry J said: Now somebody needs to define "signature" as it would apply to a strand of DNA.
Using the same code that computer keyboards use, the Japanese group, led by Masaru Tomita of Keio University, wrote four copies of Albert Einstein’s famous formula, E=mc2, along with “1905,” the date that the young Einstein derived it, into the bacterium’s genome, the 400-million-long string of A’s, G’s, T’s and C’s that determine everything the little bug is and everything it’s ever going to be. The point was not to celebrate Einstein. The feat, they said in a paper published in the journal Biotechnology Progress, was a demonstration of DNA as the ultimate information storage material, able to withstand floods, terrorism, time and the changing fashions in technology, not to mention the ability to be imprinted with little unobtrusive trademark labels — little “Made by Monsanto” tags, say.

jobby · 22 September 2008

It is a wonder that Bobby’s concept and contributions have not made international news…

... if good science needs good marketing channels

Henry J · 22 September 2008

Eh? I thought the question at hand was how to identify an unknown signature. I don't see how identifying a already known sequence applies to that.

Besides that, DNA sequences don't have durability over time. They might not be bothered by floods, fashions, or terrorism, but they do accumulate changes over large numbers of generations.

SWT · 22 September 2008

jobby said: Since you’ve already worked out an answer, it shouldn’t be too hard to reconstruct it. This time, why not save your work? I suspect this won’t be the last time you’ll be asked to respond to these questions. ... if my comments are so much in demand maybe they should not be erased.
I have no control over that. Before the question gets erased, I'm still wondering: do you agree that evolution can occur as described by MET?
SWT said:
jobby said: Then you agree that evolution can occur as described by MET? .. well to properly answer that I would have to know what you mean 'as described by MET'
Futuyma's description of the Modern Synthesis will do as a brief description of what I mean by MET (modern evolutionary theory).

jobby · 22 September 2008

Besides that, DNA sequences don’t have durability over time

........Masaru Tomita of Keio thinks they do. You should take it up with him

jobby · 22 September 2008

thought the question at hand was how to identify an unknown signature. I don’t see how identifying a already known sequence applies to that.

... by studying how know signtures are put into DNA we can develop ways to find the unknown ones. takes money tho

jobby · 22 September 2008

Futuyma’s description of the Modern Synthesis will do as a brief description of what I mean by MET (modern evolutionary theory).

... put it in your own words (if you can)

jobby · 22 September 2008

but they do accumulate changes over large numbers of generations.

.... not in the junk dna

eric · 22 September 2008

Jobby, Thanks for the reference. You conveniently snipped the part of my post where I said 'we need some sort of idea of what signal to look for.' And you haven't provided that. Look, here's the difference between real science and what you and the ID crowd does. In 30 seconds I was able to find out exactly what signal ("1905" in four places) some Japanese researchers (a type of designer) put into bacteria (a type of organism) in 1987 (a date), and for what reason (proof of a data storage principal). In contrast, you won't spend 30 seconds and answer the same questions - what sequence, what designer, what organism, what date, and what motivation? In fact ID has been around for twenty years and has yet to spend 30 seconds proposing any answer to these questions. I don't mean prove them, I mean just offer a plausible scenario with this level of detail. Thus the JAPANESE claim of genetic design is testable. YOUR claim is still so vague as to not qualify as a hypothesis.
jobby said:
Henry J said: Now somebody needs to define "signature" as it would apply to a strand of DNA.
Using the same code that computer keyboards use, the Japanese group, led by Masaru Tomita of Keio University, wrote four copies of Albert Einstein’s famous formula, E=mc2, along with “1905,” the date that the young Einstein derived it, into the bacterium’s genome, the 400-million-long string of A’s, G’s, T’s and C’s that determine everything the little bug is and everything it’s ever going to be. The point was not to celebrate Einstein. The feat, they said in a paper published in the journal Biotechnology Progress, was a demonstration of DNA as the ultimate information storage material, able to withstand floods, terrorism, time and the changing fashions in technology, not to mention the ability to be imprinted with little unobtrusive trademark labels — little “Made by Monsanto” tags, say.

Henry J · 22 September 2008

Besides that, DNA sequences don’t have durability over time

.….…Masaru Tomita of Keio thinks they do. You should take it up with him I suppose it depends how much time (or how many generations) one is talking about. Also the generation span and average mutation rate of the species. Now that I think about it in those terms, a signature of that sort might remain legible (even if slightly altered) for a few million generations.

SWT · 22 September 2008

jobby said: Futuyma’s description of the Modern Synthesis will do as a brief description of what I mean by MET (modern evolutionary theory). ... put it in your own words (if you can)
This is not mysterious, hidden information -- if you're qualified to critique evolution, you shouldn't need me to paraphrase Futuyma for you. The question stands: Do you believe that evolution can occur as described by MET?

eric · 22 September 2008

Henry, Your point illustrates why hypothesis details are so important. Time-of-design impacts quality-of-signature. Until Jobby gives a time of design, we can't figure out whether searching for a signature would be a waste of time or not. No funding agency would approve such a project unless the primary researcher demonstrated some credible chance of finding something. Meaning they would demand both a time of design and some sort of rationale for that time before proceeding. Research proposals are sort of like novels. Everyone thinks their half-baked idea would make a good one.
Henry J said:

Besides that, DNA sequences don’t have durability over time

.….…Masaru Tomita of Keio thinks they do. You should take it up with him I suppose it depends how much time (or how many generations) one is talking about. Also the generation span and average mutation rate of the species. Now that I think about it in those terms, a signature of that sort might remain legible (even if slightly altered) for a few million generations.

Henry J · 22 September 2008

but they do accumulate changes over large numbers of generations.

.… not in the junk dna Especially in the junk dna. Changes in coding or regulatory dna sometimes break things, so some fraction of changes there don't reproduce. Nonfunctional dna doesn't have that limit on changes. Although, that's over large numbers of generations, which for animals could mean millions of years, or for bacteria, thousands of years. Might be doable if redundant copies are stored in multiple colonies. But the initial question here was how to recognize an unknown signature from an unknown agent that may very well use unknown techniques to do the insertions. Use of known techniques might leave detectable effects, but if signature, agent, and technique are all unknown, there's no way to identify it.

Robin · 22 September 2008

In relation to the topic (ID movement immune to evidence) I found an interesting neurological explanation on why people tend to have a tough time letting go of beliefs even in the face of conflicting evidence. According to Dr. Robert Burton, when we get that feeling of 'knowing something', in reality very little, if any of our cognative processing center within our brain becomes active. Instead, having that feeling of knowing something is generated in our emotional centers. Burton's explanation is that just like having a 'feeling' to motivate us to eat or drink (or have sex or anything else) we have a 'feeling' associated with understanding to motivate us to rely on that understanding. Unfortunately, it is easily fooled and can become so motivating that one will refuse to alter it even in the face of evidence. Here's an interesting summary:

http://www.rburton.com/work1.htm

http://www.salon.com/env/mind_reader/2008/09/22/voter_choice/index.html

stevaroni · 22 September 2008

eric writes.... No funding agency would approve such a project unless the primary researcher demonstrated some credible chance of finding something. Meaning they would demand both a time of design and some sort of rationale for that time before proceeding.

This is dangerous talk, my friends, keep this up and at some point, jobby might realize that all needs is the information in the genome, not the lab to find the information. Given a listing of the genome of any creature he could easily look for the information himself, now couldn't he? I mean, if Einstein could work out relativity with nothing more than a pad and paper at his office desk after hours, how easy would it be for jobby, with his encyclopedic knowledge of computing, to write a program to search for hidden strings? Do you know how critical it is that jobby never get this information? Why, he'd blow the lid off the whole conspiracy! Fortunately, only a few hundred animal genomes have been fully sequenced, and as part of their clever duplicity, the evilutionists have already cunningly hidden many of them online where the only people who have any access are almost everybody on earth. The data is safe there because the only conceivable way to find this hidden trove is to master one of those fiendishly elusive and complicated "search engines". Evilutionists, will our fiendish duplicity never cease! Tricky, tricky, bastards we are, I tell you.

jobby · 22 September 2008

stevaroni said:

eric writes.... No funding agency would approve such a project unless the primary researcher demonstrated some credible chance of finding something. Meaning they would demand both a time of design and some sort of rationale for that time before proceeding.

This is dangerous talk, my friends, keep this up and at some point, jobby might realize that all needs is the information in the genome, not the lab to find the information. Given a listing of the genome of any creature he could easily look for the information himself, now couldn't he? I mean, if Einstein could work out relativity with nothing more than a pad and paper at his office desk after hours, how easy would it be for jobby, with his encyclopedic knowledge of computing, to write a program to search for hidden strings? Do you know how critical it is that jobby never get this information? Why, he'd blow the lid off the whole conspiracy! Fortunately, only a few hundred animal genomes have been fully sequenced, and as part of their clever duplicity, the evilutionists have already cunningly hidden many of them online where the only people who have any access are almost everybody on earth. The data is safe there because the only conceivable way to find this hidden trove is to master one of those fiendishly elusive and complicated "search engines". Evilutionists, will our fiendish duplicity never cease! Tricky, tricky, bastards we are, I tell you.
I think it is a litte more complicated then what you are making out. Go ahead give me that URL

jobby · 22 September 2008

there’s no way to identify it.

... wrong

jobby · 22 September 2008

Henry J said:

but they do accumulate changes over large numbers of generations.

.… not in the junk dna Especially in the junk dna. Changes in coding or regulatory dna sometimes break things, so some fraction of changes there don't reproduce. Nonfunctional dna doesn't have that limit on changes. Although, that's over large numbers of generations, which for animals could mean millions of years, or for bacteria, thousands of years. Might be doable if redundant copies are stored in multiple colonies. But the initial question here was how to recognize an unknown signature from an unknown agent that may very well use unknown techniques to do the insertions. Use of known techniques might leave detectable effects, but if signature, agent, and technique are all unknown, there's no way to identify it.
Masaru Tomita of Keio thinks they do. You should take it up with him. Or is he and 'IDiot'??

jobby · 22 September 2008

SWT said:
jobby said: Futuyma’s description of the Modern Synthesis will do as a brief description of what I mean by MET (modern evolutionary theory). ... put it in your own words (if you can)
This is not mysterious, hidden information -- if you're qualified to critique evolution, you shouldn't need me to paraphrase Futuyma for you. The question stands: Do you believe that evolution can occur as described by MET?
I believe you are faking it.

jobby · 22 September 2008

you shouldn’t need me to paraphrase Futuyma for you.

.... well I am afraid you might be misunderstanding him. Actually I do not think you are capable of paraphrasing his concepts. I think you could cut and paste but it does take understanding to paraphrase.

Too bad game over and you lose.

jobby · 22 September 2008

ATATTTGATTTCACGTGTCTAGCAGCTAACTTGTTAACATATAAAAGAGGGACCTGGATCGCAAGGTTTA
GTTCTTTATCTATGCCAAATGTTTATTAGTGAAATCGTCCTGAAGATATGATTCTACATATGGCGCTTTT
ATTTCACAGAATATTTAAGAAAAAGGACAACACATAGAATTGGACACAGAATTCAAAGACCACGGTACAA
CCTTCTTCTCCTTTTTTTTTTTACTTCAGCAAACAAAAAAAGTCAAATGACATGAAAAGTGGCGAGTCTT
CCGACAATAAATAATAAATTACTTTATAATTTTTGCAATGCAAGAGCGAACAAAAATGTTTCCTTTTTTT
CTCTTTATTTCCAGAGAGAGAAAACAGTCGTTTTAACCAATAACTATACACATCTTTGGGGGAAAAGTTC
TTGGACGGACACGAGTCAAACACAATCCCGAGACGCTTGTGGCAAAATAGAGGTAACCTTGTTGCAATGC
TTTCTAAAGTTGGTTTTTAAATCGGAATTCAAAAACCTTTAAAGTCGCTTCAGACTTCTTGATAGAGGAT
GGATCTCAAAAACAGAACAAAAGAGAAAGAGAGAGAGAGAGAGAAATAGAAACCAGCTATGGGGCATGCT
AAGAGACCTGGTTTTTTAGGCAAGCCCGTGGAAGAGTTCACTTTAAGCATTTCAGACCCACGCTGACCCG
CAATCCTTGCAACGTCGCTTTCCATGTCGACAGCAGCTTTGTCTCTTTCCCGGATCTTGGAGGAGCTCCG
GTTTGGCAAGGCAACGACCAATATAGAAACAGCACCATTCGGGAATCGATGAACTAGGAAAAATCTCTTT
CCCTCGGTTCCTCTCTAGATGTGCAGTGAAATGAAAATGCTCTTTTTTGAGATCCGCGAATATAAATCCT
CTACGTTTTTAAAAACTTTTTTTTCAGTACTCCTACTTGGATAGCGTTTCTGTTTGTTTGTTTGTTTTTT
AAATTCTAGTAAAATCCCATGATTGTCTTCACAGTGTTGCTACCATATCACTTTGTCATTAAAACAGACT
TCGTGCGTTTCATGGAGCGCTCATGTCTAGATTCAGTTTTCGTTAACTCGGTTGTTAAATACTTTTGCCG
CAGAGTCCGACGGTGTAACTTCCCACTTGCTCCAACGGGGAAAAGCCAAGCGGGAAGGAAAAACAAAACA
AAACAAAAATCCCTCATTCATGCCTCGATCGGACTGGCTACCATGCTGTTGGGGGTGTCTGGGAGCTGAG
AAGACATCGATGCTACTTCACTCCCGGTAGAATTGGAACCGGGGCCTCCTTCCGAAAAATTAACCTGCAG
CGAAGACGGGAGACAGAGAAAGGAAGGGGGTTAGTCCTGAGCCCAGCAGGGAGGAAACACGAGTGGGGCA
ATGTTCAGGCCTGCTGGGTCAGCCCAGGAACCCAACTCCAGGGAGACACGCGTGGCTCTGTACAGACGCC
ACGGAGCAGAAAGCGATCGCGGGCCATTGGATGCCACTGATTTCCCAACACGATGTGGCGTTCTCGAGGG
GTTCCCATGTTTGCTTCCCACAGTTTTTTGGTTTTTCCCAGCCCCTTGGGTCACTGGAATCGCTGGATTC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCCCAGCGCT
TAGAAAAGTGATCCTCCATAACCCCGTGATCCCCAGCACTTTACAAATACCATAATCACCCTTATCTCTC
GCACACACATTGTGGACTTCATCTCCTGTCTCCCTCCAGCTCCCAAAGACCTCCAGGCCTCATTATGCCC
GTATCCGCCCCCCCGCAAACATACACATCCCCAGCCCCCCAACATTGACTGCCAGTCAATCCTCCCGGGG
GAAGCCCGGATCGGGAGGGAGACAATGAGGGCCTTTCCCTGGGATAGGGGGAGGAGGGACGCTGGTTAGA
CACCCCCGGGGTTTCTTGGGGACACCATTGTTATTCAGGACTCTCTTCTTTAAACACACACGCACACACA
TTAATTTCAGGTGTAAAATTCAGTGACTAGGTGACTCCGAGTCCCTACGGTCAGGTGGGGTGGAGGAAAT
GTGCCCTCGGTAATTTGCAGCTGTAGCGCAGAAGCATCTAAAAGACCTTATCTTCCTGCTCACATCCACG
GATGGGGCCCATCACCACCACCAATTCAACAACAACAATAACAATAATAATATGTTTACTGAACACTCAC
GGGGTCCAATGCTTAGTGCTTAGCACATAATGCC

... you dont see the signature?? 'created by God 7000 BC in hexadecimal the upper right corner?

jobby · 22 September 2008

Pak Chung Wong, a researcher at Pacific Northwest National Laboratory, points out that some strains of bacteria have kept their DNA pretty much intact for millions of years.

Is Pak an 'IDiot'??

jobby · 22 September 2008

The human genome consists of the equivalent of approximately 750 megabytes of data .

this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

Stanton · 22 September 2008

jobbyTroll said: Pak Chung Wong, a researcher at Pacific Northwest National Laboratory, points out that some strains of bacteria have kept their DNA pretty much intact for millions of years. Is Pak an 'IDiot'??
Dr Wong was simply stating that because some bacteria strains undergo very little genomic change, especially when compared to other strains such as Escherichia coli, it would be possible to splice genomic libraries into the stable genomes of these particular bacteria, and not worry about mutations screwing with the information stored there. Nowhere did he ever claim that this was evidence for Intelligent Design. The only person who suggested this is you, jobby/bobby/goff/hamstrung/balanced The only person who can tell if Dr Pak Chung Wong is an Intelligent Design proponent or not is Dr Pak Chung Wong, himself, and he has never demonstrated or admitted that he is or ever was sympathetic to Intelligent Design.

Stanton · 22 September 2008

jobby said: The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
Genomes are not written in binary or hexidecimal, troll.

SWT · 22 September 2008

jobby said: you shouldn’t need me to paraphrase Futuyma for you. .... well I am afraid you might be misunderstanding him. Actually I do not think you are capable of paraphrasing his concepts. I think you could cut and paste but it does take understanding to paraphrase. Too bad game over and you lose.
Why don't you just answer the question? Do you believe that evolution can occur as described by MET?

David Stanton · 22 September 2008

So, let me get this straight. Darwin was wrong because the human genome couldn't possibly contain enough information to make a human being. Is that a fair summary of your argument? Have I got it right? Is that what you really want to claim?

Nice work dipstick. And of course still not one word about immunology. What a retard.

Here is a message from God written into your DNA:

"Thou shalt not lie."

Looks like you are having problems with the phenotypic expression of this sequence.

stevaroni · 22 September 2008

... because the human genome couldn’t possibly contain enough information to make a human being.

Wow. It comes as a great disappointment to me to find out that I don't contain enough genetic material to fully exist. I was already pretty agitated over the whole market meltdown thing, now how am I ever gonna sleep, knowing my genome is as hollow as my bank?

PvM · 22 September 2008

Jobby is wrong, the information in the genome is more than sufficient to account for all of this. Ignorance is no excuse
Stanton said:
jobby said: The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
Genomes are not written in binary or hexidecimal, troll.

Wayne Francis · 22 September 2008

jobby said:
stevaroni said:

eric writes.... No funding agency would approve such a project unless the primary researcher demonstrated some credible chance of finding something. Meaning they would demand both a time of design and some sort of rationale for that time before proceeding.

This is dangerous talk, my friends, keep this up and at some point, jobby might realize that all needs is the information in the genome, not the lab to find the information. Given a listing of the genome of any creature he could easily look for the information himself, now couldn't he? I mean, if Einstein could work out relativity with nothing more than a pad and paper at his office desk after hours, how easy would it be for jobby, with his encyclopedic knowledge of computing, to write a program to search for hidden strings? Do you know how critical it is that jobby never get this information? Why, he'd blow the lid off the whole conspiracy! Fortunately, only a few hundred animal genomes have been fully sequenced, and as part of their clever duplicity, the evilutionists have already cunningly hidden many of them online where the only people who have any access are almost everybody on earth. The data is safe there because the only conceivable way to find this hidden trove is to master one of those fiendishly elusive and complicated "search engines". Evilutionists, will our fiendish duplicity never cease! Tricky, tricky, bastards we are, I tell you.
I think it is a litte more complicated then what you are making out. Go ahead give me that URL
Really??? Hmmm lets see I put in the terms 'genetic sequence database' into my favorite search engine and low and behold....I get a bunch of links....I'll pick GenBank because it looks like it is exactly what I need. Quickly navigating their site I see that they have multiple methods of accessing the sequences to include flat files like this one ftp://ftp.ncbi.nih.gov/genbank/genomes/Bacteria/Streptococcus_agalactiae_2603/AE009948.fna That took me a whopping 6 minutes to get to and I've never visited that site before so had to do some reading along the way.

Vince · 23 September 2008

jobby said:
Vince said:
jobby said: Then you agree that evolution can occur as described by MET? .. well to properly answer that I would have to know what you mean 'as described by MET' I feel some goal posts shifting here.
Yeah right! The goal posts are shifting and they are being carried off the field by Jobby, whom we will note, when given an example to support his query about NS as a driving force in evolution and whom was then asked to provide a counter example of ID doing the same did not answer. You've had plenty of time to get the data Jobby, so I'll repeat the challenge: Just fill in the Blanks and you can use extra space, it’s OK. Jobby’s Testable Hypothesis on ID: ______________________________________. Jobby’s prediction: __________________________________________. Jobby’s Results: _____________________________________________. Jobby’s Conclusions: _________________________________________. Extension and usefulness of Jobby’s findings to the real world ______________. I am still awaiting your response. Vince
Already answer this and my post was then erase about 10 minutes after I posted it.
Your're dithering: Simple solution: just repost your answer for all to see.

jobby · 23 September 2008

That took me a whopping 6 minutes to get to and I’ve never visited that site before so had to do some reading along the way.

Of course finding the info you indicated is fairly easy. But my point was finding the a signature is difficult.

Try using your pea brain for a second. If we wanted to place a signature in the DNA so that intelligent beings not from our culture could read it say 1 million years from now, how would we do it. Certainly not English. What then??

jobby · 23 September 2008

Your’re dithering: Simple solution: just repost your answer for all to see.

... Can you please quit spamming. It just makes things harder to read here. You are truly a troll. Look I am not going to paste answers and get them erased over and over and over. YOU copy my answers next time if they are of that great importance to you.

And please quit spamming.

jobby · 23 September 2008

obby is wrong, the information in the genome is more than sufficient to account for all of this.

Ignorance is no excuse

...YOUR ignorance is showing yet again:

Please point me to the study that validates your assertion.

jobby · 23 September 2008

Genomes are not written in binary or hexidecimal.

Well your trollness, I never said they were. Is this really that difficult for you??

jobby · 23 September 2008

The only person who can tell if Dr Pak Chung Wong is an Intelligent Design proponent or not is Dr Pak Chung Wong, himself,

... I imagine he is too smart to admit that he feels sympathetic to ID. He seems to know the politics.

SWT · 23 September 2008

jobby said:
SWT said:
jobby said: Futuyma’s description of the Modern Synthesis will do as a brief description of what I mean by MET (modern evolutionary theory). ... put it in your own words (if you can)
This is not mysterious, hidden information -- if you're qualified to critique evolution, you shouldn't need me to paraphrase Futuyma for you. The question stands: Do you believe that evolution can occur as described by MET?
I believe you are faking it.
Come on, the question really isn't that hard -- I am asking for your opinion: Do you believe that evolution can occur as described by MET?

jobby · 23 September 2008

Do you believe that evolution can occur as described by MET?

... YOU have to define precisely what you mean. MET can have a lot of different meanings. See this is why I think you are faking here. If you were earnest you would simply tell me what you mean. But I believe you are a troll.

SWT · 23 September 2008

jobby said: Do you believe that evolution can occur as described by MET? ... YOU have to define precisely what you mean. MET can have a lot of different meanings. See this is why I think you are faking here. If you were earnest you would simply tell me what you mean. But I believe you are a troll.
I have defined what I mean by MET (Futuyma’s description of the Modern Synthesis), and you're the only one who has expressed any uncertainty about what I mean -- and this is a pretty tough room. So, for the sixth time, do you believe that evolution can occur as described by MET? Feel free to add enough detail to your answer to insure that your response is unambiguous.

Eric · 23 September 2008

jobby said: Of course finding the info you indicated is fairly easy. But my point was finding the a signature is difficult.
Its especially difficult if you follow the standard ID practice of never deciding what it is you want to look for, and then never actually looking for it. This is real simple. You have a hypothesis that there's a signal. Okay, you go find it. Or find someone who will do it for you. But no one else is obligated to spend their time researching your idea.
PvM said: Jobby is wrong, the information in the genome is more than sufficient to account for all of this. Ignorance is no excuse
…YOUR ignorance is showing yet again: Please point me to the study that validates your assertion.
There is no need for a study. Your claim is equivalent to saying that a miracle is needed for any human baby to develop into an adult. That divine intervention is needed to explain puberty. Its ridiculous.

Bryan · 23 September 2008

jobby said: looking across the animal phyla there is a clear, and obvious progression ... well sure there is a progression. but was in caused by NS?
Sorry for the delay in the reply - I was gone over the weekend to a wonderful palce with no electricity, internet or phone... Actually, natural selection would ha e only played a partial role - the rest of evolution (drift, mutation, etc) would also have been involved.

jobby · 23 September 2008

Its especially difficult if you follow the standard ID practice of never deciding what it is you want to look for, and then never actually looking for it.

... give me the funds and I will look for it

jobby · 23 September 2008

Actually, natural selection would ha e only played a partial role - the rest of evolution (drift, mutation, etc) would also have been involved.

... complex structures can be accomplished thru G drift? think before you write

jobby · 23 September 2008

Your claim is equivalent to saying that a miracle is needed for any human baby to develop into an adult.

... do you have trouble reading? when did I say that?

jobby · 23 September 2008

SWT said:
jobby said: Do you believe that evolution can occur as described by MET? ... YOU have to define precisely what you mean. MET can have a lot of different meanings. See this is why I think you are faking here. If you were earnest you would simply tell me what you mean. But I believe you are a troll.
I have defined what I mean by MET (Futuyma’s description of the Modern Synthesis), and you're the only one who has expressed any uncertainty about what I mean -- and this is a pretty tough room. So, for the sixth time, do you believe that evolution can occur as described by MET? Feel free to add enough detail to your answer to insure that your response is unambiguous.
YOU have to define precisely what you mean. MET can have a lot of different meanings. See this is why I think you are faking here. If you were earnest you would simply tell me what you mean. But I believe you are a troll.

Robin · 23 September 2008

Time to flush Bobby again for regressing back into his trollish behavior. There is only one definition for MET that I can find doing both Yahoo and Google searches (nevermind actually knowing the definition as provided by Futuyma). If Bobby is going to act in such a manner, he should be removed.

fnxtr · 23 September 2008

What... oh forget it.
Why does anyone care what this bonehead believes anyway?
Have it your way. Space aliens did it. You win. Goodbye.

jobby · 23 September 2008

There is only one definition for MET that I can find doing both Yahoo and Google searches

... paraphrase it. Are you able to?

jobby · 23 September 2008

"Over the past decade or two, scientists have begun to suspect that there are other properties of complex systems (such as living organisms) that may help, together with natural selection, explain how things such as eyes, bacterial flagella, wings and turtle shells evolve," Pigliucci told LiveScience.

SWT · 23 September 2008

jobby said:
SWT said:
jobby said: Do you believe that evolution can occur as described by MET? ... YOU have to define precisely what you mean. MET can have a lot of different meanings. See this is why I think you are faking here. If you were earnest you would simply tell me what you mean. But I believe you are a troll.
I have defined what I mean by MET (Futuyma’s description of the Modern Synthesis), and you're the only one who has expressed any uncertainty about what I mean -- and this is a pretty tough room. So, for the sixth time, do you believe that evolution can occur as described by MET? Feel free to add enough detail to your answer to insure that your response is unambiguous.
YOU have to define precisely what you mean. MET can have a lot of different meanings. See this is why I think you are faking here. If you were earnest you would simply tell me what you mean. But I believe you are a troll.
I have defined precisely what I mean -- what is ambiguous about "Futuyma's description of the Modern Synthesis?" For the seventh time, do you believe that evolution can occur as described by MET?

David Stanton · 23 September 2008

Of course Booby should be removed. He already was. When cornered, he reverts to juvenile word games. He now seems to realize what everyone else has known for over twenty years, that more than natural selection is involved in the evolutoon of complex structures. Big surprise.

This troll is absolutely worthless. He lies, he calls everyone else a troll, he refuses to read the literature and he absolutlely refuses to stay on topic. Ban him for good. Better yet, stop responding to his nonsense.

Eric · 23 September 2008

jobby said: Your claim is equivalent to saying that a miracle is needed for any human baby to develop into an adult. ... do you have trouble reading? when did I say that?
Why, on September 22 at 7:43PM, to be exact. In case what you forgot what you wrote yesterday, here it is:
The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
You said, very clearly, not enough to account for development. Perhaps you misinterpreted something you read in the Wong and Mi abstract???

stevaroni · 23 September 2008

jobby is wrong, the information in the genome is more than sufficient to account for all of this. Ignorance is no excuse

Please point me to the study that validates your assertion. OK, I said I wouldn't respond directly to the troll till he put his proposed explanations on the line. I've been for four days now, but this is so blazingly stupid I have to chime in. Jobby's original assertion, the one he's been boxed into defending is...

(comment 167226 in it's entirity) The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

So let me get this right... The human genome, which, along with a very small string of mitochondrial DNA, is the entire genetic package carried by the fertilized human zygote. Exactly one copy. But this is simply not enough information to make a human. Even though it does. Maybe I'm being mean. Maybe he just doesn't know where babies come from. Either way, this is a new pinnacle of argument even for ID proponents on PT. It's right up there with the Time Cube. To paraphrase Lloyd Bensen "I've known IDiots. You sir, are no IDiot".

stevaroni · 23 September 2008

This troll is absolutely worthless. He lies, he calls everyone else a troll, he refuses to read the literature and he absolutely refuses to stay on topic.

He really is. He's also really good at asymmetrical warfare. People waste a lot of time trying to answer his questions, but he doesn't want answers, he wants to waste more time, and he does so with one-sentence taunts. Again, for the sake of the lurkers, please note how much good, detailed, information PT posters put up in futile response to jobby's asinine questions. Please note that there may be irritation on the side of evolution's defenders, but never evasion or duplicity, which cannot be said of ID. One side has absolutely nothing to hide, the other side has absolutely nothing.

jobby · 23 September 2008

But this is simply not enough information to make a human. Even though it does.

... How do you know it has enough info?? Faith?

jobby · 23 September 2008

stevaroni said:

This troll is absolutely worthless. He lies, he calls everyone else a troll, he refuses to read the literature and he absolutely refuses to stay on topic.

He really is. He's also really good at asymmetrical warfare. People waste a lot of time trying to answer his questions, but he doesn't want answers, he wants to waste more time, and he does so with one-sentence taunts. Again, for the sake of the lurkers, please note how much good, detailed, information PT posters put up in futile response to jobby's asinine questions. Please note that there may be irritation on the side of evolution's defenders, but never evasion or duplicity, which cannot be said of ID. One side has absolutely nothing to hide, the other side has absolutely nothing.
Well define the MET thing. And show us you are forthcoming (what a joke!)

eric · 23 September 2008

jobby said: Do you believe that evolution can occur as described by MET? ... YOU have to define precisely what you mean.
For goodness' sake, I'll stick it in a post just so you have no further excuse to avoid answering the question. So, to repeat the question, do you believe evolution can occur as described below:
"...populations contain genetic variation that arises by random (ie. not adaptively directed) mutation and recombination; that populations evolve by changes in gene frequency brought about by random genetic drift, gene flow, and especially natural selection; that most adaptive genetic variants have individually slight phenotypic effects so that phenotypic changes are gradual (although some alleles with discrete effects may be advantageous, as in certain color polymorphisms); that diversification comes about by speciation, which normally entails the gradual evolution of reproductive isolation among populations; and that these processes, continued for sufficiently long, give rise to changes of such great magnitude as to warrant the designation of higher taxonomic levels (genera, families, and so forth)."

PvM · 23 September 2008

jobby said: But this is simply not enough information to make a human. Even though it does. ... How do you know it has enough info?? Faith?
Plain observation which shows how a fetus develops. Simple really

jobby · 23 September 2008

Plain observation which shows how a fetus develops. Simple really

... no one is denying that fetus develops. The question was whether the DNA has enough info storage capacity to soley guide this process.

Is this really that hard to understand??

jobby · 23 September 2008

So, to repeat the question, do you believe evolution can occur as described below:

... you were unable to explain this concept in your own words and you had to cut and paste? pity

anyhow the answer is yes

Vince · 23 September 2008

OK - Let's stop feeding the Troll. Now, is anyone else up to discussing Comparative Immunology?

David Stanton · 23 September 2008

OK. Now we are finally getting some where. Evolution occurs by exactly the mehanisms proposed, but Darwin was still wrong because the little blue devil in you back pocket needs to miraculously poof every baby human into existence. Great hypothesis. Of course you have some evidence for this.

This jerk is just too stupid to know when people are laughing at it.

David Stanton · 23 September 2008

Sorry Vince. You're exactly right.

I really liked your post on comparative immunology. I had not heard of the idea that inverts could get away without an immune system because they did not live very long. Maybe there is some evidence of more elaborate systems in inverts that are long lived, such as lobsters.

eric · 23 September 2008

jobby said: The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
This howler is a gift that keeps on giving. Its lunchtime, so here's yet another way in which Jobby is wrong. Devolopment isn't part of Darwinism. Darwinism is about generational changes in species (or allele frequencies, to use PvM's description). For the theory propounded by Darwin, as long as variation exists and is heritable, it doesn't really matter how animals develop. Jesus himself could fly down on a cloud and incubate every single living creature individually by hand, but if the resulting adults then compete to have offspring with heritable traits, natural selection is operating. Jobby's evidence doesn't disprove NS, what it does is make the designer even more cruel that normal. Under evolution you have a concept of a creator that throws his creations into a cruel competition for survival. According to Jobby, this is now disproven. Instead, Jobby has a designer who first makes his creations incapable of developing on their own and THEN throws them into a cruel competition for survival. :)

jobby · 23 September 2008

David Stanton said: OK. Now we are finally getting some where. Evolution occurs by exactly the mehanisms proposed, but Darwin was still wrong because the little blue devil in you back pocket needs to miraculously poof every baby human into existence. Great hypothesis. Of course you have some evidence for this. This jerk is just too stupid to know when people are laughing at it.
Are you reading OK? When did I say babies poof into existence? You sound like you are not in reality.

jobby · 23 September 2008

Devolopment isn’t part of Darwinism.

... then how did the instructions to take an animal fetus to full grown come from??

jobby · 23 September 2008

Eric said:
jobby said: Your claim is equivalent to saying that a miracle is needed for any human baby to develop into an adult. ... do you have trouble reading? when did I say that?
Why, on September 22 at 7:43PM, to be exact. In case what you forgot what you wrote yesterday, here it is:
The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
You said, very clearly, not enough to account for development. Perhaps you misinterpreted something you read in the Wong and Mi abstract???
Where did I say a miracle is needed for any human baby to develop into an adult???? Are you hallucinating??

stevaroni · 23 September 2008

then how did the instructions to take an animal fetus to full grown come from??

FWEEP! Foul! The Ref calls goalpost move! The original baffling jobby assertion (which he has yet to explain) is that that the genome doesn't have enough information to make a person Int he interest of fairness, let's rewind the tape and review comment 167226 in it’s entirity.

The human genome consists of the equivalent of approximately 750 megabytes of data . This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

The Ref finds a clean prior assertion: "A fertilized zygote, which only carries one copy of the genome, and can get no more information cannot possibly grow into an adult because there is not enough information available." The Ref resets the play and insists that the offense take the questions in order of precedence, the first issue being that he claims there is not enough information to accomplish that which plainly occurs. Only after we establish the prerequisite existence and sufficiency of such information will we move to subsequent issues about where it came from. For this down, the question is "Where do babies come from?" FweeeP! Back in Play...

jobby · 23 September 2008

“A fertilized zygote, which only carries one copy of the genome, and can get no more information cannot possibly grow into an adult because there is not enough information available.”

... nutbag.. I never said that. You really have trouble reading dont you?

stevaroni · 23 September 2008

For any Lurkers out there, this is the problem with ID. They have nothing, and most of their argument is based on "just say no".

It's straight out of Trial Lawyer 101; if you have no case, just argue.

The problem is, that eventually, when the only thing you've got is reflexive denial, you eventually have to deny the obvious and you get into these idiotic corners like "Human DNA doesn't contain enough information to make a human".

And then you have to try to explain where babies come from.

It's right up there with trying to bluff your way past claiming the earth is flat.

stevaroni · 23 September 2008

… nutbag.. I never said that. You really have trouble reading dont you?

Yes. You did. On September 22 at 7:43PM, to be exact.

The human genome consists of the equivalent of approximately 750 megabytes of data . This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

jobby · 23 September 2008

“A fertilized zygote, which only carries one copy of the genome, and can get no more information cannot possibly grow into an adult because there is not enough information available.”

=== equals =====

The human genome consists of the equivalent of approximately 750 megabytes of data .

This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

???????????

Are you nuts??

jobby · 23 September 2008

Is there are a serious inability to read here?? This is bizarre

jobby · 23 September 2008

“Human DNA doesn’t contain enough information to make a human”.

And then you have to try to explain where babies come from.

DDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHHH!!!!!!!!!!1

There could be other information sources.

Robin · 23 September 2008

jobby said: “A fertilized zygote, which only carries one copy of the genome, and can get no more information cannot possibly grow into an adult because there is not enough information available.” === equals ===== The human genome consists of the equivalent of approximately 750 megabytes of data . This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info. ??????????? Are you nuts??
There's nothing nuts about understanding that the two statements are equivalent. That you do not understand that is yet another firm demonstration that you do not understand what you are talking about. Clearly there is plenty of storage space within the human genome (and all other genomes) to account for body structures and development info. That you don't understand that is yet another firm demonstration of your inability to think logically.

jobby · 23 September 2008

Clearly there is plenty of storage space within the human genome (and all other genomes) to account for body structures and development info.

... that is an assumption not based on evidence, testing, experimentation or even calculations.

Pure gimme that ole time Darwinism Faith.

Now I have seen 'Blind Faith' in action.

jobby · 23 September 2008

jobby said: Clearly there is plenty of storage space within the human genome (and all other genomes) to account for body structures and development info. ... that is an assumption not based on evidence, testing, experimentation or even calculations. Pure gimme that ole time Darwinism Faith. Now I have seen 'Blind Faith' in action.
Incredible arrogance. How in the world do you know there is not another info source for the body plans. There was a time we did not know about DNA. Could it be possible there is another DNA type thing out there we have not discovered yet. Or are you assuming we have know everything there is to know already. Really you cannot see how faulty your logic is??

Henry J · 23 September 2008

If there is another "DNA type thing" in cells, scientists will deal with it when and if somebody discovers evidence of it. In the meantime it makes more sense to assume that another major type of molecule would have been noticed already if it were there.

eric · 23 September 2008

C'mon guys, get with the program. Jobby's right. Its clearly arrogant of you to value YOUR partially tested, partially understood idea about how genes lead to development, over HIS completely untested, not understood nonidea about how development occurs. Reject the imperfect knowledge of science! A partial explanation is worse than no explanation at all!
jobby said: Incredible arrogance. How in the world do you know there is not another info source for the body plans. There was a time we did not know about DNA. Could it be possible there is another DNA type thing out there we have not discovered yet. Or are you assuming we have know everything there is to know already. Really you cannot see how faulty your logic is??

stevaroni · 23 September 2008

there is another DNA type thing out there we have not discovered yet. Or are you assuming we have know everything there is to know already. Really you cannot see how faulty your logic is??

I'm lovin' this. Seriously, J. You're arguing flat earth here. Time to leave the thread. Still here? OK. Let's work it out, slowly, so you can have one last chance to dig the hole deeper. Your assertion is that the genome doesn't have enough information to make the organism. You're wrong that we cannot test this. We can make the model even simpler by using a chicken egg instead of a mammal (that gives us a self-contained world, if we were in a mammal, we'd have to control for "information leakage" from the mother.) A chicken egg has exactly 1 nucleus. 1 sperm. 1 egg. 1 cell. We know this has the potential to produce an organism, because it can be observed to do so, and has many, many times. The only information inside that egg is one copy of chicken DNA and a few hundred nucleotides of mitochondrial RNA. The egg white is basically a thin albumin soup, and the yolk is essentially vitamins, minerals, and fats. Nothing special, and certainly nothing that could coherently store information. If we want to, we can put the egg in an incubator, That way no information is passed from the environment. If we want to, we can put the incubator inside a Farady cage, in a filtered clean room, and keep all living organisms 3 feet away at all times. We will still get a chicken, jobby. Where did the information come from if not the DNA? Once again, How do you make a baby?

David Stanton · 23 September 2008

OK hand jobby. Now, all you have to do is demonstrate that this DNA-like thingy actually exists and then you might have something. Until then, absolutely on one is obliged to believe in it, not even you. You know, kind of like that unnamed designer that everyone keeps talking about.

So, believing in the power of DNA to direct development is blind faith and belief in your little blue demon is real science. Got it. Well, until you can come up with some evidence, stick you head between your legs and kiss you butt good bye. Oh, and when are you going to stop visiting porn sites?

By the way, got any thought on the immune system yet? Are mysterious DNA thingys involved in the immune system as well? Inquiring minds want to know.

jobby · 23 September 2008

Where did the information come from if not the DNA?

The world of physics is much stranger than what our intuitive knowledge can comprehend. We have gone from atoms to electrons to quarks to strangeness to kaons etc. At each stage they were surprised that smaller and smaller particles. The DNA was a big shock. One gig is cannot store enough info to account for the mappings or all the body structures AND the the physiology. A computers OS cannot run on one gig how can an animals body. And that does not include the developmental instructions. I know you want to believe in your world view. But your faith is making you blind.

jobby · 23 September 2008

and belief in your little blue demon is real science.

... when did I ever bring up a blue demon?

So, believing in the power of DNA to direct development is blind faith

... it is faith to believe it can miraculously do things which it does not have the capacity to do.

David Stanton · 23 September 2008

Just in case anyone thinks that the delusional hand jobby has even the faintest idea of what he is talking about, there are about 3 billion bases in the haploid human genome. For every base position there are 4 possible nucleotides (not including methylation, base modifications, acetylation patterns of histones, mitochondrial DNA, maternal effects, etc.) Now, how in the world could anyone get the figure 750 megabytes out of that? Care to show us your calculations retard, or did you just copy that from some creationist web site?

Keep diggin booby boy, that hole is getting deeper and deeper.

David Stanton · 23 September 2008

Well booby, you have once again failed to provide any alternatives, so we will just have to skip directly to filling in the gaps for you if you refuse to do so. It is a real time saver. Can you prove the blue demon does not exist?

Here, I'll make it real simple for you. All you have to do is come up with one protein that is used in the development of the human body that is not coded for in the human genome. That's it. Should be a piece of cake right? If you can't do that, then just shut up and go away, forever.

Is it just me, or is this nut job starting to sound a lot like realpc. Now that guy had problems.

Henry J · 23 September 2008

3,000,000,000 bases, 4 possible states each
= 6,000,000,000 bits
= 750,000,000 bytes

Though as I understand it, only a small fraction of that is coding genes.

But also as I understand it, the DNA does not have to encode the location and type of every cell, which would presumably take more than 750 meg. Instead, it gives guidelines to each type of cell on when and how much to grow. Take capillaries for example - they don't have to be at predetermined locations, they just have to be appropriate distances apart in order to deliver supplies to their client cells. So all the DNA has to specify is the spacing between them, not an exact road map.

Henry

D. P. Robin · 23 September 2008

Cleanup on aisle three!!!

Henry J · 23 September 2008

Aisle three? How does one determine the aisle number? ;)

D. P. Robin · 23 September 2008

Henry J said: Aisle three? How does one determine the aisle number? ;)
I just write what the voices tel me to! (Sound of maniacal laughter in the background) 8^)

Science Avenger · 23 September 2008

Handjobby is doing a great impersonation of the witch doctor who insists that it takes arsenic AND the magic spell to kill someone. Believing it is just the arsenic is blind faith, you see. Even if you kill someone with the arsenic supposedly without any spells, you can't prove that no one, anywhere, was casting a spell at that moment. After all, spells are complicated, and all that.

And at the risk of tossing gasoline on a blazing inferno, note that Handjobby bravely ran away from our discussion (if I may elevate it with that description) of computer simulations once I had addressed all his faulty arguments and defied him to show me the frontloading he so desperately needs to exist in my hypothetical program. I'm sure when poor Handjobby started parroting all those ignorant creationist canards about computer models he never expected to crash into someone who actually builds and uses such models who could call him on his bullshit. And yet, never the slightest acknowledgement of any of the corrections of his ignorance. It's another indication of just how intellectually dishonest he is, assuming he's not one of us just jacking around pretending to be an idiot.

Henry J · 23 September 2008

Well, then it's a good thing this blog has a spell checker...

stevaroni · 23 September 2008

note that Handjobby bravely ran away from our discussion

Yeah, he does that. Bullies always run once you corner them, and militant IDiots are almost always intellectual bullies. Just look at "Wild Bill" Dembski and his "I don't have to answer your pathetic details" hissy fit.

D. P. Robin · 23 September 2008

Henry J said: Well, then it's a good thing this blog has a spell checker...
True, the voices don't proofread very well.

jobby · 23 September 2008

Todd Moore:

How does the genetic code of the human species measure up against Microsoft Windows XP? Comparing the size of human genome to the latest operating system from Redmond may sound like a stretch, but the results might surprise you.

A DNA molecule consists of two strands that wrap around each other to resemble a twisted ladder whose sides, made of sugar and phosphate molecules are connected by rungs of nitrogen-containing chemicals called bases. There are 4 different bases that are present in DNA, which are Adenine, Thymine, Cytosine, and Guanine. These bases are always paired in such a way that Adenine connects to Thymine, and Cytosine connects to Guanine. These pairings produce 4 different base pair possibilities—A to T, T to A, G to C, and C to G.

The human genome, which is the entire sequence of DNA for the human body, consists of around 3 billion of these base pairs. This sequence is grouped into 23 distinct parts known as chromosome pairs. Our human genome is the latest in a long line of evolution, which is considered by many to be the architectural blueprint for human life.

The Windows XP operating system is the latest in a long line of operating systems from Microsoft Corporation. An operating system is the life force of a personal computer’s collection of hardware. It enables the running of applications, management of information, provides for data sharing and communication, and much more. The Windows XP operating system is grouped into over 5,000 distinct parts known as system components, libraries, and applications.

Computers store data in a binary format (0’s and 1’s) which can be thought of as rows of light switches either turned off or on. These 0 and 1 bits are usually grouped together to form larger numbers or structures--the smallest being a “byte” which consists of 8 bits. The computer industry denotes storage requirements in terms of bytes. Windows XP installed and configured requires around 1,500,000,000 bytes that can be stated as 1.5 gigabytes or 1,500 megabytes.

In order to represent a DNA sequence on a computer we would need to be able to represent all 4 base pair possibilities in binary form. This can be done using a minimum of 2 bits, which yields 4 different bit combinations (00, 01, 10, and 11). Each 2 bit combination would represent one DNA sequence. A single byte (or 8 bits) can represent 4 DNA sequences. In order to store the entire human genome on a computer without compression would require around 3,000,000,000 / 4 = 750,000,000 bytes of storage or 750 megabytes.

The human genome requires 750 megabytes of storage compared to 1,500 megabytes of storage for Windows XP. Microsoft’s latest operating system requires twice the storage space than the genetic blueprint of the human species. This does not imply that Windows XP is more advanced or complex than the human genome, in fact, there is little correlation between the complexity of an organism and the length of its DNA sequence. A simple creature known as amoeba dubia has a genome that is over 200 times larger than the human genome.

In conclusion, the Microsoft Windows XP operating system contains more code for operation of a personal computer than the human genome contains for the creation of life.

Jeez say he is off by a factor of 1000 say it stores 750 gigs. still not enough.

jobby · 23 September 2008

Wiki:

The human genome is the genome of Homo sapiens, which is stored on 23 chromosome pairs. Twenty-two of these are autosomal chromosome pairs, while the remaining pair is sex-determining. The haploid human genome occupies a total of just over 3 billion DNA base pairs and has a data size of approximately 750 Megabytes,[1] which is slightly larger than the capacity of a standard Compact Disc. The Human Genome Project produced a reference sequence of the euchromatic human genome, which is used worldwide in biomedical sciences.

If you feel this is incorrect you can go to wiki and correct it yourself.

jobby · 23 September 2008

Eberhard Passarge, M.D. is Professor of Human Genetics, Institute of Human Genetics, University of Essen, Essen, Germany:

He estimates 900 mb. I guess all these people are wrong and are IDiots.

jobby · 23 September 2008

Dr. Hugh Deasy trained as a physicist and astronomer and is currently working as flight dynamics consultant at the European Space Operations Centre, Darmstadt, Germany.

Jeez another IDiot! They are everywhere!

"Human beings are far more complicated than bacteria, with about 10 to 20 times the number of genes. The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA - some 11.25 megabytes of ASCII." Recent attempts to add some non repetitive sequences such as non coding RNA to the tally of information carrying DNA did not increase the total information content by more than a megabyte or so. Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity. Thus fields such as Sociobiology or evolutionary psychology, which assume that behaviour is to a large extent determined by the genes face a major challenge in the light of these findings. Take for example a new born gazelle - it is able to walk and then run within minutes of being born, a skill needed to flee prowling lions. Yet such skill requires sophisticated software, certainly many megabytes in size, to run on the latest robots from Honda or Soni. So the gazelle must have the equivalent of this sophisticated software, but if its genome is only tens of megabytes, then can it all come from the genes while allowing enough data to form the muscles and other bodily components? Can its neural network learn quickly enough to flee a charging lion? The latter is negated for example by the observations of a horse owner friend: "I can't remember how long it takes a foal to run after it's been born, but I think it stands up immediately after birth while the mother cleans it. It doesn't copy other running animals - in the case of the foal sired by our stallion, it was not just trotting an hour after being born, it was racing around the field with its body at an angle of about 45 degrees as it went round corners. In other words this is all wired in, like young cats' ability to see." The latter again begs the question of where all this hard wired behavior comes from in the presence of so few genes. Are we forced to reconsider mechanisms such as Jung’s collective unconscious?

jobby · 23 September 2008

“Length-based Encoding of Binary Data in DNA,” published by the American Chemical Society:

he human genome is comprised of 22,000 genes and takes the equivalent of 750 megabytes of data. This data, researchers say, takes up only about 3% of the storage capacity of the DNA material. The remaining 97% of DNA material provides “plenty of room to encode information in a genome,” researchers say, and allows that information to be preserved and replicated in perpetuity.

Jeez! More IDiots!

stevaroni · 23 September 2008

I just write what the voices tell me to!

I'm bad. I use the "voices" joke all the time and somebody invariably asks me what the voices say. I always just give an irritated little shrug and respond... "It's the same thing they always say - It's always Clean the guns! Clean the guns! "Geeze! How many times can you clean the guns? "The guns are freakin' clean already! "I wish they'd just give it a rest once in a while" People invariable step back just a bit and never, ever, ask again.

stevaroni · 23 September 2008

In conclusion, the Microsoft Windows XP operating system contains more code for operation of a personal computer than the human genome contains for the creation of life.

So? How much space should it take to encode all the necessary proteins?

eric · 23 September 2008

Yeah, you see those five posts about genome size you PT b*stards? How can you NOT see that they prove the nonmechanism nonproposed by Jobby is true!

To add insult to injury, you must also certainly admit that his nonexplanation has no gaps. No details means no gaps. Meanwhile, you don't know how every single development step is accomplished. Thats TONS of gaps! And everyone knows an explanation with no gaps is better than one with gaps!

So clearly the nonexplanation is superior. Throw in the towel, his logic is impeccable!

David Stanton · 23 September 2008

Still no answer hand jobby? I thought not. Piss off you ignorant twit.

tresmal · 23 September 2008

jobby said: The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

So jobby, how much information does it take?
1)The answer should be in the form of a numerical value.
2)And show your work or provide a source.


David Stanton · 23 September 2008

This just in: bumble bees aerodynamically incapable of flight. Film at 11:00.

No, wait, what would it look like if they really can't fly? Pretty boring film I guess.

Wayne Francis · 24 September 2008

jobby said: That took me a whopping 6 minutes to get to and I’ve never visited that site before so had to do some reading along the way. Of course finding the info you indicated is fairly easy. But my point was finding the a signature is difficult. Try using your pea brain for a second. If we wanted to place a signature in the DNA so that intelligent beings not from our culture could read it say 1 million years from now, how would we do it. Certainly not English. What then??
First you need to learn how to "reply" as you've mixed up my comments with yours. Your comments are
jobby said: Of course finding the info you indicated is fairly easy. But my point was finding the a signature is difficult. Try using your pea brain for a second. If we wanted to place a signature in the DNA so that intelligent beings not from our culture could read it say 1 million years from now, how would we do it. Certainly not English. What then??
What I was expanding on was
stevaroni said on September 22, 2008 6:09 PM ... how easy would it be for jobby, with his encyclopedic knowledge of computing, to write a program to search for hidden strings? Do you know how critical it is that jobby never get this information? ...
and your reply of
jobby said: I think it is a litte more complicated then what you are making out. Go ahead give me that URL
So I gave you one of those URLs. Remember your reply was to a post by stevaroni indicating that the genomes are easily available. stevaroni didn't talk about web resources on learning about cryptology at all so don't try to say you where asking for URLs on that. So do you care to explain what URLs you what to find? Then I can't blame you for moving the goal post. Now I don't know where you think any of us "pea brain" people said the message would be in English. Don't put words into our mouths. I to think it is funny that many of people that do bible codes use the KJV. Personally I like the Moby Dick Codes….they are far more interesting. The point that stevaroni was making was anyone has the source genetic code to try to look for some "signature" if they want to. No one does because honestly no one really expects to find "Made by God" type of signatures to show up. If we wanted someone 1 million years from now to pick up a message in DNA how would we do it? You are correct...English would not be my first choice. With this type of situation there are many things to factor in. 1) Encoding of the data. When you look at a word Sentence "Made by God" on a computer you have to understand that those letters are coded in some way. This might be in ASCII, UAC, EBCDIC, or a number of other encoding schemes. The problem is that all these methods rely on a understanding of the source language something you don't assume if you are trying to communicate with an unknown recipient. This is why you don’t see messages we have sent out into space encoded like that. 2) How to signify there is a message First thing is you would use something that, given the medium, would easily be recognised as not natural. Many people say “Look for π (pi) to n or more digits” I disagree as this makes assumptions on how floating point numbers are encoded into binary data, or in this case quad data format. On this I would suggest the use of another universal language element …primes, just like in the movie Contact. So the big thing here is deciding how do encode the data. Someone might come up with a logical assignment of A,C,G&T to the numerical values of 0,1,2&3. Maybe based on their molecular weight, strength of their molecular bond, etc. In the end I think anyone reading our message would not have a problem even if we assigned the values randomly. Next is to decide to we set up a size of our DNA (Byte)? Or just but up the raw numbers end to end and have them variate their lengths. Again either way should not be difficult for the receiver to figure out. If we did use fixed lengths then we would probably want to indicate that to them …for example if we decided to use sets of 8 nucleotides then we might want to indicate this by starting our message off with strings of 8 identical nucleotides, probably in the order of their values. i.e. AAAAAAAACCCCCCCCGGGGGGGGTTTTTTTT Then we might just start encoding the first part of our signature like this AAAAAAACAAAAAAATAAAAAACCAAAAAACTAAAAAAGTAAAAAATCAAAAACACAAAAACAT This is the sequence 1,3,5,7,9,11,13,17,19 If we did not have fixed lengths then it would look something like CTCCCTGTTCCACCAT Much harder to spot…even if we didn’t put in a string like AAAAAAAACCCCCCCCGGGGGGGGTTTTTTTT Before the fixed length. Now we would go much higher then 19 and we would probably want to have the set multiple times. We know that no matter what we do the strings will get changed. We will get point mutations, insertions, deletions, translocations and all the other types of errors in copying genetic material. We would ideally like to find a way to encode it in regions that are highly conserved but my understanding is that this type of data would not meet the criteria to be conserved…i.e. a mutation in these strings of nucleotides would not be catastrophic to the organism. Most likely the organism would not care unless we had the knowledge of how to cause a mutation of these strings of nucleotides to become fatal…not very likely. Could we encode error checking? Some type of parity? Well if we knew we where talking to someone with the specification of our encoding then sure…but we don’t so this would just make the message harder to read. 3) What would our message be? Again “Made by God” isn’t a good message…it is to short, and relies on a knowledge of English. The receiver might as well be looking at random strings. We could try to use math again but how much social information can be transmitted that way? Pictures is another way, again Contact used this theme, to convey information. Their method was fairly complex but similar methods could be used. All this said…I would not use DNA to send a message to the future…it is just to volatile and to hard to read. The records on Voyagers where a good way to communicate far into the future. There isn’t much info on the records but it is better then using DNA IMHO So while scientist have put messages in DNA it is more of a novelty at this point and far from a candidate for storing messages over millions of years. Anyway, if you want to find a message from “God” go ahead…you have everything you need…well maybe not the cryptographic skills but hey nothing stopping you from learning that besides your brain. If you are a YECer then according to your model there would not be that many mutations to degrade "Gods" message...well for that matter I would think "God" would have shielded the message from any damage ever.

Wayne Francis · 24 September 2008

jobby said: Plain observation which shows how a fetus develops. Simple really ... no one is denying that fetus develops. The question was whether the DNA has enough info storage capacity to soley guide this process. Is this really that hard to understand??
Technically jobby, without knowing it probably, is correct. There are external factors that guide in this process. For example Iodine deficiency during pregnancy was a huge factor in mental retardation and brain damage of babies. But jobby is basically saying that without the finger of "God" a Zigote will never form into a fetus. Even tho we don't have any sign of any other "information" being needed. The fact is the information within a species DNA is more then enough to make and instance of that species given the material it needs to build. Just like the blueprints of a house should be all that is needed to build that house as long as you know how to build and have the materials to build. What jobby thinks is that the DNA is missing information much like a house blueprint might be missing oh lets say...the basic floor plan. Between DNA and epigenetics there is even enough information for siamese twins to survive. The genetic "blue print" is so robust that the builders (Cells) can cope with unexpected changes like while building the spinal cord and finding there is not far away it can merge the 2. Abigail and Brittany Hensel are a great example of this. Unlike what most people think of siamese twins being mostly separate people joined at one point Abigail and Brittany share 1 pelvis and legs. Their lower spines join together. DNA isn't a hard and fast "blue print" of a species. It is more general building instruction and if everything is normal then you get the typical member of a species. Different environmental changes can effect the "building" of the member(s) of the species. Without Iodine the building goes on but it can't build it properly (like trying to build a concrete wall but running out of re-bar and continuing building without the re-bar) or (like building a house to plan but finding tat there is tree you are not allowed to cut down in the way and you alter the plan to build the house around the tree using basic building principals) Again remember that jobby honestly seems to think that a tree can't rise from a seed without the hand of "God" helping it along the way.

jobby · 24 September 2008

But jobby is basically saying that without the finger of “God” a Zigote will never form into a fetus.

... I never said that. It seems that your simplistic mind says it has to be Darwinism or God. No other alternative. I do not subscribe to that primitive thinking. It could very well be a yet undiscovered natural cause. Your allegiance to Darwinism has stifled your thinking processes.

jobby · 24 September 2008

The genetic “blue print” is so robust that the builders (Cells) can cope with unexpected changes like while building the spinal cord and finding there is not far away it can merge the 2.

... and all of this is done in 750 megs of instructions!
Truly miraculous!

Dave Lovell · 24 September 2008

Jobby

So you are convinced that the human genome contains about 750Mb, and this is not enough to encode the instructions to build a human being. From your reaction to comments about "divine intervention" and "poofing", I will for now do you the courtesy of assuming the you are happy that a fertilised egg contain all the information needed to build a human, but that more information must be encoded in this egg by other means, using a non-supernatural mechanism not yet understood. Is this a fair summary of your position?

You don’t suggest how much information you think is needed, but from your comparison with a computer operating system, it seems clear that you think considerably more than 750Mb of good (i.e. junk free), information is required. To keep the arithmetic simple, I’ll assume you think we need 10 times as much information, and generously assume this new encoding system contains only 90% junk not 97/98% as you propose for the DNA. We need 50 times as much information to be stored by your proposed mechanism. If this information were somehow encoded on the DNA, it would need to store 50 bits per ATCG code letter, greater than one bit per atom. As we can be sure there are no other chemistry based structures in the nucleus within many orders of magnitude of the size of the chromosomes, you are looking to store between one and hundreds of thousands of bits per atom (no magic, remember). This is well outside the realms of biochemistry. The teams at the Large Hadron Collider are probably twiddling their thumbs at the moment pending the repair of their equipment. Perhaps you should take this part of your theory to them.

However much information is required, your comparisons with Windows are seriously flawed. A better analogy would be the source code used to generate. If stripped of its verbosity and any comments included to make the code programmer readable, it will be several orders of magnitude smaller than the installed code size you postulate. The “product” can be far harder to describe than the instructions to generate it For example, using very few bytes of code, an assembly level programmer could write a program for a 64-bit x86 processor to make it fill 4Gbytes of memory with the first 500 million non-prime numbers. I would hazard a guess that the information required to describe a functional 1Gb DRAM chip is less that that required to describe the original Intel 4004 microprocessor, because of repetition of structures. Did you see the recent article here on snake segmentation? ( http://pandasthumb.org/archives/2008/07/snake-segmentat.html ). Complex anatomies can simply be built by a looping a parameterised call to a genetic subroutine until the prescribed number of body segments has been built. Fingerprints would be very complex to describe unambiguously over the lifetime of an individual, probably taking even more than your 750 MB for that alone. But they are not specified very precisely by genes, because if you examine your hands you will see that the prints are not completely symmetrical. Identical twins do not have perfectly matched fingerprints either.

jobby · 24 September 2008

So you are convinced that the human genome contains about 750Mb,

... this is not my opinion this the estmate by mainstream scientists

jobby · 24 September 2008

Complex anatomies can simply be built by a looping a parameterised call to a genetic subroutine until the prescribed number of body segments has been built.

... big assumption. prove it! That's science.

jobby · 24 September 2008

The overall point is there should be an estimate of how many bytes of info are needed to for instance have the necessary instructions to construct and operate a human. Including the pre-programmed behavioral instructions.

There has been no quantization of this and that is not science.

To say that there is enough space in the DNA cuz 'My Darwin tells me so' is not good enough.

I know the Darwinist devotees have immeasurable faith but sorry that is NOT science.

jobby · 24 September 2008

Is this the point:

The posters here believe the DNA has enough space to have the necessary instructions to construct and operate a human. Including the pre-programmed behavioral instructions.

Is this what the posters here believe??

Dave Lovell · 24 September 2008

jobby said: So you are convinced that the human genome contains about 750Mb, ... this is not my opinion this the estmate by mainstream scientists
That neatly avoided the point of the whole paragraph. I'll try again and change the question slightly. A yes/no answer, even an answer of the form "yes (but..)" or "no (because....)" is all that is needed to clarify your position so we don't have to argue over things we might agree on. Given that human genome contains a maximum of about 750MB, you think this is not enough to encode the instructions to build a human being. From your reaction to comments about “divine intervention” and “poofing”, I will for now do you the courtesy of assuming the you are happy that a fertilised egg contain all the information needed to build a human, but that more information must be encoded in this egg by other means, using a non-supernatural mechanism not yet understood. Is this a fair summary of your position?

eric · 24 September 2008

jobby said: Complex anatomies can simply be built by a looping a parameterised call to a genetic subroutine until the prescribed number of body segments has been built. ... big assumption. prove it! That's science.
Read Shubin's "Your Inner Fish." He describes evidence for repetition of instruction in segmentation in some detail. Specifically as it relates to humans, he describes how a single small spot on the developing hand uses the same set of instructions repeated to build all the fingers. I don't really know why you're even arguing about evidence of repeat-type instructions. There's nothing mechanically or conceptually difficult about a cell reading/activating the same DNA sequence twice.
The overall point is there should be an estimate of how many bytes of info are needed to for instance have the necessary instructions to construct and operate a human.
'Should be' for what? What science action are you suggesting? That geneticists cease all R&D until this question is answered? That we abandon all theories until someone can figure out exactly how much DNA is needed? What do you want us to do in response to this issue? You claim not to be an IDer but you keep falling back on the typical ID strategy of confusing "unsolved mystery" with "alternative explanation." No amount of pointing out mysteries will get people to accept a nonexplanation you don't describe. Only a viable alternative explanation will get people to question and abandon TOE.

Robin · 24 September 2008

Henry J said: If there is another "DNA type thing" in cells, scientists will deal with it when and if somebody discovers evidence of it. In the meantime it makes more sense to assume that another major type of molecule would have been noticed already if it were there.
Actually, I disagree Henry because I feel that you are accidentally addressing Bobby's strawman here. The fact is, as you noted, the ONLY thing that scientists can operate is what is available, not what might be available. Bobby (like a lot of creationists) is setting up a strawman about what scientists assume doesn't exist. Only, scientists DON'T assume such doesn't exist - they just don't have any evidence of such to consider it. And it isn't true that acknowledging that there is plenty of information in the genome to make a human is based on faith. That is what the evidence (yes...based on experiments, observations, etc) points to. Bobby can rail against such or make up claims that such isn't known by science all he wants, but unless he can present actual EVIDENCE that contradicts such an explanation and conclusion, his complaints are so much bluster in the wind.

Science Avenger · 24 September 2008

jobby said: ... I never said that. It seems that your simplistic mind says it has to be Darwinism or God. No other alternative. I do not subscribe to that primitive thinking. It could very well be a yet undiscovered natural cause. Your allegiance to Darwinism has stifled your thinking processes.
This is a completely moronic nonargument. MET has been incorporating formerly undiscovered natural causes for evolutionary facts for decades, things like the genetic code itself, sexual selection, genetic drift, evo-devo, and a host of others. The idea that scientists resist adding to this list out of some allegiance to Darwinism is a figment of Handjobby's disturbed imagination, just like the supposed frontloading of my computer simulation example.

eric · 24 September 2008

Wayne, Very nice detailed post on encoding a message into DNA. But you're forgetting the larger context of the claim. If you want to leave a message for millions of years, there are far better media than DNA. The very pressupposition that someone would try and communicate this way and only this way is somewhat ridiculous. Any designer who does that obviously does not have clear, unambiguous communication as a priority. What Jobby's doing is fitting data to a preconcieved idea. His logic goes something like this - (i) given that there is a designer; (ii) given that he left messages; (iii) acknowledging the fact that we observe no obvious messages, then; (iv) we must conclude the message is hidden somewhere we haven't looked, like in DNA. He never for a moment considers the fact that (iii) might actually be evidence that (i) or (ii) is wrong.
Wayne Francis said: If we wanted someone 1 million years from now to pick up a message in DNA how would we do it? You are correct...English would not be my first choice. With this type of situation there are many things to factor in. [rest deleted]

David Stanton · 24 September 2008

Still no answer to my question handjobby? Well now everyone can see that you are just blowing smoke out of your butt. Game over, you lose, go away ignorant twit.

Anyone who ever responds to this fool ever again gets exactly what they deserve.

stevaroni · 24 September 2008

Surprisingly, creating these sorts of messages is a fairly well researched area. It figures prominently in the work of those interested in searching for extraterrestrial intelligence, sort of the ultimate arena for "universal communication".

One of the seminal works in the field was Carl Sagan's "Communication with Extraterrestrial Intelligence" (MIT Press, 1973, 428 pgs). It was his work in this area that led him to write "Contact".

Eric brings up an interesting point though. DNA is a bad medium for messaged because it's particularly prone to weird mutations that can shift things around. If I send out a radio signal, bits may get dropped, but at least I can know that the rest of the bits will get to their destination in the right order, and missing information will be obvious.

Not so with DNA, where the genome will be chopped up and rearranged dramatically over the eons.

Also, since all instructions in DNA will be executed as actual code, even those simply meant to be a copyright symbol, I also have to make sure that my encoding system doesn't do something stupid when the instructions are executed, like create a virulent toxin.

Henry J · 24 September 2008

I also have to make sure that my encoding system doesn’t do something stupid when the instructions are executed, like create a virulent toxin.

Just avoid using start and stop codons in your encoding. :p Henry

Robin · 24 September 2008

Dave Lovell said: Jobby So you are convinced that the human genome contains about 750Mb, and this is not enough to encode the instructions to build a human being. From your reaction to comments about "divine intervention" and "poofing", I will for now do you the courtesy of assuming the you are happy that a fertilised egg contain all the information needed to build a human, but that more information must be encoded in this egg by other means, using a non-supernatural mechanism not yet understood. Is this a fair summary of your position? You don’t suggest how much information you think is needed, but from your comparison with a computer operating system, it seems clear that you think considerably more than 750Mb of good (i.e. junk free), information is required. To keep the arithmetic simple, I’ll assume you think we need 10 times as much information, and generously assume this new encoding system contains only 90% junk not 97/98% as you propose for the DNA. We need 50 times as much information to be stored by your proposed mechanism. If this information were somehow encoded on the DNA, it would need to store 50 bits per ATCG code letter, greater than one bit per atom. As we can be sure there are no other chemistry based structures in the nucleus within many orders of magnitude of the size of the chromosomes, you are looking to store between one and hundreds of thousands of bits per atom (no magic, remember). This is well outside the realms of biochemistry. The teams at the Large Hadron Collider are probably twiddling their thumbs at the moment pending the repair of their equipment. Perhaps you should take this part of your theory to them. However much information is required, your comparisons with Windows are seriously flawed. A better analogy would be the source code used to generate. If stripped of its verbosity and any comments included to make the code programmer readable, it will be several orders of magnitude smaller than the installed code size you postulate. The “product” can be far harder to describe than the instructions to generate it For example, using very few bytes of code, an assembly level programmer could write a program for a 64-bit x86 processor to make it fill 4Gbytes of memory with the first 500 million non-prime numbers. I would hazard a guess that the information required to describe a functional 1Gb DRAM chip is less that that required to describe the original Intel 4004 microprocessor, because of repetition of structures. Did you see the recent article here on snake segmentation? ( http://pandasthumb.org/archives/2008/07/snake-segmentat.html ). Complex anatomies can simply be built by a looping a parameterised call to a genetic subroutine until the prescribed number of body segments has been built. Fingerprints would be very complex to describe unambiguously over the lifetime of an individual, probably taking even more than your 750 MB for that alone. But they are not specified very precisely by genes, because if you examine your hands you will see that the prints are not completely symmetrical. Identical twins do not have perfectly matched fingerprints either.
The real problem with Bobby's arguments regarding the 750 MB worth of "storage space" in the human genome is that there is NO indication of how much space the information required to build a human MUST take up. In other words, why is he assuming that the information required to make an organism is related in any way to multiple bytes? Seems to me that the amount of information to make a human might only require 1 byte of space TOTAL and thus our genome may well have 749.99999 MB of space left. This is even assuming that the "information" within the genome takes up any space at all.

jobby · 24 September 2008

here is NO indication of how much space the information required to build a human MUST take up.

... sure there is! THINK!

stevaroni · 24 September 2008

There is NO indication of how much space the information required to build a human MUST take up.

… sure there is! THINK! Enlighten us, O Wise One. How do us mere mortals go about calculating this number? Your expert, Dr. Hugh Deasy says "human genes are coded in only about 1.5 % of our DNA - some 11.25 megabytes of ASCII.” Apparently, he's wrong?

Robin · 24 September 2008

stevaroni said:

There is NO indication of how much space the information required to build a human MUST take up.

… sure there is! THINK! Enlighten us, O Wise One. How do us mere mortals go about calculating this number? Your expert, Dr. Hugh Deasy says "human genes are coded in only about 1.5 % of our DNA - some 11.25 megabytes of ASCII.” Apparently, he's wrong?
The whole premise is just silly. It's easy to determine how much space a given program will require when both the storage space format and the program format are known. It also helps that we developed the media and the storage. But there's no reason to assume that biological developmental "information" is even remotely analogous, which of course is the whole problem I have with Dembski's question begging argument regarding CS. It is quite possible that the "information" contained in the genome takes up NO space at all, but regardless from a scientific perspective, we can only study what is, not what might be. Of course, if Bobby wishes to provide an actual scientific hypothesis for the extra information he feels is required, actually test said hypothesis, and then actually get said study published in s peer-reviewed scientific journal, I'm sure actual scientists will take a look at it. As it stands, it is just and argument from incredulity.

eric · 24 September 2008

stevaroni said: DNA is a bad medium for messaged because it's particularly prone to weird mutations that can shift things around.
The final irony for creationists is the reverse conclusion - messages should be easy to transmit and read if you assume, as Behe does, that there is a limit to evolutionary change. You just stick the message in the non-mutable parts. Which means Behe's assumption would falsify the hypothesis of a communicative designer. *If* there is an unevolvable/non-mutable part of the code and *if* there's no message in it, then either the designer is too stupid to use it or doesn't want to communicate. :)

jobby · 24 September 2008

As it stands, it is just and argument from incredulity.

.... So you feel that the DNA has enough space to have the necessary instructions to construct and operate a human. Including the pre-programmed behavioral instructions. ???

jobby · 24 September 2008

Which means Behe’s assumption would falsify the hypothesis of a communicative designer.

... and if the concept is falsifiable it is a 'scientific' theory.

thank you for admitting that ID is science.

jobby · 24 September 2008

But there’s no reason to assume that biological developmental “information” is even remotely analogous,

... and there is no reason to assume it is not.

eric · 24 September 2008

1. No, science requires more than just Popper's falsifiability criteria. 2. Thank you for agreeing to a definition of ID. I'm keeping your message for the next time you try and dodge that particular issue. How's your review of that Wong and Mi article coming?
jobby said: Which means Behe’s assumption would falsify the hypothesis of a communicative designer. ... and if the concept is falsifiable it is a 'scientific' theory. thank you for admitting that ID is science.

stevaroni · 24 September 2008

Robin: But there’s no reason to assume that biological developmental “information” is even remotely analogous, Jobby: … and there is no reason to assume it is not.

So, um, Jobby, then your saying that biological development information is the same sort of thing as a big long string of computer code, so then by extension, there has to be some sort of storage medium where this big, long string has to be kept. Apparently, it has to be serial, like computer code, since "instruction order" matters. If your current statement is true, and there has to be some structured medium, haven't you successfully argued against your previous post, where you complained that DNA wasn't capable of holding all this information?

Robin · 24 September 2008

jobby said: But there’s no reason to assume that biological developmental “information” is even remotely analogous, ... and there is no reason to assume it is not.
...which is nothing more than question begging by arguing a negative. That's illogical, nevermind being a very unscientific approach to understanding anything. Thankfully, rational scientists ignore such nonsense. Oh...and in case you don't understand, Bobby, since there's no reason to assume that biological developmental "information" is analogous to digital (or analog) information, there's nothing to consider as far as the inverse is concerned. There is no "information" size to even consider as far as biological systems are concerned as far as anyone can currently tell. Speculating that the information has some kind of size is absolutely meaningless unless you have some evidence for it (which, oddly enough, you don't have).

Robin · 24 September 2008

jobby said: As it stands, it is just and argument from incredulity. .... So you feel that the DNA has enough space to have the necessary instructions to construct and operate a human. Including the pre-programmed behavioral instructions. ???
The issue of DNA's capacity is of no concern at this point since there is nothing to indicate the 'dimension' or 'space' that the (theoretical) "information" within DNA takes up. Again, there is nothing to indicate that all the information contained in DNA isn't equivalent to 1 byte. When someone discovers some objective evidence indicating the attributes of said information and in particular the area it takes up, then we can discuss whether there's enough room in the genome for such. Until then, such a discussion is moot.

Robin · 24 September 2008

jobby said: Which means Behe’s assumption would falsify the hypothesis of a communicative designer. ... and if the concept is falsifiable it is a 'scientific' theory. thank you for admitting that ID is science.
Incorrect. It would only demonstrate that the "designer" proposed by ID could not be the Christian "God" of the bible.

Henry J · 24 September 2008

Well, the sequence info for proteins does seem to take a certain amount of space on the DNA string. Then there's regulatory sequences that turn genes on and off. It does sort of make sense to note how many bits of computer memory it takes to store a digital representation of those things.

fnxtr · 24 September 2008

I suppose if a person programmed a CNC machine or something similar with instructions to "make more CNC machines", and you subjected this machine to environmental stresses (UV, maybe) that altered the program so that the next generation was built slightly differently than the original, this DNA/software analogy might come a little closer to actually being useful... ROMs, CD's, and hard drives, as far as I know, do not reproduce. Seems to me that in natural systems there a big blurry interface between
'software' and 'hardware' equivalents.

jobby · 24 September 2008

It would only demonstrate that the “designer” proposed by ID could not be the Christian “God” of the bible.

.... ID theory does not say it is 'God'. So your point is moot.

Robin · 24 September 2008

Henry J said: Well, the sequence info for proteins does seem to take a certain amount of space on the DNA string. Then there's regulatory sequences that turn genes on and off. It does sort of make sense to note how many bits of computer memory it takes to store a digital representation of those things.
I can understand thinking of such in general analogous terms, but insisting (as Bobby does) that there is insufficient space within the genome for the information required is just a claim out of his rear. There's no indication of the absolute size of the information, so on what could such a conclusion accurately be drawn?

stevaroni · 24 September 2008

… ID theory does not say it is ‘God’. So your point is moot.

Actually, ID "theory" doesn't say much of anything.

Robin · 24 September 2008

jobby said: It would only demonstrate that the “designer” proposed by ID could not be the Christian “God” of the bible. .... ID theory does not say it is 'God'. So your point is moot.
LOL! Riiiiiggghtt! And George Bush does not say that the War in Iraq was started under false pretenses. It's called lying by omission and denial and it's just as dishonest as fraud. Yeah...ID does not say anything about the "designer" being God...except when one of the ID proponents (like Dembski) is wearing his or her "theistic hat"...

David Stanton · 24 September 2008

While hand jobby is buzy trying to find an example of a protein not encoded by the human genome as I requested, I should add a few more caveats to the list I already presented, just in case anyone thinks that hand jobby knows anything about anything.

(1) The genome is not a blueprint for building the human body, it is a set of instructions. As others have noted, this renders any supposed calculations about minimum genome size irrelevant.

(2) There are actually two strands to every molecule of DNA, so the total amount of information is actually twice what hand jobby imagines. And yes, both strands can code for proteins and yes genes can be overlapping.

(3) Humans are diploid, so there is potentially twice as much genetic information as that found in a haploid chromosome set in every human cell. And don't forget mitochondrial DNA as well, that can be present in thousands of copies per cell.

(4) Single genes can be responsible for encoding many different proteins. Until you can account for this ability you are just blowing smoke in the wind.

(5) Humans don't develop from DNA alone, they develop from a fertilized cell. There is lots of information in the maternal cytoplasm, so any calculation must account for this.

Of course, even in the absence of all of this, hand jobby still has not provided any possible alternative, let alone any evidence, Until then, who cares?

Henry J · 24 September 2008

(2) There are actually two strands to every molecule of DNA,

I didn't think of that point; thanks for mentioning it.

(5) Humans don’t develop from DNA alone, they develop from a fertilized cell.

Yeah, the egg has proteins in it that were made using the mother's DNA. Henry

stevaroni · 24 September 2008

David S writes... (2) There are actually two strands to every molecule of DNA, so the total amount of information is actually twice what hand jobby imagines. And yes, both strands can code for proteins and yes genes can be overlapping.

That's kind of fascinating. I knew the coil "unzipped" and then it coded proteins against one strand. I realized that valid proteins might be found with either strand as the scaffold, but always figured that the "opposite" areas of the corresponding strand just came along for the ride and served to fill the space with whatever "inverse" pattern was needed. I never imagined that you'd get areas that overlapped function on both strands.

Science Avenger · 24 September 2008

jobby said: .... ID theory does not say it is 'God'.
Just in case any lurkers need to be told this... Intelligent Design was an attempt to hide creationism behind a sciency sounding veneer to get past the courts after the 1987 Edwards vs Aguilar case, where creationism was ruled religion, not to be taught in science classes. This is evidenced by the Wedge Document, google word counts that show a dramatic shift from "creationism" to "intelligent design" immediately following the Edwards ruling, and the dubious and highly embarrasing discovery, in the creationist-then-intelligent-design book "Of Pandas and People", of the curious phrase "cdesign proponentsists", the result of a haphazard substitution of "design proponents" for "creationism" in the book's text. "God" was likewise substituted with "the designer". About 99% of ID proponents are born again Christians, and no aspect of any of the ID work from prominent ID proponents has received critical acclaim from scientific peers in the areas of import. Mathematicians do not think highly of Dembski's math, and biologists do not think highly of Behe's biology. Conversely, none of the ID proposals and theories have had much of a ripple effect in any of the many areas of science on which they would have relevance (such as archaeology and forensics). References from other scientific work is paltry at best. It doesn't matter if the ID proponents say it is about God or not. It clearly is.

Wayne Francis · 24 September 2008

jobby said: But jobby is basically saying that without the finger of “God” a Zigote will never form into a fetus. ... I never said that. It seems that your simplistic mind says it has to be Darwinism or God. No other alternative. I do not subscribe to that primitive thinking. It could very well be a yet undiscovered natural cause. Your allegiance to Darwinism has stifled your thinking processes.
First....LEARN TO USE REPLY!!!! FFS it is a link right there at the top of the post you are "REPLYING" to. ok...not the 'finger of "God"' but "some" unknown thing that no one has any evidence of. Your suggestion that there is something other then DNA, that we have no evidence of, that is need to guide development of living organisms is no good. Just because you think DNA can't do it doesn't mean squat. Your hypothesis might as well say that '"God" did it' or 'pink invisible unicorns stand beside every living organism and mentally control every cell division via some unknown method that is also completely undetectable as of yet' You seem to think that the "Plan" for a species has to be some huge rigid thing and thus couldn't fit in a certain amount, in the case of humans 750meg, of data. The fact is it is your lack of understanding of biochemistry. You thing very procedurally it seems. It is much more flexible and adaptive then you think. Thus smaller amounts of information can result in "emergent properties" Remember life has had almost like 3.5 billion years to build up these programs. Yes there are outside forces at play. This is a very fruitful field of research called "epigenetics" but it is still interacting with the proteins produced by DNA to effect development. This is like when there is a iodine deficiency during development there is a very high chance that proper brain development does not occur. With genes we know 1 gene often has MANY different rolls in development. Many scientist study in great detail what genes are responsible for what features within organisms. While some attributes of an organism might be difficult to find out what genes contribute to that attribute as of yet I have not seen one single paper that says "Attribute X's development is not attributable to any expression of gene(s)". Scientists consistently perform knock out tests and see how removing even individual gene expression during specific developmental points can cause a change in the development. The biochemistry ultimately points to the fact that when you knock out said gene(s) in experiment X that reaction Y does not occur because of biochemical processes Z. Not once have scientist come back and said. Hey when we knocked out Gene(s) A reaction Y still seemed to occur even though biochemical processes Z isn't present. A good analogy is math Developmental biology equation as we know it is something like X + Y = Z Every math test scientist every preformed currently fits this formula Jobby comes along and say "Hey X isn't enough. There has to be something else to get to Z besides X & Y. I think the formula should be" X + Y + A = Z Jobby says "I don't know what A is. It seems to be 0 in EVERY test ever done. You scientists should look for it even though we've never seen any sign of it anywhere. " Scientist say "But 8 + 7 = 15, there is no need for another unknown variable" Jobby says "I don't understand simple math well enough and can't see how 8 + 7 = 15 so there must be something else" Comparing the byte size of any genome to a computer program has zero relevance. It is about as useful as comparing a quantum computer to a binary computer and saying that the quantum computer can't do what it does because it takes less processing to do something then the binary computer. The 2 work on COMPLETELY different principals. Development is the same way. It isn't a simple set of instructions to build a body plan. It is layers on layers on layers all effecting each other in subtle ways. Loosely organized these different processes not only produce primary goals but alternate goals. It might not seem intuitive to you but evolution doesn't care. Over 3.5 billion years these crazy interactions have tweaked themselves to cause very complex and diverse results via very simple processes. Let it be known this is more for the lurkers then Jobby that is intellectually bankrupt with his/her assertions.

David Stanton · 24 September 2008

Well, still no answer from hand jobby, big surprise. Here is something that is sure to exclude him from the conversation permanently, a scientific reference. If anyone is interested in overlapping genes here is an example from cetaceans:

Nuc. Acid Res. 30(13):2906-2910 (2000)

Of course it supports the close relationship of cetaceans to artiodactyls, another favorite subject that hand jobby loves to butcher. It really must be hard trying to argue with scientists when you really don't have a clue what you are talking about.

Wayne Francis · 24 September 2008

jobby said:
Wayne Francis said: The genetic “blue print” is so robust that the builders (Cells) can cope with unexpected changes like while building the spinal cord and finding there is not far away it can merge the 2.
... and all of this is done in 750 megs of instructions! Truly miraculous!
Again learn to use the "REPLY" link Not miraculous. Amazing and impressive yes but no miracle needed here. The biochemical processes are known. We can induce twinning in mice, we can observe the development of the zygotes and the effect of the 2 zygotes being in contact during development. It is because the genes and ultimately the DNA has a loose plan that conjoined twins occurs. The same biochemical signals that cause certain development to occur can get influenced by the same biochemical signals coming from another source, in this case another zygote. This is why conjoined twins are conjoined. Lets take a simple set of conjoined twins that are just joined by some epithelial tissue. The 2 zygotes are genetically identical. They are in physical contact with each other. When the epithelial cells are forming they sense the biochemical messages from the same type of cells from the other zygote and don't recognize it as a separate zygote thus it develops to merge the conecting cells. Think of it like 2 brick layers building 2 small buildings. They start laying down their bricks and everyone is happy. As they build the wall they find the 2 concrete slabs are actually touching. The 2 brick layers instead of making 2 separate, but very close buildings, actually join the 2 buildings into 1. The builders don't know the overall building shape before hand. They are just told to build the wall on the edge of the concrete slab. When they get to the point where the 2 slabs touch they view it as really 1 big slab. When the 2 builders meet they think they are building the same building and just merge their work. It is about as simple as that. See the brickies don't need to know the dimensions, shape of the slab. They just know "Build wall on edge of slab from 9am to 5pm". The shape of the slab was determined earlier, probably followed some simple rules too and the amount of time they build is determined by some other signaling process. This is why we see many of the birth defects we do. The amount of time that the signal to build X was messed up, to long or to short, or that maybe what it was building upon was also faulty. No miracles needed here but it is still impressive.

Wayne Francis · 24 September 2008

jobby said:
Dave Lovell said: Complex anatomies can simply be built by a looping a parameterised call to a genetic subroutine until the prescribed number of body segments has been built.
... big assumption. prove it! That's science.
Again learn to use "REPLY"!!!!! And did you miss the sentence right before the one you quoted? It has this GREAT thing called a hyperlink that points you.
Dave Lovell said: Did you see the recent article here on snake segmentation? ( http://pandasthumb.org/archives/200[…]gmentat.html ).
I puts it in great, easy to understand terms. If you want more proof just go to your local library and look up some articles in journals. There are tons of them. gene expression is fun for scientists to play with. One of my favorites experiments is where scientist that get flies to grow legs where their antenna should be. Its been proven. Because you want to remain ignorant is your choice.

Wayne Francis · 24 September 2008

eric said: Wayne, Very nice detailed post on encoding a message into DNA. But you're forgetting the larger context of the claim. If you want to leave a message for millions of years, there are far better media than DNA. [rest deleted] ...
Hi eric, I'll assume you skimmed over my post and missed
Wayne Francis said: All this said…I would not use DNA to send a message to the future…it is just to volatile and to hard to read. The records on Voyagers where a good way to communicate far into the future. There isn’t much info on the records but it is better then using DNA IMHO
We are saying the same thing.

Henry J · 24 September 2008

I knew the coil “unzipped” and then it coded proteins against one strand. I realized that valid proteins might be found with either strand as the scaffold, but always figured that the “opposite” areas of the corresponding strand just came along for the ride and served to fill the space with whatever “inverse” pattern was needed. I never imagined that you’d get areas that overlapped function on both strands.

That's how somebody can have two alleles for one gene, one from each parent. Sometimes the two copies are identical, sometimes they're not. When not, sometimes one allele is dominant and the other recessive (in which case the recessive one is unexpressed but might get passed on to progeny). Henry

Henry J · 24 September 2008

Lets take a simple set of conjoined twins that are just joined by some epithelial tissue. The 2 zygotes are genetically identical. They are in physical contact with each other. When the epithelial cells are forming they sense the biochemical messages from the same type of cells from the other zygote and don’t recognize it as a separate zygote thus it develops to merge the conecting cells.

So that's what happens to cause that? I'd always just assumed that the embryo just partially divided instead of entirely dividing. Didn't think of it being sort of an identity crisis occurring after the division. Henry

David Stanton · 24 September 2008

Henry,

Actually that was my point 3 which is distinct from point 2. So I guess, in a sense, there is potentially at least four times as much information in each human cell as hand jobby claims. What a shock.

Henry J · 24 September 2008

Another thought here - wouldn't that 3,000,000,000 total have been computed so as to already include all the strands?

Henry

Wayne Francis · 25 September 2008

Henry J said:

Lets take a simple set of conjoined twins that are just joined by some epithelial tissue. The 2 zygotes are genetically identical. They are in physical contact with each other. When the epithelial cells are forming they sense the biochemical messages from the same type of cells from the other zygote and don’t recognize it as a separate zygote thus it develops to merge the conecting cells.

So that's what happens to cause that? I'd always just assumed that the embryo just partially divided instead of entirely dividing. Didn't think of it being sort of an identity crisis occurring after the division. Henry
As I understand it both fission, what you said, and fusion, how I described it, can occur. I was trying keep it simple. Fusion twins probably have a higher survival rate then fission twins because the fusion can be much more superficial. The fission event is probably the cause of twins like Britney and Abby while Chang and Eng might well have been a product of later stage fusion. It has been a while but I think an autopsy found that they where actually only superficially connected and even back then could have been separated very easily with minimal risk to both twins. Fission twins are medically more interesting but the same processes effect development. It is just the types of stem cells that come into contact with each other. They sense the development around themselves and develop accordingly. unless you have some serious screwed up signals you won't get a tooth growing from your big toe, tho it is possible. All this study has great implications. Why do Gecko's regenerate limbs but humans don't. Why does a severed spinal cord in humans start repairing itself but then stop. Why can doctors now stimulate an adult to grow new teeth. It is all to do with these biochemical signals and processes that jobby think can't be accounted for within the currently understood framework.

Dave Lovell · 25 September 2008

Henry J said:

I knew the coil “unzipped” and then it coded proteins against one strand. I realized that valid proteins might be found with either strand as the scaffold, but always figured that the “opposite” areas of the corresponding strand just came along for the ride and served to fill the space with whatever “inverse” pattern was needed. I never imagined that you’d get areas that overlapped function on both strands.

That's how somebody can have two alleles for one gene, one from each parent. Sometimes the two copies are identical, sometimes they're not. When not, sometimes one allele is dominant and the other recessive (in which case the recessive one is unexpressed but might get passed on to progeny). Henry
I am not a biologist, this contradicts something I thought I understood. Are you not confusing chromosomes with DNA stands here?

Dave Lovell · 25 September 2008

Wayne Francis said:
after jobby said: Something
First....LEARN TO USE REPLY!!!! FFS it is a link right there at the top of the post you are "REPLYING" to.
You may underestimating him here. It seems to me that "Reply" posts are automatically flushed if the original if removed. His way each of his posts have to be removed separately

jobby · 25 September 2008

1. No, science requires more than just Popper’s falsifiability criteria.

... OK then what do you feel it requires??

jobby · 25 September 2008

So, um, Jobby, then your saying that biological development information is the same sort of thing as a big long string of computer code,

... I am not saying this. It is mainstream science. Of you might not accept science.

jobby · 25 September 2008

Seems to me that the amount of information to make a human might only require 1 byte of space TOTAL and thus our genome may well have 749.99999 MB of space left.

... I just love this one. Wow all the instructions for the human body plan, the physiology and behavior insturctions in one little byte. Truly truly miraculous.

And you think that feeding 50 people with a couple of fish and loaves is a miracle.

jobby · 25 September 2008

Your expert, Dr. Hugh Deasy says “human genes are coded in only about 1.5 % of our DNA - some 11.25 megabytes of ASCII.”

.... why is that wrong??

jobby · 25 September 2008

That we abandon all theories until someone can figure out exactly how much DNA is needed?

... when did I say that? Please stop the hyperbole. However we should not avoid researching that because it seems to conflict with Darwinism.

jobby · 25 September 2008

I am not a biologist, this contradicts something I thought I understood. Are you not confusing chromosomes with DNA stan

... this is typical of the level of understanding of biology and science here. Couldnt pass bio 101.

eric · 25 September 2008

I did miss that! Your post is even better the second time around :)
Wayne Francis said:
eric said: Wayne, Very nice detailed post on encoding a message into DNA. But you're forgetting the larger context of the claim. If you want to leave a message for millions of years, there are far better media than DNA. [rest deleted] ...
Hi eric, I'll assume you skimmed over my post and missed
Wayne Francis said: All this said…I would not use DNA to send a message to the future…it is just to volatile and to hard to read. The records on Voyagers where a good way to communicate far into the future. There isn’t much info on the records but it is better then using DNA IMHO
We are saying the same thing.

eric · 25 September 2008

Proposing an alternate hypothesis for testing. *Doing* experiments rather than waiting for someone else to do them for you. Subjecting both your methods and results to peer review. Not coincidentally, ID studiously avoids these parts of science because they open the alternate idea to critical assessment.
jobby said: 1. No, science requires more than just Popper’s falsifiability criteria. ... OK then what do you feel it requires??

Robin · 25 September 2008

jobby said: Seems to me that the amount of information to make a human might only require 1 byte of space TOTAL and thus our genome may well have 749.99999 MB of space left. ... I just love this one. Wow all the instructions for the human body plan, the physiology and behavior insturctions in one little byte. Truly truly miraculous. And you think that feeding 50 people with a couple of fish and loaves is a miracle.
Begging the question isn't any more creative or intelligent sounding the third or fourth time around, Bobbo. You can insist all you want that there's not enough space in the genome for the "information" to make a human, but until you have some objective evidence for the size of the "information", your claims are just so much fog. The fact is, the information could be 1 byte in size. You don't know, Jobo, so quit pretending that you know something that real scientists don't.

Robin · 25 September 2008

jobby said: That we abandon all theories until someone can figure out exactly how much DNA is needed? ... when did I say that? Please stop the hyperbole. However we should not avoid researching that because it seems to conflict with Darwinism.
Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development because it conflicts with the theory of evolution. Seeing as how I'm 99% certain you are just making claims out of your rear end (as usual) I won't hold my breath that you will present any evidence for such.

jobby · 25 September 2008

he fact is, the information could be 1 byte in size. You don’t know, Jobo, so quit pretending that you know something that real scientists don’t.

... one byte, one letter of the alphabet is enough info for even the design of a fingernail? you are totally ignorant.

jobby · 25 September 2008

*Doing* experiments rather than waiting for someone else to do them for you.

... what experiments have Darwinists done to validate their theory??

... please, please show me them

jobby · 25 September 2008

Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development.

.....feel free to post the names of real who are scientists who are studying the information space requirements for biological development.

eric · 25 September 2008

Many scientists are researching the connection between genetics and development. If you have a specific idea you want them to research, then the burden is on you to convince them its worthwhile. They are going to want details before they spend their money and time on it. The total detail you've given us is that you think aliens could have intervened at some undetermined time in the history of earth, and done something unspecified. And that something unspecified but not DNA contains information used to build humans. That's all And you wonder why people aren't studing your idea? Because your ideas are vague and content-free.
jobby said: That we abandon all theories until someone can figure out exactly how much DNA is needed? ... when did I say that? Please stop the hyperbole. However we should not avoid researching that because it seems to conflict with Darwinism.

eric · 25 September 2008

The Wong and Mi abstract discussed information required for development. You said you read it, right?
jobby said: Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development. .....feel free to post the names of real who are scientists who are studying the information space requirements for biological development.

David Stanton · 25 September 2008

So, with all the bluster and name calling, our good friend and constant source of amusement hand jobby has failed to even address one of my points. Well, here is a news flash for you hand jobby, you have to undeerstand all of the available mechanisms before you can say that they are inadequate. So come on troll, expalin RNA editing and alternative splicing for us.

Anyway, all of this is completely irrelevant. Hand jobby claimed that his stupid idea is somehow proof that Sarwin was wrong about something. Well Darwin didn't know anything about DNA let alone information requirements. How in the world does any of this have anything to to with Darwin?

jobby · 25 September 2008

Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development.

.....feel free to post the names of real who are scientists who are studying the information space requirements for biological development.

jobby · 25 September 2008

The Wong and Mi abstract discussed information required for development. You said you read it, right?

... have you read it?

stevaroni · 25 September 2008

me, yesterday, quoting jobby... Your expert, Dr. Hugh Deasy says “human genes are coded in only about 1.5 % of our DNA - some 11.25 megabytes of ASCII.”

. jobby, replying this morning... .… why is that wrong?? I have no clue. I was hoping that youwould tell me since you've been arguing vociferously against it for three days.

(comment 167226) The human genome consists of the equivalent of approximately 750 megabytes of data . This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

Apparently, you can add "short term memory loss" to the list of whatever else ails you.

jobby · 25 September 2008

stevaroni said:

me, yesterday, quoting jobby... Your expert, Dr. Hugh Deasy says “human genes are coded in only about 1.5 % of our DNA - some 11.25 megabytes of ASCII.”

. jobby, replying this morning... .… why is that wrong?? I have no clue. I was hoping that youwould tell me since you've been arguing vociferously against it for three days.

(comment 167226) The human genome consists of the equivalent of approximately 750 megabytes of data . This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

Apparently, you can add "short term memory loss" to the list of whatever else ails you.
You can add frontal lobe malfunction to YOUR list of ailments.

Henry J · 25 September 2008

Dave Lovell, September 25, 2008 5:40 AM I am not a biologist, this contradicts something I thought I understood. Are you not confusing chromosomes with DNA stands here?

That's a distinct possibility. Henry

stevaroni · 25 September 2008

You can add frontal lobe malfunction to YOUR list of ailments.

Jobby! You learned how to use "reply"! We're so proud of you, we knew you could do it! Maybe soon, you'll learn how to use "logic". Keep trying.

eric · 25 September 2008

jobby said: *Doing* experiments rather than waiting for someone else to do them for you. ... what experiments have Darwinists done to validate their theory?? ... please, please show me them
Its your theory we're discussing. I know of no biologist who claims DNA information space requirements aren't enough. You, Jobby make that claim. In fact you've made it repeatedly. In fact you referred to this claim yet again two minutes after writing the above post! In case you don't remember that either, here's what you said:
.….feel free to post the names of real who are scientists who are studying the information space requirements for biological development.
So you - and you alone, not us - are on the hook for studying information space requirements. Try and stay focused on the subject that you, in fact, brought up.
jobby said:T The Wong and Mi abstract discussed information required for development. You said you read it, right? … have you read it?
That wasn't the question. Answer my question, I'll answer yours in turn.

Robin · 25 September 2008

jobby said: he fact is, the information could be 1 byte in size. You don’t know, Jobo, so quit pretending that you know something that real scientists don’t. ... one byte, one letter of the alphabet is enough info for even the design of a fingernail? you are totally ignorant.
Translation: "I don't have a rebuttal so I'll just toss out the usual litany of insults and nonsensical statements."

Robin · 25 September 2008

jobby said: Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development. .....feel free to post the names of real who are scientists who are studying the information space requirements for biological development.
Translation: "I'll toss out a burden of proof fallacy because I don't have any evidence for my claim." Yaaawwwnn.

jobby · 25 September 2008

The Wong and Mi abstract discussed information required for development. You said you read it, right?

… have you read it?

typical. lazy and whats others to do the work!

jobby · 25 September 2008

know of no biologist who claims DNA information space requirements aren’t enough.

... and have there been studies to show that it IS enough??

oh I forgot. studies arent needed just FAITH!

Dave Lovell · 25 September 2008

jobby said: know of no biologist who claims DNA information space requirements aren’t enough. ... and have there been studies to show that it IS enough??
Such a study would be meaningless unless the mechanisms of the cell were completely understood, and then it would be unnecessary. For example, how much information do you think a very large mass of water would need to completely fill the world's oceans up to current sea level if it were poured onto a dry earth from space? Every little irregularity below the water surface would of course need to be filled perfectly

jobby · 25 September 2008

For example, how much information do you think a very large mass of water would need to completely fill the world’s oceans up to current sea level if it were poured onto a dry earth from space?

... this can be estimate.

stevaroni · 25 September 2008

know of no biologist who claims DNA information space requirements aren’t enough. … and have there been studies to show that it IS enough?? oh I forgot. studies arent needed just FAITH!

Oh, look, it's "backwards day" in Jobby's world. Again. Actually, it's always backwards say there, but I digress. Anyhow, the idea that DNA is insufficient, and that all of established science is wrong is you idea, lil' J, so you get to prove it. That's how it works. If the standard was good enough for Einstein, Galileo, Newton, Copernicus, Kepler, Maxwell, and Darwin, all of whom had radical ideas, and all of which were obliged to offer proof before they were taken seriously, it's good enough for you.

jobby · 25 September 2008

stevaroni said:

know of no biologist who claims DNA information space requirements aren’t enough. … and have there been studies to show that it IS enough?? oh I forgot. studies arent needed just FAITH!

Oh, look, it's "backwards day" in Jobby's world. Again. Actually, it's always backwards say there, but I digress. Anyhow, the idea that DNA is insufficient, and that all of established science is wrong is you idea, lil' J, so you get to prove it. That's how it works. If the standard was good enough for Einstein, Galileo, Newton, Copernicus, Kepler, Maxwell, and Darwin, all of whom had radical ideas, and all of which were obliged to offer proof before they were taken seriously, it's good enough for you.
Where is the proof that there is enough info in the DNA?

CJO · 25 September 2008

The creobot is trying to solve the halting problem, experientially. Could be awhile.

Dave Lovell · 25 September 2008

jobby said: For example, how much information do you think a very large mass of water would need to completely fill the world’s oceans up to current sea level if it were poured onto a dry earth from space? ... this can be estimate.
Have a try then. If your estimate is not zero, please show your workings

Robin · 25 September 2008

jobby said:
stevaroni said:

know of no biologist who claims DNA information space requirements aren’t enough. … and have there been studies to show that it IS enough?? oh I forgot. studies arent needed just FAITH!

Oh, look, it's "backwards day" in Jobby's world. Again. Actually, it's always backwards say there, but I digress. Anyhow, the idea that DNA is insufficient, and that all of established science is wrong is you idea, lil' J, so you get to prove it. That's how it works. If the standard was good enough for Einstein, Galileo, Newton, Copernicus, Kepler, Maxwell, and Darwin, all of whom had radical ideas, and all of which were obliged to offer proof before they were taken seriously, it's good enough for you.
Where is the proof that there is enough info in the DNA?
Gee Jobo, repeating a question that was just shot down really doesn't strengthen your argument. To wit:
stevaroni said: Anyhow, the idea that DNA is insufficient, and that all of established science is wrong is your idea, lil' J, so you get to prove it.
In otherwords, jobo, we are ignoring your burden of proof fallacy.

jobby · 25 September 2008

Anyhow, the idea that DNA is sufficient is a concept which has not been proven.

And in science we need PROOF not FAITH

stevaroni · 25 September 2008

Anyhow, the idea that DNA is sufficient is a concept which has not been proven. And in science we need PROOF not FAITH

Why, yes, yes we do Lil' J. Since it's your idea, you get to prove it. If that rule was good enough for Newton, it's good enough for you. Better get crackin' there, J. Time's a wastin'.

stevaroni · 25 September 2008

Anyhow, the idea that DNA is sufficient is a concept which has not been proven.

By the way. Lil J, the expert that you yourself quoted, said it is. he says it in a quote you posted.

comment 167368 (from jobby) Dr. Hugh Deasy: "The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA "

Your guy, the one you quoted, say's that you are wrong. He say's there's plently of leftover space. In your fit of cut-and-paste extacy did you not even bother to stop and read what you were spouting??? Not only don't you know how to reason cogently, you haven't even mastered the simplest of ID troll skills yet. You have actually failed at quotemining! Somewhere, under a foggy bridge in Norway, a grizzled old master troll is hanging his head in shame, wondering how the kids today could have gone so terribly, terribly, wrong.

Robin · 25 September 2008

stevaroni said:

Anyhow, the idea that DNA is sufficient is a concept which has not been proven.

By the way. Lil J, the expert that you yourself quoted, said it is. he says it in a quote you posted.

comment 167368 (from jobby) Dr. Hugh Deasy: "The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA "

Your guy, the one you quoted, say's that you are wrong. He say's there's plently of leftover space. In your fit of cut-and-paste extacy did you not even bother to stop and read what you were spouting??? Not only don't you know how to reason cogently, you haven't even mastered the simplest of ID troll skills yet. You have actually failed at quotemining! Somewhere, under a foggy bridge in Norway, a grizzled old master troll is hanging his head in shame, wondering how the kids today could have gone so terribly, terribly, wrong.
Even beyond Jobo's idiocy in not understanding the quote he posted, the fact is from a scientific standpoint no proof that DNA has sufficient storage capacity is needed or for that matter cared about. Science can only disprove an incorrect explanation; it cannot prove an explanation is true. So Jobo's complaint is just a red herring.

jobby · 25 September 2008

Dave Lovell said:
jobby said: For example, how much information do you think a very large mass of water would need to completely fill the world’s oceans up to current sea level if it were poured onto a dry earth from space? ... this can be estimate.
Have a try then. If your estimate is not zero, please show your workings
This is a simple calculation. If you dont know how to do it you should go back to 8th grade.

jobby · 25 September 2008

Your guy, the one you quoted, say’s that you are wrong. He say’s there’s plently of leftover space.

.........Read it you numskull. Thats not what he said.

jobby · 25 September 2008

the fact is from a scientific standpoint no proof that DNA has sufficient storage capacity is needed or for that matter cared about. Science can only disprove an incorrect explanation;

..OK prove that the assertion that DNA does not have sufficient space is incorrect.

jobby · 25 September 2008

Even beyond Jobo’s idiocy in not understanding the quote he posted, the fact is from a scientific standpoint no proof that DNA has sufficient storage capacity is needed or for that matter cared about.

... All coming from a person who thinks that one byte of info can direct the body plan of a human. hahahaha bwahahah hahaha

that is REALLY STUPID!!

stevaroni · 25 September 2008

Lil' J rants... ..OK prove that the assertion that DNA does not have sufficient space is incorrect.

Um, Jobster, that's the side your're supposed to be arguing bro. I know, this trolling stuff is a bit confusing, so I'll spot you the game plan, because you seem a little flustered. See, you're the one arguing that DNA does not have sufficient space, and somehow extra information comes out of the quantum foam or something. Got it? OK, now, stick with me here, we're the ones that are working with the assumption that DNA does have enough space, in part, because your expert, Dr Deasey, says so. Does that make sense? Good. I know, it's tough keeping your rants straight, with all these pesky facts flying around, you can do it if you just try. Alright, now that we got that all straightened out, back to our normal program.... Jobby - You're an idiot.

jobby · 25 September 2008

stevaroni said:

Lil' J rants... ..OK prove that the assertion that DNA does not have sufficient space is incorrect.

Um, Jobster, that's the side your're supposed to be arguing bro. I know, this trolling stuff is a bit confusing, so I'll spot you the game plan, because you seem a little flustered. See, you're the one arguing that DNA does not have sufficient space, and somehow extra information comes out of the quantum foam or something. Got it? OK, now, stick with me here, we're the ones that are working with the assumption that DNA does have enough space, in part, because your expert, Dr Deasey, says so. Does that make sense? Good. I know, it's tough keeping your rants straight, with all these pesky facts flying around, you can do it if you just try. Alright, now that we got that all straightened out, back to our normal program.... Jobby - You're an idiot.
Youre a dummy: How do we know the DNA has enough space, imbecile??

jobby · 25 September 2008

OK, now, stick with me here, we’re the ones that are working with the assumption that DNA does have enough space, in part, because your expert, Dr Deasey, says so.

Deasey never 'said so' dummy. learn to read.

So we are supposed to accept the fact that DNA has enough space on FAITH??

David Stanton · 25 September 2008

Three days now and poor little hand jobby still can't find an example of even one little protein that isn't coded in the human genome that is necessary for human development. Oh well, who cares? He also failed to address the other twelve points that I made that completely invalidate all his nonsense.

And of course, still not one word about how any of this relates to Darwin (that was the original claim) and not one word about the immune system.

stevaroni · 25 September 2008

Lil' J! You're back on your side of the argument. I'm quite relieved, since I'm pretty sure that if I had to argue the ID side, my head would explode.

Deasey never ‘said so’ dummy. learn to read.

And polite as ever! I did. I started with reading this...

comment 167368 (from jobby) Dr. Hugh Deasy: “The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA “

I'm just a product of the American public school system, but that seems to fulfill the requirements of "said so" for me. Especially since you're the one vouching for him. Um, hey, maybe you didn't mean to do this, would you like to retract your previous comments? I'll give you a Mulligan if you need one.

jobby · 25 September 2008

Dr. Hugh Deasy: “The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA “

... dummy, did you read the article??

jobby · 25 September 2008

David Stanton said: Three days now and poor little hand jobby still can't find an example of even one little protein that isn't coded in the human genome that is necessary for human development. Oh well, who cares? He also failed to address the other twelve points that I made that completely invalidate all his nonsense. And of course, still not one word about how any of this relates to Darwin (that was the original claim) and not one word about the immune system.
So we are supposed to accept the fact that DNA has enough space on FAITH??

jobby · 25 September 2008

stevaroni said: Lil' J! You're back on your side of the argument. I'm quite relieved, since I'm pretty sure that if I had to argue the ID side, my head would explode.

Deasey never ‘said so’ dummy. learn to read.

And polite as ever! I did. I started with reading this...

comment 167368 (from jobby) Dr. Hugh Deasy: “The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA “

I'm just a product of the American public school system, but that seems to fulfill the requirements of "said so" for me. Especially since you're the one vouching for him. Um, hey, maybe you didn't mean to do this, would you like to retract your previous comments? I'll give you a Mulligan if you need one.
Deasey: Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.

David Stanton · 25 September 2008

Hand jobby wrote:

"So we are supposed to accept the fact that DNA has enough space on FAITH??"

No. If you had read any of my posts you would realize that:

1) The burden of proof is on you to prove that your hypothesis is correct. The assumption that there is enough DNA to account for human development is the default value in this discussion. This assumption is based on evidence and experience, no faith is involved. (By the way, do other organisms have enough information or is it only humans who don't)?

2) You have no idea how much information is needed to make a human being. All you have is lack of imagination and "one suspects". Well many suspect that what the one suspects is suspect. Until you have a calculation with explicit assumptions you as just making stuff up.

3) There is a lot more information storage capacity in a human genome than you have calculated.

4) There are many genetic mechanisms that render your calculation irrelevant. You have not demonstrated that you understand any of these mechanisms, nor have you incorporated them into you "calculations".

In short jobby boy, there is absolutely no reason for anyone to take you seriously. Go figure. Now, do you have an example of a protein yet or not? If not, go away and don't come back.

stevaroni · 25 September 2008

jobby sez.. Deasey: Thus the final total will almost certainly be still below 15 megabytes.

Help me out here jobby. You do realize that 15 megabytes is less than 700 megabytes, right. Help me out with this, because I'm a little baffled. You're arguing that the genome isn't possibly big enough to do the job because once you total up the "required" information, you've got a lot of empty space left over? Because that's the only part of that whole clip where your "expert" actually uses a hard data point. The rest is, well, ahem,let's just call it, conveniently vague, Lil' J.

On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.

Hmmm, "seems", "suspects", "might". Yeah, that's an airtight case. I haven't seen conclusive evidence like that since I went over Dembski's unspecified impossibility filter. Come back when you manage to measure a couple of those "seems" of this, Lil' J. That's how we do it in the adult world. After all, that's what you've been demanding for 5 days now, right? Proof. Come back when you have some, troll.

jobby · 25 September 2008

The point is that most scientists believe the DNA contains about 800 megabytes. About as much as the average CD.

Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

Remember the average bio 101 textbook is around 800 megabytes.

David Stanton · 25 September 2008

Hand jobby,

How do you know that 800 megabytes is not enough? Are we supposed to take it on FAITH???

Anyway, you first claimed that it was 750. Now you claim 800. Which is it? Why should anyone believe you when you keep changing your mind?

I suspect that a recipe as big as a biology textbook would allow you to make quite a cake.

Got an example of a protein yet? Have you considered any of the other mechanisms involved yet? Got any reasoin to take you seriously yet?

jobby · 25 September 2008

jobby said: The point is that most scientists believe the DNA contains about 800 megabytes. About as much as the average CD. Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Remember the average bio 101 textbook is around 800 megabytes.
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

jobby · 25 September 2008

I suspect that a recipe as big as a biology textbook would allow you to make quite a cake.

.. and the intro text book only describes the basics of biology. just imaging how large a book would have to be to explain how to construct a human. terabytes at the minimum

The DNA simply does not have the capacity

jobby · 25 September 2008

well observers what do you think:

Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

My answer is a definite no.

Why can't any other poster state an educated guess on this?

Science Avenger · 25 September 2008

jobby said: well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no.
Why should anyone care?

David Stanton · 25 September 2008

Can a bumble bee fly? Anyone care to hazard a guess? Hand jobby votes no apparently.

David Stanton · 25 September 2008

HAnd jobby,

Is "all" of your behavior coded in your DNA? If so, then perhaps you have some excuse.

Wayne Francis · 25 September 2008

jobby said:
stevaroni said: Lil' J! You're back on your side of the argument. I'm quite relieved, since I'm pretty sure that if I had to argue the ID side, my head would explode.

Deasey never ‘said so’ dummy. learn to read.

And polite as ever! I did. I started with reading this...

comment 167368 (from jobby) Dr. Hugh Deasy: “The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA “

I'm just a product of the American public school system, but that seems to fulfill the requirements of "said so" for me. Especially since you're the one vouching for him. Um, hey, maybe you didn't mean to do this, would you like to retract your previous comments? I'll give you a Mulligan if you need one.
Deasey: Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.
You just don't get it. First don't confuse biochemical processes with binary code. As complex as some binary code is out there it does not come, within any order of magnitude, close to the ability of biochemical processes controlled by genetics. But don't think that complex results require complex instructions. Fractals are a good example, very complex pictures can come out of very simple instructions. Developmental biology is analogous to a lossy compression, but much higher then anything we produce right now. Why? Life has had 3.5 billion years to learn how to efficiently compress into DNA. Life accepts, and really requires, the compression of this information to be lossy for evolution to work. DNA isn't binary Code. DNA isn't binary data. DNA is a code and data. 1 gene can be coopted for many different functions withing both development and normal living processes. It would be like a code base being used. You come along and write a bit of code (A) to do (X) but 6 months down the track some other coder piggy backs onto your code and uses your code to drive his/her code or maybe even has code that injects data into your code to alter how it works. Genetic code is essentially the best self modifying code out there. It's design isn't limited to how humans think about things. It's design is just guided by trying to keep what works and what doesn't most often gets thrown away (individual dies/does not reproduce effectively) Comparing Genetic Code to Binary Code is just as bad as comparing Binary Code to Quantum Code. The 2 aren't even apples and oranges it is like a gentle breeze and the standard model of physics. Sure a breeze effects things and it can take a lot of complex work to get a breeze to do what you want but the stand model of physics pretty much explains everything we see in the universe today with some fairly simple rules. Oh here is a link for you to not read that talks about some well understood developmental biology that you seem to think can't happen http://scienceblogs.com/pharyngula/2006/07/transcription_factors_and_morp.php

Wayne Francis · 25 September 2008

jobby said:
jobby said: The point is that most scientists believe the DNA contains about 800 megabytes. About as much as the average CD. Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Remember the average bio 101 textbook is around 800 megabytes.
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
You are replying to yourself ... and only repeating something in the post you replied to? 1st you don't seem to realize that that scientist you keep quoting does not have a problem with the less than "15Mb" of DNA to make a human. 2nd You don't seem to realize that none of the creo/idiot scientist think that there isn't enough information in the DNA of a individual of a species to develop from a zygote to a full grown member given the appropriate material (food, water, etc). You keep telling people they have reading comprehension problems but it is you that have the comprehension problem. You misunderstand a very straight forward statement and inject your own assumptions on a statement and when it is pointed out to you, over and over, you ignore it and keep rambling on and on. Also let it be known that DNA doesn't have to account for the brain/mind complexity. We are finding out more about this every day but the fact is brain/mind has a lot to do with environment. Everything isn't reduced to DNA. Identical twins separated at birth and exposed to very different living environments will continue to develop in very different ways and in many cases producing very different minds and brains. Some personality traits might have genetic origins but genetics is far from the final decider on personality traits and I don't know any scientist that says it is. Like the identical twins finger prints. They are not identical. This feature is highly influenced by the environment. While fingerprints are a product of genetics it is not the only factor. In fact there are some interesting findings coming out like by examining fingerprints you can help in diagnosing some diseases because those diseases are genetic in origin and the same genetic defects that cause the disease also effect the development of epidermal ridges (ie fingerprints) perhaps you should either shut up or make sure you understand what you read before you misinterpret what you've read...or in your case claim to have read.

Wayne Francis · 25 September 2008

jobby said: The point is that most scientists believe the DNA contains about 800 megabytes. About as much as the average CD. Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Remember the average bio 101 textbook is around 800 megabytes.
yes with some caveats on the "All the behavior" that I've already discussed. Hell I'm happy with the 15Mb for the most part. I do think we'll find more function within "Junk DNA" but I don't see any problem with trimming a lot of the human genome and still having viable humans. Who cares how much info is needed to store the average bio 101 textbook. Take that same 800 meg and find a good suitable lossy compression mechanism that has been developed over 3.5 billion years and let that same compression mechanism take 3.5 billion years to compress the book and I'm quiet sure that the book would end up orders of magnitude smaller then the orignal. Of course we would not be able to read it in its compressed format very well. Just like we are not that good at reading DNA. We are much better at reading the proteins produced from genes (aka uncompressed genetics) but even then the analogy of a book and reading breaks down because we, westerners, read right to left and top to bottom of a page. When reading genetics you have to read in multiple dimensions at the same time. It would be like reading the story of everyone in a small town at the same time. This is why scientist focus in on one or a few genes and their effects. They ignore "Joe" who is across town a work and has little to no effect on the baseball game the scientists are watching. I'm sure this is another analogy that is lost on you but most of the lurkers will understand it just fine.

stevaroni · 26 September 2008

The thing is jobby is hung up on is that he's conflating the final product, which can be very complicated, and the process that creates it.

THe complexity of the two are not necessarily related. For instance, check out this picture, and tell me how much information is in it.

http://upload.wikimedia.org/wikipedia/commons/3/37/Mandel_zoom_14_satellite_julia_island.jpg

At first guess, you'd probably say a lot. The image is 2,560 × 1,920 pixels, the full file size is 4.93 MB, it's big even as a jpeg. But even if you said that, you'd still be dramatically underestimating it's complexity, because it's actually infinitely intricate.

Complicated, huh?

Not really. For those who are unfamiliar with it, it's a function called a "Mandlebrot Set", and it can be created with one equation.

That one equation can be expressed in about 30 characters.

Now, that's "data compression".

So, Jobby, Google "fractal" and learn something.

And before you start spouting about the fact that equations need to be executed before you see the results, well, so do genes.

tresmal · 26 September 2008

jobby · 26 September 2008

1st you don’t seem to realize that that scientist you keep quoting does not have a problem with the less than “15Mb” of DNA to make a human.

... wrong!

Deasey:

Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.

jobby · 26 September 2008

1st you don’t seem to realize that that scientist you keep quoting does not have a problem with the less than “15Mb” of DNA to make a human.

... wrong!

Deasey:

Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.

cobby · 26 September 2008

1st you don’t seem to realize that that scientist you keep quoting does not have a problem with the less than “15Mb” of DNA to make a human.

... wrong!

Deasey:

Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.

cccccc · 26 September 2008

1st you don’t seem to realize that that scientist you keep quoting does not have a problem with the less than “15Mb” of DNA to make a human.

... wrong!

Deasey:

Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.

jobby · 26 September 2008

At first guess, you’d probably say a lot. The image is 2,560 × 1,920 pixels, the full file size is 4.93 MB, it’s big even as a jpeg. But even if you said that, you’d still be dramatically underestimating it’s complexity, because it’s actually infinitely intricate.

Complicated, huh?

Not really. For those who are unfamiliar with it, it’s a function called a “Mandlebrot Set”, and it can be created with one equation.

... DUH of course! I can write a program 2 lines:

10. print random number
20 go to to

that will print an infinite series of numbers. but you forgot to enter the complexity of the compiler that interprets the code. and the complexity of the hardware that translates your mandlebrot code into a computers screen. very, very complex and could not evolve.

jobby · 26 September 2008

I’m quiet sure that the book would end up orders of magnitude smaller then the orignal.

... there is limit to how far info can be compressed

you never answered:

Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

Why cant you just say yes or no?

I said no. I am forthcoming and not a coward to make a claim.

Obviously you are neither

jobby · 26 September 2008

We are finding out more about this every day but the fact is brain/mind has a lot to do with environment.

... wrong again
Deasy:

Take for example a new born gazelle - it is able to walk and then run within minutes of being born, a skill needed to flee prowling lions. Yet such skill requires sophisticated software, certainly many megabytes in size, to run on the latest robots from Honda or Soni. So the gazelle must have the equivalent of this sophisticated software, but if its genome is only tens of megabytes, then can it all come from the genes while allowing enough data to form the muscles and other bodily components? Can its neural network learn quickly enough to flee a charging lion? The latter is negated for example by the observations of a horse owner friend: "I can't remember how long it takes a foal to run after it's been born, but I think it stands up immediately after birth while the mother cleans it. It doesn't copy other running animals - in the case of the foal sired by our stallion, it was not just trotting an hour after being born, it was racing around the field with its body at an angle of about 45 degrees as it went round corners. In other words this is all wired in, like young cats' ability to see."

jobby · 26 September 2008

Deasy:

But since the Human Genome Project completed in 2003, we know that there are only 22,000 genes corresponding to about 10 megabytes of data. But this data is scarcely sufficient to specify the complexity of the 200 different types of cell in the body, it's 12 or more physiological subsystems and all the (rough) structure of the brain. That is true even if the non-coding RNA is considered to have a control function

Science Avenger · 26 September 2008

jobby said: but you forgot to enter the complexity of the compiler that interprets the code. and the complexity of the hardware that translates your mandlebrot code into a computers screen. very, very complex and could not evolve.
BZZZZT!!! Sorry, that's the same crap as the "you designed the experiment with your intelligence so it really supports intelligent design" nonsense. It's just another case of goalpost moving.

jobby · 26 September 2008

Science Avenger said:
jobby said: well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no.
Why should anyone care?
YOU seem to care quite a bit about what I post here. You cannot stop yourself from responding to each and everyone of my posts.

Dave Lovell · 26 September 2008

In an attept to enlighten jobby on the futility trying to estimate the requirements of a system you don't understand, Dave Lovell asked: For example, how much information do you think a very large mass of water would need to completely fill the world’s oceans up to current sea level if it were poured onto a dry earth from space? jobby replied : ... this can be estimate. Dave Lovell then asked: Have a try then. If your estimate is not zero, please show your workings jobby replied : This is a simple calculation. If you dont know how to do it you should go back to 8th grade.
But I do know how to do it It is a Kindergarten physics calculation, and the answer is ZERO. The water will perfectly fit every atom sized nook and cranny without a single bit of added information. This would seem miraculous to somebody who did not understand the behaviour of fluids under gravity. However, to exactly specify the shape of the resulting mass of water to atomic resolution would require a litte more information. As an order of magnitude calculation, the world is 40,000,000 metres around, and there are about 10^10 atoms per metre (4x10^17). The surface has two dimensions, so square this to get 1.6x10^35. Using polar coordinates to specify the position of each point on the surface to an atomic resolution requires 112 bits per point in ASCII, so say 1.6*10^37. Adding an average of a metre of sediment or porous rock will increase this by another 10^14 to specify the shape between the grains. Can you comprehend how large 10^51 is? Does every raindrop that falls have this much information encoded into it so it knows where to go? As for your Deasey quote, does his next paragraph begin with "But" or "However" by any chance?

Robin · 26 September 2008

jobby said: the fact is from a scientific standpoint no proof that DNA has sufficient storage capacity is needed or for that matter cared about. Science can only disprove an incorrect explanation; ..OK prove that the assertion that DNA does not have sufficient space is incorrect.
Burden of proof fallacy and a strawman. There's no need for me to chase such absurd red herrings. It's your claim, Bobjob - your burden to prove.

jobby · 26 September 2008

BZZZZT!!! Sorry, that’s the same crap as the “you designed the experiment with your intelligence so it really supports intelligent design” nonsense. It’s just another case of goalpost moving.

... do you feel that a computer program can produce output with out a complier for the program and hardware?

jobby · 26 September 2008

you never answered:

Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

Why cant you just say yes or no?

I said no. I am forthcoming and not a coward to make a claim.

Obviously you are neither

Robin · 26 September 2008

jobby said: Even beyond Jobo’s idiocy in not understanding the quote he posted, the fact is from a scientific standpoint no proof that DNA has sufficient storage capacity is needed or for that matter cared about. ... All coming from a person who thinks that one byte of info can direct the body plan of a human. hahahaha bwahahah hahaha that is REALLY STUPID!!
Translation: "I have no clue of what I speak so I'm just going to toss out more insults." Yaaaawwwnn... Oh and btw...I'd really appreciate it if you wouldn't attribute statements to me that I didn't make. I won't say you're lying because it is quite evident you didn't understand what I previously wrote, but then you shouldn't make up what you think I said since it demonstrates that you are wrong.

Robin · 26 September 2008

jobby said: Deasey never 'said so' dummy. learn to read.
LOL! Deasey did say so. Learn to read.

Robin · 26 September 2008

jobby said:
stevaroni said: Lil' J! You're back on your side of the argument. I'm quite relieved, since I'm pretty sure that if I had to argue the ID side, my head would explode.

Deasey never ‘said so’ dummy. learn to read.

And polite as ever! I did. I started with reading this...

comment 167368 (from jobby) Dr. Hugh Deasy: “The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA “

I'm just a product of the American public school system, but that seems to fulfill the requirements of "said so" for me. Especially since you're the one vouching for him. Um, hey, maybe you didn't mean to do this, would you like to retract your previous comments? I'll give you a Mulligan if you need one.
Deasey: Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.
Gee...and here I thought we were all highly inefficient PCs running inefficient code that requires inefficient magnetic and electronic storage space...Oh wait, you mean the genome doesn't work like a PC's harddrives? Oh...what a relief!

Robin · 26 September 2008

jobby said: The point is that most scientists believe the DNA contains about 800 megabytes. About as much as the average CD. Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Remember the average bio 101 textbook is around 800 megabytes.
Bobjob...you still don't get it. Unless the human genome is storing "data" in the same format as a computer, 800 MB doesn't tell you ANYTHING. What is the size of an individual piece of data in the human genome? Unless you can show the size of a piece of data, there is nothing to consider. You are assuming that data in the genome is analogous to data in a computer, but that isn't scientific or logical. There's no reason to assume such. A piece of "data" could very well be only a few atoms in total volume, in which case 800 MB would be more than plenty of space. Your whole argument is nothing but question begging.

Robin · 26 September 2008

jobby said: well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no. Why can't any other poster state an educated guess on this?
Because you haven't provided any relevant information.

Robin · 26 September 2008

jobby said: I said no. I am forthcoming and not a coward to make a claim.
The only thing such demonstrates is that you are obviously not scientist or a logical and educated individual but rather just a speculative, linear-thinking individual who really has no clue what he's talking about.

fnxtr · 26 September 2008

Well, Yobbo, since you make the claim that there must be something else -- though you're very careful never to state clearly what that something else might be, it is nevertheless up to you to find it. All this whining to the effect of "why doesn't somebody do want I want them to" is not going to change anything. DIY.

fnxtr · 26 September 2008

...what I want them to...

for better comprehension. Morning fingers.

jobby · 26 September 2008

The only thing such demonstrates is that you are obviously not scientist or a logical and educated individual but rather just a speculative, linear-thinking individual who really has no clue what he’s talking about.

... Well unlike you I do not think that all the human anatomy could be constructed with ONE BYTE OF INFORMATION!

hahaha! bwahahaha haha!

Science Avenger · 26 September 2008

jobby said: YOU seem to care quite a bit about what I post here. You cannot stop yourself from responding to each and everyone of my posts.
I care about lurkers being misled by your dishonest drivel, character or no, but neither I, nor doubtless anyone here, cares what you think, since you clearly have no idea what you are talking about and make shit up as you go. But you do project well. It is you who have lastworditis and can't stop yourself from responding to each and every one of your critics' posts, except of course the ones that nail you to the wall, like my challenge to you to identify the supposed frontloading you claimed was in my dice simulator. Those posts you run from like the plague.

jobby · 26 September 2008

Well, Yobbo, since you make the claim that there must be something else – though you’re very careful never to state clearly what that something else might be

... no wrong again:

The curiosity for a planet beyond Neptune began with a man named Percival Lowell, who believed that there exists a "Planet X" somewhere in the outer reaches of our solar system, based on calculations done with the study of the motions of Uranus and Neptune.

.... many times discoveries were made simply because they knew something was there but not knowing what. that is science. not putting your head in the sand.

jobby · 26 September 2008

can’t stop yourself from responding to each and every one of your critics’ posts, except of course the ones that nail you to the wall, like my challenge to you to identify the supposed frontloading you claimed was in my dice simulator. Those posts you run from like the plague.

.... altho there is high demand for my responses I have other duties and avocations which insist on my time. so I cannot respond to all of them. sorry.

jobby · 26 September 2008

You are assuming that data in the genome is analogous to data in a computer, but that isn’t scientific or logical.

... wrong again. a byte or bit of data is a universal concept regardless of the media. hash marks on a cell wall being each one bit of data. and each byte in the Mayan math system being 20 bits. these are univeral concepts

Science Avenger · 26 September 2008

jobby said: ... Well unlike you I do not think that all the human anatomy could be constructed with ONE BYTE OF INFORMATION! hahaha! bwahahaha haha!
Why should anyone place the slightest bit of credibility on what you think? You think you get to substitute "god" into anything you don't personally understand, which sadly, is quite a bit. You also have never, as all ID proponents have never, explained exactly what measure of information you are applying to human genetics. It's just a word you toss around to attempt to sound smart - sort of like "front loading".

jobby · 26 September 2008

ou think you get to substitute “god” into anything you don’t personally understand, which sadly, is quite a bit.

... I never have since I am an agnostic.

Stanton · 26 September 2008

jobby said: .... many times discoveries were made simply because they knew something was there but not knowing what. that is science. not putting your head in the sand.
Then, how come you demand that we stop accepting the fact that DNA codes for all of the proteins and RNA products that either build, or are used to manufacture products used to build living organisms, while you have not proposed an alternative explanation? Then if DNA is not used to initiate the processes starting protein synthesis, what do you think does initiate it?

jobby · 26 September 2008

You also have never, as all Darwinism proponents have never, explained exactly what measure of information you are applying to human genetics.

Stanton · 26 September 2008

Stanton said: Then if DNA is not used to initiate the processes starting protein synthesis, what do you think does initiate it?
And, more importantly, what experimental proof do you have that supports your claims?

Science Avenger · 26 September 2008

jobby said: .... altho there is high demand for my responses I have other duties and avocations which insist on my time. so I cannot respond to all of them. sorry.
That lame bullshit again? You spend pages typing bullshit, but you conviently don't respond to the posts that prove you wrong. It would have taken less time to point out the frontloading than you've taken to dodge the question by an order of magnitude. Your character is a little obvious here, you should work on something more credible. No one but a bratty 12-year-old would try the old "I don't have time" dodge whilst simultaneously spending a lot of time on dodges. Colbert you ain't.

Science Avenger · 26 September 2008

jobby said: The curiosity for a planet beyond Neptune began with a man named Percival Lowell, who believed that there exists a "Planet X" somewhere in the outer reaches of our solar system, based on calculations done with the study of the motions of Uranus and Neptune. .... many times discoveries were made simply because they knew something was there but not knowing what. that is science. not putting your head in the sand.
Yes, but Lowell said "there is a planet, of mass X, at such-and-such location". Such detail is consistently missing from your's and the rest of the IDers dishonest creationist blather.

Science Avenger · 26 September 2008

jobby said: ou think you get to substitute “god” into anything you don’t personally understand, which sadly, is quite a bit. ... I never have since I am an agnostic.
You're a liar.

Science Avenger · 26 September 2008

jobby said: You also have never, as all Darwinism proponents have never, explained exactly what measure of information you are applying to human genetics.
Idiot, we're not the ones making claims based on information. YOU keep talking about information, so it is YOU that have to define it. How pathetic and transparent that you are reduced to parroting our criticisms back at us, even when it makes no sense to do so. You really aren't very good at this.

Robin · 26 September 2008

jobby said: The only thing such demonstrates is that you are obviously not scientist or a logical and educated individual but rather just a speculative, linear-thinking individual who really has no clue what he’s talking about. ... Well unlike you I do not think that all the human anatomy could be constructed with ONE BYTE OF INFORMATION! hahaha! bwahahaha haha!
There you go again, attributing statements to me that I didn't make. Clearly if you can't understand what I wrote, there's no way you can understand genome science or anything about biology for that matter. Of course the loony laugh is also a pretty good indicator of your mental capability...

stevaroni · 26 September 2008

jobby: but you forgot to enter the complexity of the compiler that interprets the code. and the complexity of the hardware that translates your mandlebrot code into a computers screen. very, very complex and could not evolve.

Two points here, Lil' J. First, regardless of how complex the computer code if you produce an infinite series of numbers, eventually you amortize the code's share of the complexity to zero. Secondly, in the case of DNA, we do know a lot about the "complexity of the compiler that interprets the code", because we can observe it directly. And it's substantially simpler than any computer program ever written because it does not require a processor, or compiler, and it's operating system is a testube full of wet chemistry. In DNA, the gene forms a physical framework upon which a protein assembles itself as a mirror image. We can observe the process, and there is apparently little intervention required past having some enzymes in the general area. Not exactly ice cubes forming in an ice cube tray, but that's not a bad model. Please explain exactly what aspects of the chemical process you feel are irredeemably complicated. (Lurkers: I know, of course, that he won't actually answer the question, he'll just wave his hands and say "too complicated", but it's important to ask. If nothing else, his constant evasion speaks volumes more than any actual answer he's likely to provide)

Robin · 26 September 2008

jobby said: Well, Yobbo, since you make the claim that there must be something else – though you’re very careful never to state clearly what that something else might be ... no wrong again: The curiosity for a planet beyond Neptune began with a man named Percival Lowell, who believed that there exists a "Planet X" somewhere in the outer reaches of our solar system, based on calculations done with the study of the motions of Uranus and Neptune. .... many times discoveries were made simply because they knew something was there but not knowing what. that is science. not putting your head in the sand.
Geez...if only you understood what you wrote and why it demonstrates the nonsensical nature of your complaints visa vis space in the genome. Lowell didn't merely "believe" there was a planet beyond Neptune just because he felt that there should be one - he had actual mathematical anomalies in his orbital models that were nicely fixed by having another body in orbit beyond Neptune. This would be the same type of scientific logic applied to predicting such features as black holes, dark matter, dark energy, and a variety of radiations. Your imaginary "information" volume, however, has no mathematical anomalies. You just insist that there MUST be an analogy between computer storage formats and the human genome, but there's no actual evidence to suggest such. But hey...feel free to demonstrate the size of a piece of biological "information". I know, I know...it's a wacky request, but gosh Jobo...I'm afraid that how science works.

Robin · 26 September 2008

jobby said: can’t stop yourself from responding to each and every one of your critics’ posts, except of course the ones that nail you to the wall, like my challenge to you to identify the supposed frontloading you claimed was in my dice simulator. Those posts you run from like the plague. .... altho there is high demand for my responses I have other duties and avocations which insist on my time. so I cannot respond to all of them. sorry.
HaHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHHAHAHA!!!! Ooohh...that's the funniest thing I've read in months! Oh stop...you're killing me with your silliness Bojo!!

Science Avenger · 26 September 2008

jobby said: BZZZZT!!! Sorry, that’s the same crap as the “you designed the experiment with your intelligence so it really supports intelligent design” nonsense. It’s just another case of goalpost moving. ... do you feel that a computer program can produce output with out a complier for the program and hardware?
The question is irrelevant. The ID position is that complexity cannot result from simplicity. The Mandlebrot Set Stevaroni mentioned refutes this position (as do snowflakes, EAs, and a host of other examples) because the complicated structure is the result of a single, simple, formula. The composition of the compiler and program is completely beside the point. To illustrate, consider sand dunes, and the complex patterns they form. You might claim such complexity requires some intelligence behind it. I might respond by renting a dump truck, plopping a ton of sand in my wind tunnel, and blowing the wind on the sand to reproduce similar patterns, thus refuting your position. Your retort of "but your intelligence was behind the design of the wind tunnel and the use of the truck" is clearly beside the point, since those were only necessary to reproduce the natural conditions of the sand dunes in the first place. Or to put it more briefly, you don't get to discount Galileo's hypocraphal gravity test of dropping weights from the Tower of Pisa by noting that the tower was designed.

jobby · 26 September 2008

You just insist that there MUST be an analogy between computer storage formats and the human genome, but there’s no actual evidence to suggest such.

... in your opinion do you think that DNA is a code that gives instructions to a cell on how to grow and do physiological functions?

jobby · 26 September 2008

Or to put it more briefly, you don’t get to discount Galileo’s hypocraphal gravity test of dropping weights from the Tower of Pisa by noting that the tower was designed.

... of course not. you really do not understand ID theory

jobby · 26 September 2008

Or to put it more briefly, you don’t get to discount Galileo’s hypocraphal gravity test of dropping weights from the Tower of Pisa by noting that the tower was designed.

... do you feel 500 megs is enough info to construct a human?

Robin · 26 September 2008

jobby said: You are assuming that data in the genome is analogous to data in a computer, but that isn’t scientific or logical. ... wrong again. a byte or bit of data is a universal concept regardless of the media. hash marks on a cell wall being each one bit of data. and each byte in the Mayan math system being 20 bits. these are univeral concepts
BZZZZTT!! Wrong. Please do not try and bluff on subjects for which you clearly have no understanding. A byte isn't even univeral in computer technology as it is based upon the amount of information a given processor can 'bite' off in a single process. There have been 4-bit bytes, 32-bit bytes, 9-bit bytes, etc, and now the common 8-bit bytes. But such only applies to binary information compiler systems anyway, and to fixed human-designed (read: inefficient) electro-magnetic and digital storage systems. Further, the amount of information contained in a given byte isn't even universal. Since you have NO concept of what constitutes a "bit" of genome information or how that information is stored in DNA, your entire premise holds no validity.

Robin · 26 September 2008

jobby said: You also have never, as all Darwinism proponents have never, explained exactly what measure of information you are applying to human genetics.
Geez...you mean it's not bytes! Oh wait...

stevaroni · 26 September 2008

you really do not understand ID theory

Just one more thing I am grateful for.

jobby · 26 September 2008

Science Avenger said:
jobby said: ou think you get to substitute “god” into anything you don’t personally understand, which sadly, is quite a bit. ... I never have since I am an agnostic.
You're a liar.
Moron, I lied about what??

jobby · 26 September 2008

stevaroni said:

you really do not understand ID theory

Just one more thing I am grateful for.
Yes ignorance can be bliss. You must be very happy.

stevaroni · 26 September 2008

Robin: A byte isn’t even univeral... there have been 4-bit bytes, 32-bit bytes, 9-bit bytes

At some point int he distant past, I worked with a machine that had "bytes" that were 40 bits long, if I recall correctly the data was always encoded by default as scientific notation, the top 15 bits were the mantissa and the bottom 25 the exponent. While this made many floating-point operations very easy, BCD integer and bit-wise math was a raging nightmare. Ironically, just the opposite of the normal case. I've always mused about whether we would have gotten to computer technology earlier if humans had 8 (or 16) fingers instead of 10. Maybe binary math would have been explored centuries earlier than it was. I wonder what Babbage would have done with those sorts of ideas. One of his great sticking points was the difficulty of building mechanical base-10 adders and accumulators.

jobby · 26 September 2008

Since you have NO concept of what constitutes a “bit” of genome information or how that information is stored in DNA, your entire premise holds no validity.

Can a word or phrase be written into DNA?

jobby · 26 September 2008

A byte isn’t even univeral… there have been 4-bit bytes, 32-bit bytes, 9-bit bytes

... DUH reading problem! never said that all bytes have a specific # of bits

stevaroni · 26 September 2008

… DUH reading problem! never said that all bytes have a specific # of bits

Well, if you're talking information content, that's a significant issue. Although, colloquially, when you say "byte" most computer types will automatically interpret that as 8 bits, and mentally correct for systems with bigger words by breaking them into bytes, this is not universal. And the actual data encoded is an issue totally separate from the format chosen. Imagine a color .tif format image of a scanned page of laser printer text. It's 8x10 at 200dpi, and the file size is 9.6Mb so you can rationally say that it has 9+ megs of data. Except that all those pixels have only one of two values, printed or not. So there's only 400K of real information. Others may look at that and declare that you could probably transfer the real information not as an image file, but as 3000 text characters, 3000 bytes. Except that there are only 26 letters and a handful of special characters, so instead of 8 bits, if you pack into 5 bits, there's probably only 1875 real bytes of information. That:s a 5120:1 range, J-boy. So you had better define your terms. What constitutes the "information" necessary to build a human? Clearly, it's not an exact map of the location of every cell (that's changing all the time anyhow, and somehow we survive, and besides, identical clones can be dramatically different, especially if born of different mothers, so it can't be a "hard map" in computer terms). It has to be some kind of formula for how to do the deed. How much information does that formula really take, J? Do you actually have any idea? I suspect not.

Robin · 26 September 2008

jobby said: A byte isn’t even univeral… there have been 4-bit bytes, 32-bit bytes, 9-bit bytes ... DUH reading problem! never said that all bytes have a specific # of bits
Bytes are not a univeral anything, hojo, that's the point.

jobby · 26 September 2008

Can a word or phrase be written into DNA?
Robin said:
jobby said: A byte isn’t even univeral… there have been 4-bit bytes, 32-bit bytes, 9-bit bytes ... DUH reading problem! never said that all bytes have a specific # of bits
Bytes are not a univeral anything, hojo, that's the point.
Can a word or phrase be written into DNA?

jobby · 26 September 2008

stevaroni said:

… DUH reading problem! never said that all bytes have a specific # of bits

Well, if you're talking information content, that's a significant issue. Although, colloquially, when you say "byte" most computer types will automatically interpret that as 8 bits, and mentally correct for systems with bigger words by breaking them into bytes, this is not universal. And the actual data encoded is an issue totally separate from the format chosen. Imagine a color .tif format image of a scanned page of laser printer text. It's 8x10 at 200dpi, and the file size is 9.6Mb so you can rationally say that it has 9+ megs of data. Except that all those pixels have only one of two values, printed or not. So there's only 400K of real information. Others may look at that and declare that you could probably transfer the real information not as an image file, but as 3000 text characters, 3000 bytes. Except that there are only 26 letters and a handful of special characters, so instead of 8 bits, if you pack into 5 bits, there's probably only 1875 real bytes of information. That:s a 5120:1 range, J-boy. So you had better define your terms. What constitutes the "information" necessary to build a human? Clearly, it's not an exact map of the location of every cell (that's changing all the time anyhow, and somehow we survive, and besides, identical clones can be dramatically different, especially if born of different mothers, so it can't be a "hard map" in computer terms). It has to be some kind of formula for how to do the deed. How much information does that formula really take, J? Do you actually have any idea? I suspect not.
What a tapdance!!

David Stanton · 26 September 2008

No hand jobby, the tap dance is you refusing to answer the reasonable question and instead copying and pasting the entire post without responding to the question. Now that is a tap dance.

Got an example of a protein yet? Got an answer for whether a bumble bee can fly yet?

stevaroni · 26 September 2008

What a tapdance!!

Hmmm, attacks, but once again, no data. I wonder why that could be? If I'm dancing it should be a trivial matter to define your terms and end the music, now shouldn't it, troll? Um, unless you can't. Um, because you don't actually have any information, and at this point you know that whenever you try to bluff, we call you on it. Yeah, that pretty much fits the data I have available.

Science Avenger · 26 September 2008

jobby said: Or to put it more briefly, you don’t get to discount Galileo’s hypocraphal gravity test of dropping weights from the Tower of Pisa by noting that the tower was designed. ... of course not. you really do not understand ID theory
Nice attempt to dodge the issue, but we weren't talking about ID theory, especially since there is no ID theory. We were talking about your idiotic argument that any disproof of your claim that complexity cannot result from simplicity in a certain environment without the aid of intelligence, is nullified if we had to use intelligence to create said environment. And please spare us the whine that you didn't say that. It IS what yo are saying, just expressed in a more general and coherent form.

Science Avenger · 26 September 2008

jobby said: Or to put it more briefly, you don’t get to discount Galileo’s hypocraphal gravity test of dropping weights from the Tower of Pisa by noting that the tower was designed. ... do you feel 500 megs is enough info to construct a human?
Wow, there's a five-star non sequitor! To answer the question, I do not know. I'm a mathematician, not a biologist, so I'm not really qualified to say (and by the same token, neither are you). What I am qualified to say is that you don't get to make mathematical arguments by waving your hands and yanking figures out of your ass. If you claim X meg is too low for task A, you must show your work. Where are your formulas? What are your assumptions? What are the justifications for them? You don't get to play Berlinski and just make up figures like 50,000 morphological changes "on the back of an envelope". Mathematical arguments require math. Where is yours?

Robin · 26 September 2008

jobby said: Can a word or phrase be written into DNA?
Robin said:
jobby said: A byte isn’t even univeral… there have been 4-bit bytes, 32-bit bytes, 9-bit bytes ... DUH reading problem! never said that all bytes have a specific # of bits
Bytes are not a univeral anything, hojo, that's the point.
Can a word or phrase be written into DNA?
That question doesn't make any sense, Bojo. What is a "word" or a "phrase" from an amino acid standpoint?

Dave Lovell · 26 September 2008

jobby said: ... DUH reading problem! never said that all bytes have a specific # of bits
But you should have. With errors on both sides some computing basics seem necessary. In computing a Bit can be set to one of two states, and a BYTE always consists of 8 bits. Half a byte is a NIBBLE, A WORD was originally two bytes, though the term tends to be used to mean 4 or 8 bytes today. A processor has a data bus through which it communicates with other devices, and this will almost always be 2^n bits wide. Modern PC processors typically have 64 bit data busses allowing them to access 8 bytes of data simultaneously. A byte is a very precisely defined store of raw information. So what can be stored in a byte? Using ASCII, one letter, but this is very wasteful, and a more complex scheme targeted at English will reach almost one word per byte. At a thousand words per page, 800MBytes could store about 800,000 pages of text. The human genome I understand to be 3 billion base pairs long. There are only four base pair types, so 2 bits per base pair gives gives 750MBytes. So if I were a manufacturer of computer storage devices looking for a more compact replacement for the CD, I could get two CD's worth of data onto a DNA string the same length as that in a human cell nucleus. The sequencer required to read back the information would need some miniaturisation over current technology, and read speed would be very slow (unless the high speed sequencers used in CSI type TV programs are made more widely available) Writers for this technology seem to be some way off. So this sets an upper limit of about 750MB of raw information in human DNA. Is this enough to build a human? It seems to work millions of times every day, so surely the question for a scientist is to try to explain how, as there is no other source of larger amounts of information without resorting to particle physics (or homeopathy). If you think it is worth spending your life investigating other possibilities, don't let us stop you. Is is a path to a Nobel prize in the same way a lottery ticket is a path to becoming the worlds richest man.

jobby · 26 September 2008

The word "byte" has two closely related meanings: A contiguous sequence of a fixed number of bits (binary digits). The use of a byte to mean 8 bits has become nearly ubiquitous. A contiguous sequence of bits within a binary computer that comprises the smallest addressable sub-field of the computer's natural word-size. That is, the smallest unit of binary data on which meaningful computation, or natural data boundaries, could be applied. For example, the CDC 6000 series scientific mainframes divided their 60-bit floating-point words into 10 six-bit bytes. These bytes conveniently held Hollerith data from punched cards, typically the upper-case alphabet and decimal digits. CDC also often referred to 12-bit quantities as bytes, each holding two 6-bit display code characters, due to the 12-bit I/O architecture of the machine. The PDP-10 used assembly instructions LDB and DPB to extract bytes — these operations survive today in Common Lisp. Bytes of six, seven, or nine bits were used on some computers, for example within the 36-bit word of the PDP-10. The UNIVAC 1100/2200 series computers (now Unisys) addressed in both 6-bit (Fieldata) and 9-bit (ASCII) modes within its 36-bit word.
Dave Lovell said:
jobby said: ... DUH reading problem! never said that all bytes have a specific # of bits
But you should have. With errors on both sides some computing basics seem necessary. In computing a Bit can be set to one of two states, and a BYTE always consists of 8 bits. Half a byte is a NIBBLE, A WORD was originally two bytes, though the term tends to be used to mean 4 or 8 bytes today. A processor has a data bus through which it communicates with other devices, and this will almost always be 2^n bits wide. Modern PC processors typically have 64 bit data busses allowing them to access 8 bytes of data simultaneously. A byte is a very precisely defined store of raw information. So what can be stored in a byte? Using ASCII, one letter, but this is very wasteful, and a more complex scheme targeted at English will reach almost one word per byte. At a thousand words per page, 800MBytes could store about 800,000 pages of text. The human genome I understand to be 3 billion base pairs long. There are only four base pair types, so 2 bits per base pair gives gives 750MBytes. So if I were a manufacturer of computer storage devices looking for a more compact replacement for the CD, I could get two CD's worth of data onto a DNA string the same length as that in a human cell nucleus. The sequencer required to read back the information would need some miniaturisation over current technology, and read speed would be very slow (unless the high speed sequencers used in CSI type TV programs are made more widely available) Writers for this technology seem to be some way off. So this sets an upper limit of about 750MB of raw information in human DNA. Is this enough to build a human? It seems to work millions of times every day, so surely the question for a scientist is to try to explain how, as there is no other source of larger amounts of information without resorting to particle physics (or homeopathy). If you think it is worth spending your life investigating other possibilities, don't let us stop you. Is is a path to a Nobel prize in the same way a lottery ticket is a path to becoming the worlds richest man.
Sorry. Youre wrong: Wiki: The word "byte" has two closely related meanings: A contiguous sequence of a fixed number of bits (binary digits). The use of a byte to mean 8 bits has become nearly ubiquitous. A contiguous sequence of bits within a binary computer that comprises the smallest addressable sub-field of the computer's natural word-size. That is, the smallest unit of binary data on which meaningful computation, or natural data boundaries, could be applied. For example, the CDC 6000 series scientific mainframes divided their 60-bit floating-point words into 10 six-bit bytes. These bytes conveniently held Hollerith data from punched cards, typically the upper-case alphabet and decimal digits. CDC also often referred to 12-bit quantities as bytes, each holding two 6-bit display code characters, due to the 12-bit I/O architecture of the machine. The PDP-10 used assembly instructions LDB and DPB to extract bytes — these operations survive today in Common Lisp. Bytes of six, seven, or nine bits were used on some computers, for example within the 36-bit word of the PDP-10. The UNIVAC 1100/2200 series computers (now Unisys) addressed in both 6-bit (Fieldata) and 9-bit (ASCII) modes within its 36-bit word.

jobby · 26 September 2008

So this sets an upper limit of about 750MB of raw information in human DNA. Is this enough to build a human? It seems to work millions of times every day, so surely the question for a scientist is to try to explain how, as there is no other source of larger amounts of information without resorting to particle physics (or homeopathy).

.....wrong again: how do you know there is no other source?

jobby · 26 September 2008

That question doesn’t make any sense, Bojo. What is a “word” or a “phrase” from an amino acid standpoint?

... Study Harder:

Using the same code that computer keyboards use, the Japanese group, led by Masaru Tomita of Keio University, wrote four copies of Albert Einstein’s famous formula, E=mc2, along with “1905,” the date that the young Einstein derived it, into the bacterium’s genome, the 400-million-long string of A’s, G’s, T’s and C’s that determine everything the little bug is and everything it’s ever going to be.

jobby · 26 September 2008

If you claim X meg is ---sufficient--- for task A, you must show your work. Where are your formulas? What are your assumptions? What are the justifications for them? You don’t get to play Berlinski and just make up figures like 50,000 morphological changes “on the back of an envelope”.

Mathematical arguments require math. Where is yours?

jobby · 26 September 2008

JPEG image of Indian Flag File Size = 1981 Bytes DNA bases = 7924 In example. 2, a JPEG image if Indian Flag having file size of 1981 Bytes have been encrypted in terms of DNA bases. A total of 7924 DNA bases (4-base/Byte) are required to encrypt the complete image. Since the sequence is large, fragmenting the sequence into smaller segments is required.

REFERENCES 1. Lalit M Bharadwaj*, Amol P Bhondekar, Awdhesh K. Shukla, Vijayender Bhalla and R P Bajpai. DNA-Based High-Density Memory Devices And Biomolecular Electronics At CSIO. Proc. SPIE: vol. 4937, pp 319-325 (2002).

David Stanton · 26 September 2008

So there you go. Hand jobby has proven that it takes less than 8,000 bases to get a picture of a flag. So that should be the same amount that you need to get a picture of a human being. So there you go. 750 - 800 megabytes is plenty of information to make a picture of a human being. (Not counting compression algorithms that could drastically reduce the amount of information needed). What, making a human is not the same as making a picture of a human? Really. Then the argument is inappropriate and hand jobby has proven absolutely nothing.

How do you know that there isn't a little blue demon involved? I challenge you to prove that there isn't. Asking others to show their work when you have not is just hypocritical. Anyway, here is my calculation - one page recipe for a cake, 3000 page recipe for a human. Yea, that sounds about right, one suspects.

Last chance troll of many names. Got an example of a protein or not? Got an explanation for RNA editing and alternative splicing or not? Got an answer to any of my questions or not? You have exactly one hour to come up with an answer or you lose. What, that isn't enough time? You had five days already.

Four hundred posts and not one word about the topic of the thread. Go home to mommy.

jobby · 26 September 2008

So there you go. 750 - 800 megabytes is plenty of information to make a picture of a human being.

........ DUH. were not making pictures here. We are constructing a very, very complicated machine.

fnxtr · 26 September 2008

jobby said: Since you have NO concept of what constitutes a “bit” of genome information or how that information is stored in DNA, your entire premise holds no validity. Can a word or phrase be written into DNA?
In what language? English? Farsi? Mayan petroglyphs? Inuit syllabary? WATFOR? Z80 machine code? See, 'bit' of information is meaningless without context, and not necessarily convertible from one medium to another. Oh, btw folks, Yobbo has admitted before he thinks we were designed by space aliens.

Henry J · 26 September 2008

What constitutes the “information” necessary to build a human?

As a starting point: recipes for all the required proteins, and regulatory DNA for each of those to turn it on in cells that need it, and off in cells that don't. Henry

jobby · 26 September 2008

fnxtr said:
jobby said: Since you have NO concept of what constitutes a “bit” of genome information or how that information is stored in DNA, your entire premise holds no validity. Can a word or phrase be written into DNA?
In what language? English? Farsi? Mayan petroglyphs? Inuit syllabary? WATFOR? Z80 machine code? See, 'bit' of information is meaningless without context, and not necessarily convertible from one medium to another. Oh, btw folks, Yobbo has admitted before he thinks we were designed by space aliens.
Study harder: REFERENCES 1. Lalit M Bharadwaj*, Amol P Bhondekar, Awdhesh K. Shukla, Vijayender Bhalla and R P Bajpai. DNA-Based High-Density Memory Devices And Biomolecular Electronics At CSIO. Proc. SPIE: vol. 4937, pp 319-325 (2002).

fnxtr · 26 September 2008

.. and what do you mean by written, anyway? Like Venter did? That depends on a convention of the abbrevations for certain amino acids generated by the particular DNA strand in question.

Each "letter" in a 21-aa alphabet would take 3 base pairs. But if you just want to write the word CAT over and over, it only takes 1 for each letter.

If there are conventional protein name abbreviations (I don't know), it would take one hell of a lot more. See where I'm going here? Your question is pointless.

Science Avenger · 26 September 2008

jobby said: If you claim X meg is ---sufficient--- for task A, you must show your work. Where are your formulas? What are your assumptions? What are the justifications for them? You don’t get to play Berlinski and just make up figures like 50,000 morphological changes “on the back of an envelope”. Mathematical arguments require math. Where is yours?
Sorry handjobby, you don't get to always shift the burdon of proof to someone else. Science can't prove things, it can only disprove them. YOU made mathematical claims of insufficiency, and you need to back them up with math. If you don't, there is simply no reason for anyone to take you or them seriously.

fnxtr · 26 September 2008

Study harder: REFERENCES 1. Lalit M Bharadwaj*, Amol P Bhondekar, Awdhesh K. Shukla, Vijayender Bhalla and R P Bajpai. DNA-Based High-Density Memory Devices And Biomolecular Electronics At CSIO. Proc. SPIE: vol. 4937, pp 319-325 (2002).
From the abstract:
The DNA can be coated selectively with metals with molecular level precision giving us capability to design molecular electronic components, such as, diode, triode, transistor, etc. This paper discusses the DNA based language developed by our group for coding and decoding any digital information in terms of DNA sequence. Basic arithmetical operations, such as, addition subtraction, multiplication, division and exponential have been defined in terms of DNA sequence and their validity has been demonstrated.
They're talking about "basic arithmetical operators" and "molecular electronic components", Yobbo, not human language. In other words, electro-mechanical functions, not abstract concepts like "space alien" or "insanity".

jobby · 26 September 2008

fnxtr said:
Study harder: REFERENCES 1. Lalit M Bharadwaj*, Amol P Bhondekar, Awdhesh K. Shukla, Vijayender Bhalla and R P Bajpai. DNA-Based High-Density Memory Devices And Biomolecular Electronics At CSIO. Proc. SPIE: vol. 4937, pp 319-325 (2002).
From the abstract:
The DNA can be coated selectively with metals with molecular level precision giving us capability to design molecular electronic components, such as, diode, triode, transistor, etc. This paper discusses the DNA based language developed by our group for coding and decoding any digital information in terms of DNA sequence. Basic arithmetical operations, such as, addition subtraction, multiplication, division and exponential have been defined in terms of DNA sequence and their validity has been demonstrated.
They're talking about "basic arithmetical operators" and "molecular electronic components", Yobbo, not human language. In other words, electro-mechanical functions, not abstract concepts like "space alien" or "insanity".
Study MUCH harder: From the article: The method enables the storage of information in DNA. In another embodiment a software based on the above method enables all 256 Extended ASCII characters to be defined in terms of DNA sequences. T

fnxtr · 26 September 2008

(shrug) Okay, so you meant ASCII. Why didn't you just say so in the first place?

And... so what?

jobby · 26 September 2008

fnxtr said: (shrug) Okay, so you meant ASCII. Why didn't you just say so in the first place? And... so what?
I thought it was obvious they were using ASCII. What is it you do not understand?

tresmal · 26 September 2008

jobby: Did you hear a whooshing sound when you were responding to stevaroni's comment with the Mandelbrot set? That was the sound of another point going over your head. His point was that a code doesn't have to contain a lot of information to produce complex results. A code can have the ability to generate information. A lot of information. Your objection to the comment: ..."you forgot to enter the complexity of the compiler that interprets the code. and the complexity of the hardware that translates your mandlebrot code into a computers screen. very, very complex and could not evolve" fails on two points. 1) the cell's biochemistry is plenty adequate to perform the analogous functions. 2)your original point was about the size of the code, which is the point addressed by stevaroni. Your original point was about software and when that was addressed you moved the goalposts by claiming "oh yeah, you gotta account for the hardware too!"

As for your question my answer is that 750MB - even the 1.5 percent of that number mentioned here - is plenty big enough for the functions ascribed to it by scientists.

jobby · 26 September 2008

Sorry handjobby, you don’t get to always shift the burdon of proof to someone else. Science can’t prove things, it can only disprove them. YOU made mathematical claims of insufficiency, and you need to back them up with math. If you don’t, there is simply no reason for anyone to take you or them seriously.

... You are saying that the burden of proof is on me to validate my assertion but you do not have the same burden?

My point is that whether the DNA has enough info is unkown. However you are saying you KNOW it does.

Must we accept what you say on FAITH or do you have evidence to back up what you believe in?

jobby · 26 September 2008

That was the sound of another point going over your head. His point was that a code doesn’t have to contain a lot of information to produce complex results. A code can have the ability to generate information. A lot of information.

... you are confusing information with data. I can generate much data with one command PRINT RANDOM NUMBERS. However there will be little information

.... Study much harder.

jobby · 26 September 2008

As for your question my answer is that 750MB - even the 1.5 percent of that number mentioned here - is plenty big enough for the functions ascribed to it by scientists.

.... And I must accept your belief on FAITH? Any tests to back up your belief?

jobby · 26 September 2008

As for your question my answer is that 750MB - even the 1.5 percent of that number mentioned here - is plenty big enough for the functions ascribed to it by scientists.

... yet many comptuer operation systems need gigs of info and you are saying the human body can grow, and be contructed, and execute on 12 MB?

... "Extraordinary claims require extraordinary evidence" was popularized by Carl Sagan (1934 - 1996)

.... show me that extraordinary evidence.

David Stanton · 26 September 2008

Jobby. Jobby, Jobby. Quote mining a post that appears just above yours is not a good strategy. Everyone can see thatyou just missed the point once again.

Now, the clock is running. Only one half hour left. Got any answers for me or not?

Science Avenger · 26 September 2008

jobby said: ... You are saying that the burden of proof is on me to validate my assertion but you do not have the same burden? My point is that whether the DNA has enough info is unkown. However you are saying you KNOW it does. Must we accept what you say on FAITH or do you have evidence to back up what you believe in?
You are making shit up. I've made no such assertion, and in fact expressly stated I am not qualified to answer the question (something you should learn how to do). You have made an assertion. You said 750 megabytes was insufficient, so you need to back it up. Whether anyone else may or may not be defending what they should defend is irrelevant to your epistemological duties.

Science Avenger · 26 September 2008

jobby said: That was the sound of another point going over your head. His point was that a code doesn’t have to contain a lot of information to produce complex results. A code can have the ability to generate information. A lot of information. ... you are confusing information with data. I can generate much data with one command PRINT RANDOM NUMBERS. However there will be little information .... Study much harder.
No amount of study can make ill-defined terms meaningful. There is simply no content to what you said above. You are just tossing around verbage, a la Palin.

jobby · 26 September 2008

Science Avenger said:
jobby said: ... You are saying that the burden of proof is on me to validate my assertion but you do not have the same burden? My point is that whether the DNA has enough info is unkown. However you are saying you KNOW it does. Must we accept what you say on FAITH or do you have evidence to back up what you believe in?
You are making shit up. I've made no such assertion, and in fact expressly stated I am not qualified to answer the question (something you should learn how to do). You have made an assertion. You said 750 megabytes was insufficient, so you need to back it up. Whether anyone else may or may not be defending what they should defend is irrelevant to your epistemological duties.
You said 750 megabytes was insufficient, so you need to back it up. .... never said that. .... anyhow. You admit that there is no evidence that there is enough space in the DNA to contruct a human?

Science Avenger · 26 September 2008

jobby said: As for your question my answer is that 750MB - even the 1.5 percent of that number mentioned here - is plenty big enough for the functions ascribed to it by scientists. ... yet many comptuer operation systems need gigs of info and you are saying the human body can grow, and be contructed, and execute on 12 MB? ... "Extraordinary claims require extraordinary evidence" was popularized by Carl Sagan (1934 - 1996) .... show me that extraordinary evidence.
Show us your support for claiming it is an extraordinary event. Since it is witnessed happening all the time, it would seem at a most basic level a very UNextraordinary event. You might as well stand in an airport challenging us to prove airplanes can fly without angels assisting them.

jobby · 26 September 2008

No amount of study can make ill-defined terms meaningful. There is simply no content to what you said above. You are just tossing around verbage, a la Palin.

... you feel that 10,000 randomly generated numbers are 'information'?

jobby · 26 September 2008

Since it is witnessed happening all the time, it would seem at a most basic level a very UNextraordinary event.

... witnessing what?

jobby · 26 September 2008

Science Avenger said:
jobby said: As for your question my answer is that 750MB - even the 1.5 percent of that number mentioned here - is plenty big enough for the functions ascribed to it by scientists. ... yet many comptuer operation systems need gigs of info and you are saying the human body can grow, and be contructed, and execute on 12 MB? ... "Extraordinary claims require extraordinary evidence" was popularized by Carl Sagan (1934 - 1996) .... show me that extraordinary evidence.
Show us your support for claiming it is an extraordinary event. Since it is witnessed happening all the time, it would seem at a most basic level a very UNextraordinary event. You might as well stand in an airport challenging us to prove airplanes can fly without angels assisting them.
You admit that there is no evidence that there is enough space in the DNA to contruct a human?

Science Avenger · 26 September 2008

jobby said:
Science Avenger said: You are making shit up. I've made no such assertion, and in fact expressly stated I am not qualified to answer the question (something you should learn how to do). You have made an assertion. You said 750 megabytes was insufficient, so you need to back it up. Whether anyone else may or may not be defending what they should defend is irrelevant to your epistemological duties.
You said 750 megabytes was insufficient, so you need to back it up. .... never said that. .... anyhow. You admit that there is no evidence that there is enough space in the DNA to contruct a human?
You have been saying over and over again that the information is insufficient you pathetic liar. And your reading comprehension is suffering again, since it can be seen plainly above that I have made no comment about the evidence in this discussion because I'm not qualified to judge it. I guess I can see where you'd have a problem digesting that, since it's clear from your behavior that you don't seem to recognize the concept of being unqualified to pass judgement on an issue. Regardless of how clearly your ignorance is illustrated, you keep plowing into every issue as if your opinion had merit everywhere. Wake up, it doesn't.

jobby · 26 September 2008

You have been saying over and over again that the information is insufficient you pathetic liar.

... show me where!

.... but that is not important. why cant you answer the following question. I can: my answer is: there is no evidence.

anyhow. You admit that there is no evidence that there is enough space in the DNA to contruct a human?

Science Avenger · 26 September 2008

jobby said: No amount of study can make ill-defined terms meaningful. There is simply no content to what you said above. You are just tossing around verbage, a la Palin. ... you feel that 10,000 randomly generated numbers are 'information'?
Another 5-star non sequitor. I feel that you are talking a lot and saying nothing. I'll let the information theorists deal with your information claims. I'll stick to demonlishing your statistical ones. Speaking of which, still no time to make good your claim that my computer simulation was frontloaded eh? Amazing how you have so much time to ask inane irrelevant questions though. Shows where your priorities are. Just argue, always argue. Feh on evidence. As to my other comment, we witness fertilized eggs becoming people, just like we watch bumblebees fly. Your theoretical noodlings cannot compete with hard reality.

Science Avenger · 26 September 2008

jobby said: You have been saying over and over again that the information is insufficient you pathetic liar. ... show me where!
Like shooting fish in a barrel:
jobby said: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no.
So there you go. You know, between this gaffe and your seeming inability to remember what I told you mere minutes ago, I'm now entertaining the theory that you are really several people playing from the same script of canned answers and infantile debating tactics.
.... but that is not important. why cant you answer the following question. I can: my answer is: there is no evidence.
That only shows that I have a much higher standard for my understanding of a subject before I'll publicly opine about it in the face of actual experts on the subject. Your indifference to these issues is hardly a bragging point.
anyhow. You admit that there is no evidence that there is enough space in the DNA to contruct a human?
[sigh] I've "admitted" no such thing Mr. Reading Comprehension. Let's see if you can actually digest it this time.

jobby · 26 September 2008

Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

My answer is a definite no.

... Yes I feel that 800 megabytes is not enough. Do I know? No! Of course not. I would have to run an experiment or see a study and I do not believe there are any.

However YOU do believe that there is enough info in the DNA. without see an experiment. That is because you have strong FAITH in Darwinism. I do not. I think the whole issue of origins has little proof. Either way. If you believe in Darwinism or ID or Creationism or whatever it is a matter of faith and not science.

jobby · 26 September 2008

As to my other comment, we witness fertilized eggs becoming people,

... of course we do! But we do not know that the info that constructed them is solely in the DNA. That is your FAITH position.

jobby · 26 September 2008

anyhow. You admit that there is no evidence that there is enough space in the DNA to contruct a human?

[sigh] I’ve “admitted” no such thing Mr. Reading Comprehension. Let’s see if you can actually digest it this time.

... so please explain: are you saying you actually know of the evidence but will not say that you know it?

.... Do you believe there is such evidence? Have you seen the experiment??

David Stanton · 26 September 2008

ENOUGH. Your time is up fool. You have had long enough. You have no answers, just inane drivel.

There is no protein needed for human development that is not coded in human DNA, period. It is not something taken of faith. We have sequenceed the entire human genome. Scientists have been studying development for over two hunderd years. Hand jobby is ignorant of all of this research so he arrogantly assumes that everyone else is as well. Don't play his foolish little words games filled with hypocricy. He knows nothing and he wants you to know nothing.

He has been banned for breaking the rules of civilized discourse here. Make the ban stick. Just say NO to the hand jobby.

jobby · 26 September 2008

David Stanton said: ENOUGH. Your time is up fool. You have had long enough. You have no answers, just inane drivel. There is no protein needed for human development that is not coded in human DNA, period. It is not something taken of faith. We have sequenceed the entire human genome. Scientists have been studying development for over two hunderd years. Hand jobby is ignorant of all of this research so he arrogantly assumes that everyone else is as well. Don't play his foolish little words games filled with hypocricy. He knows nothing and he wants you to know nothing. He has been banned for breaking the rules of civilized discourse here. Make the ban stick. Just say NO to the hand jobby.
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

fnxtr · 26 September 2008

WTF? Is it a bot? I'm thinking maybe it's a bot.

jobby · 26 September 2008

Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

...I can answer: intuitively I think not since the OS of a computer operating system takes gigs. However I never have seen an experiment to prove it either way. So I think to believe that it does or does not is a FAITH issue.

... why cant other posters state their opinions? Why are they so afraid??

fnxtr · 26 September 2008

No-one's afraid, Yobbo, they just don't care what you think.

David Stanton · 26 September 2008

Ban the boob.

PvM · 26 September 2008

It seems that Jobby has missed an important distinction between the information in a book or a hard drive and information in the genome which interacts with chemical and physical processes. So in other words, when during the developmental phase, the body plan is constructed, it achieves this by setting up gradients of chemicals, and switching on and off regulatory genes, which suppress or enable proteins. In other words, simple rules based on complex chemistry and physics. So in other words, the genome interacts with the environment, such as gravity to generate the body plan.
As such, the information requirements are much lower than when one has to specify every single cell individually. Now all that is needed are gradients, and surrounding tissues which by themselves constrain or enable.

That's why developmental theory is so important. A single change in shutting off a particular gene can affect the length of a whole limb, including all the structures within.

Bobby, unfamiliar with much of anything related to evolutionary theory may thus be confused.

No problem, we should help him understand the vacuity of his position. It's not that hard really.

Stanton · 26 September 2008

PvM said: (W)e should help him understand the vacuity of his position. It's not that hard really.
Actually, given as how bobby/jobby/jacob/hamstrung/balanced/goff makes a game out of refusing to understand even the most basic concepts, to the point of making himself look like a contrarian moron, as well as deliberately agitating people, it is virtually impossible to help him understand the vacuity of his position. After all, he claims that the genome is insufficient to produce a human, but his only evidence is a vague, and tortured comparison to ASCII and bytes, and he has yet to propose an alternative explanation of how proteins and other genomic products are manufactured, if not from DNA.

David Stanton · 26 September 2008

PvM,

I and others have pointed this out in great detail. This fool has ignored every argument. Why is it impossible to ban it? Do we lack the technology or the will? I must say that this does not inspire confidence in the administration of this site if they allow such an abnoxious troll to hijack every thread. Why allow over four hundred off-topic posts, many of which are insanely repetitive? Please ban the boob - permanently.

Science Avenger · 27 September 2008

jobby said: However YOU do believe that there is enough info in the DNA. without see an experiment. That is because you have strong FAITH in Darwinism. I do not. I think the whole issue of origins has little proof. Either way. If you believe in Darwinism or ID or Creationism or whatever it is a matter of faith and not science.
You are clearly making shit up, as [sigh] once again, I don't feel qualified to pass opinion on the subject, so I don't much have one, nor do I have faith in Darwinism. I know it's tough to deal with reality and not your little fantasies, but there it is.
jobby said: As to my other comment, we witness fertilized eggs becoming people, ... of course we do! But we do not know that the info that constructed them is solely in the DNA. That is your FAITH position.
In exactly the same way that my belief that a person given arsenic who dies did so solely due to the arsenic. It's called a reasonable deference to the best available evidence, ready to change in the face of new evidence. There is no faith involved. Your problem is that you want us to give up that position WITHOUT presenting the new evidence that would make that reasonable.
jobby said: ... so please explain: are you saying you actually know of the evidence but will not say that you know it? .... Do you believe there is such evidence? Have you seen the experiment??
Jesus, and you have the gall to accuse others of having reading comprehension problems? Once again troll, so clearly even you can't miss it: I DO NOT FEEL QUALIFIED TO HAVE AN OPINION ON THE SUBJECT, SO I DON'T. Now please, set the all time troll record and misinterpret that a 4th (or 5th, I've lost count) time to mean something other than what it clearly says.

Mike Elzinga · 27 September 2008

fnxtr said: WTF? Is it a bot? I'm thinking maybe it's a bot.
It appears to be a real sicko that is becoming impotent. It used to ejaculate after every response to it. Now it apparently takes about a hundred responses and climbing.

Wayne Francis · 27 September 2008

jobby said: Well, Yobbo, since you make the claim that there must be something else – though you’re very careful never to state clearly what that something else might be ... no wrong again: The curiosity for a planet beyond Neptune began with a man named Percival Lowell, who believed that there exists a "Planet X" somewhere in the outer reaches of our solar system, based on calculations done with the study of the motions of Uranus and Neptune. .... many times discoveries were made simply because they knew something was there but not knowing what. that is science. not putting your head in the sand.
Once again you fail to see the truth. Yes Percival Lowell did believe there was a Planet X that was effecting Uranus and Neptune. He spent the last decade of his life looking for this planet with no success. It was over a decade and a half after Percival died that Pluto was discovered by Clyde Tombaugh discovered it. Now here is the important bit. Percival math was mistaken. Much like you not understanding DNA and thinking there needs to be something out there effecting development, Percival's assumptions about Planet X was wrong because he was using incorrect values for Neptune's mass. In the late 70's the mass of Pluto was verified and it was shown that Pluto, and the then 1 known moon, gravitational effect was not significant on Neptune and Uranus. Thus comparing Percival's search for Planet X was based on bad math just like you wanting scientist to search for this missing information that no one has evidence for is bad science. At least Percival HAD some math even if it is bad. Yes many scientific discoveries have been made by chance, like the discovery of Pluto, but that IS NOT the definition of science. Science may be used in the discovery but the discoveries themselves if based on faulty logic/math/understanding is better classified as luck.

Wayne Francis · 27 September 2008

jobby said: You are assuming that data in the genome is analogous to data in a computer, but that isn’t scientific or logical. ... wrong again. a byte or bit of data is a universal concept regardless of the media. hash marks on a cell wall being each one bit of data. and each byte in the Mayan math system being 20 bits. these are univeral concepts
Once again for the lurkers I'll point out Jobby's bad logic. a Bit is defined as a single binary digit often having the value 1 and 0 or "On" and "Off" Yes for storing the sequence of DNA we can use binary data and yes the human Genome can be represented by a string of binary data. This is where Jobby stops being right. There are 3 billion (3,000,000,000) base pairs. We can "compress" the data by 1/2 by ignoring the 2nd half of the double helix because its pattern is directly correlated on the 1st half. There are 4 possible values for a base pair (position). Binary data holds 2 per position. Thus 1 base pair can be represented by 2 Binary digits. A Byte is 8 bits (others have said that "Bytes" can have other number of bits. Technically speaking this is wrong. The next unit up, a word, is more flexible and based on the architecture of the computer thus could be 16,32, 64 bits or more.) Given that a Byte is 8bits a Byte store a sequence of 4 base pairs. 1Kb is 1024 Bytes (thus can hold 4,096 base pairs) 1Mb is 1024 Kb. For simplicity it is often just rounded down to 1,000. So 1KB is about 1,000. 1Mb is about 1,000,000. 1Gb (Gigabyte) = 1,000,000,000. Hmmm Human Genome is 3,000,000,000. That is 3 Gigabytes has to be divided by 4 since we can encode 4 base pairs for every 8 bits or 1 Byte. from the Human Genome FAQ located at http://www.ornl.gov/sci/techresources/Human_Genome/faq/faqs1.shtml
jobby said: Storing all this information is a great challenge to computer experts known as bioinformatics specialists. One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space. Since the human genome is 3 billion base pairs long, 3 gigabytes of computer data storage space are needed to store the entire genome. This includes nucleotide sequence data only and does not include data annotations and other information that can be associated with sequence data.
Jobby's big mistake is thinking that that the binary representation of DNA has anything to do with the amount of biological information within the DNA sequence. If we sent a DVD out into space with a copy of the human genome on it would a alien life form not based on DNA have ANY clue what the data meant? The answer is "NO" unless we also gave them information on how we both encoded the data and what the data actually meant. Jobby fails to see that he fails to apply the same logic to similar problems. Lets look at some more of Jobby's comments other other analogies. Note I've fixed Jobby's inability to use "reply"
jobby said:
stevaroni said: The thing is jobby is hung up on is that he's conflating the final product, which can be very complicated, and the process that creates it. THe complexity of the two are not necessarily related. For instance, check out this picture, and tell me how much information is in it. http://upload.wikimedia.org/wikipedia/commons/3/37/Mandel_zoom_14_satellite_julia_island.jpg At first guess, you'd probably say a lot. The image is 2,560 × 1,920 pixels, the full file size is 4.93 MB, it's big even as a jpeg. But even if you said that, you'd still be dramatically underestimating it's complexity, because it's actually infinitely intricate. Complicated, huh? Not really. For those who are unfamiliar with it, it's a function called a "Mandlebrot Set", and it can be created with one equation. That one equation can be expressed in about 30 characters. Now, that's "data compression". So, Jobby, Google "fractal" and learn something. And before you start spouting about the fact that equations need to be executed before you see the results, well, so do genes.
... DUH of course! I can write a program 2 lines: 10. print random number 20 go to to that will print an infinite series of numbers. but you forgot to enter the complexity of the compiler that interprets the code. and the complexity of the hardware that translates your mandlebrot code into a computers screen. very, very complex and could not evolve.
Now Jobby's comments are mixed up on so many levels. Jobby fails to see that chemistry is the compiler and hardware that DNA runs on. This chemistry is universal through out the known universe. So DNA runs on the OS & Hardware of Chemistry. Still even though this is the case if we sent a DVD of the Human Genome and a DVD that is 99.99% empty with just a small amount of data representing 1 or more fractal sets into space and Alien species would most likely figure out the results of the fractal set much quicker quicker the the DNA sequence even without a compiler or computer to run it on. The math of Fractals, while pretty on a computer screen, does NOT require it to have an effect or to be understood. On the other hand the DNA sequence would require the aliens to understand the encoding we used for the DNA. In short everywhere in the universe intelligence that comprehends math can understand binary data and could quickly and easily understand a Fractal. To be even more sure we can mechanically represent a fractal in many ways that the aliens should be able understand it without great difficulty. DNA on the other hand they would need to know the encoding. To effectively transmit DNA data we either have to assume that the receiver already understands DNA or provide them with an actual example of DNA in its environment. But back to the DNA on a DVD analogy. Even when it is on the DVD the reader has to know that 00 might = Adenine. Here we are having 2 bits of data actually representing http://en.wikipedia.org/wiki/Adenine So unless you start to define what information you are holding the number of Bytes means nothing. Just like I can represent http://en.wikipedia.org/wiki/Adenine with the value binary value 00 I can just as easily represent the my genome with the value binary value 00. I could then say binary value 01 = all the information to make up the earth, binary value 10 = chocolate cake, binary value 11 = Season 7 episode 1 of Smallville. WOW in 1 byte (binary value 00011011) I have stored the information about 4 of my favorite things!!! The aliens only have to understand how I encoded that data! So we see that Jobby doesn't understand what he reads, he doesn't understand information theory, he doesn't understand that what he reads into a scientist statement isn't the truth and he doesn't understand that his own analogies break down with his own logic.

sylvilagus · 27 September 2008

Wayne Francis said:
jobby said: You are assuming that data in the genome is analogous to data in a computer, but that isn’t scientific or logical. ... wrong again. a byte or bit of data is a universal concept regardless of the media. hash marks on a cell wall being each one bit of data. and each byte in the Mayan math system being 20 bits. these are univeral concepts
Once again for the lurkers I'll point out Jobby's bad logic. a Bit is defined as a single binary digit often having the value 1 and 0 or "On" and "Off" Yes for storing the sequence of DNA we can use binary data and yes the human Genome can be represented by a string of binary data. This is where Jobby stops being right. . . . [Excellent material omitted for space saving] . . . So we see that Jobby doesn't understand what he reads, he doesn't understand information theory, he doesn't understand that what he reads into a scientist statement isn't the truth and he doesn't understand that his own analogies break down with his own logic.
Thanks for this post. You helped me understanding several points that I had an intuitive sense of but not a clear argument for. And as for what jobby understands... well, if he understood even a fraction of what he claims to understand (and possibly believes he actually does understand) he would of course be a professional in several different fields and actually doing research, instead of jabbering away online in his bedroom after mom and dad go to bed.

jobby · 27 September 2008

obby. Jobby, Jobby. Quote mining a post that appears just above yours is not a good strategy. Everyone can see thatyou just missed the point once again.

... that is not 'quote mining' Shows you do not even understand the term.

Dave Lovell · 27 September 2008

jobby said: Sorry. Youre wrong: after offering me his "Wiki" quote below The word "byte" has two closely related meanings: A contiguous sequence of a fixed number of bits (binary digits). The use of a byte to mean 8 bits has become nearly ubiquitous. A contiguous sequence of bits within a binary computer that comprises the smallest addressable sub-field of the computer's natural word-size. That is, the smallest unit of binary data on which meaningful computation, or natural data boundaries, could be applied. For example, the CDC 6000 series scientific mainframes divided their 60-bit floating-point words into 10 six-bit bytes. These bytes conveniently held Hollerith data from punched cards, typically the upper-case alphabet and decimal digits. CDC also often referred to 12-bit quantities as bytes, each holding two 6-bit display code characters, due to the 12-bit I/O architecture of the machine. The PDP-10 used assembly instructions LDB and DPB to extract bytes — these operations survive today in Common Lisp. Bytes of six, seven, or nine bits were used on some computers, for example within the 36-bit word of the PDP-10. The UNIVAC 1100/2200 series computers (now Unisys) addressed in both 6-bit (Fieldata) and 9-bit (ASCII) modes within its 36-bit word.
I was trying to define the meaning of words you and others were using, but you seem to have a need to argue for argument's sake. Even your chosen source says "The use of a byte to mean 8 bits has become nearly ubiquitous." before adding a list of computers designed in the late fifties and early sixties to illustrate exceptions. These computers were designed by isolated design teams making up their vocabulary as they went along. Bus widths had to be carefully optimised to the intended application because of the very high cost of hardware. To these designers a Megabyte would have been an unbelievably large memory, however they chose to describe it. The use of Megabyte today to mean the information stored in 2^20 8-bit bytes is ubiquitous, (except for hard drive manufacturers who use 10^6 to make their drives look a few percent bigger). What is the point of arguing about numbers using words the numerical meaning of which you consider to vary by a factor six? When you are being interviewed for your first job and your prospective employer makes you a salary offer of a million Dollars, it would be prudent to establish this is US and not Zimbabwean Dollars before trying to negotiate an extra 10%.

jobby · 27 September 2008

I could then say binary value 01 = all the information to make up the earth, binary value 10 = chocolate cake, binary value 11 = Season 7 episode 1 of Smallville. WOW in 1 byte (binary value 00011011) I have stored the information about 4 of my favorite things!!! The aliens only have to understand how I encoded that data!

... well that is contrary to mainstream info theory. basically your decoder is more complex than your code. well you can go on tap dancing on this but it really doesnt matter.

jobby · 27 September 2008

David Stanton said: Jobby. Jobby, Jobby. Quote mining a post that appears just above yours is not a good strategy. Everyone can see thatyou just missed the point once again. Now, the clock is running. Only one half hour left. Got any answers for me or not?
.....Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Why are you afraid to answer??

jobby · 27 September 2008

What is the point of arguing about numbers using words the numerical meaning of which you consider to vary by a factor six? When you are being interviewed for your first job and your prospective employer makes you a salary offer of a million Dollars, it would be prudent to establish this is US and not Zimbabwean Dollars before trying to negotiate an extra 10%.

...Whatever:

Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?

jobby · 27 September 2008

So DNA runs on the OS & Hardware of Chemistry.

... how fortunate that that chemistry thru pure happenstance is able to do that. How fortunate indeed.

David Stanton · 27 September 2008

Ban the boob.

jobby · 27 September 2008

David Stanton said: Ban the boob.
.….Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Why are you afraid to answer??

jobby · 27 September 2008

I was trying to define the meaning of words you and others were using, but you seem to have a need to argue for argument’s sake.

... the point is that the size of a 'byte' is arbitrary and based on 'convention' rather than a fixed math property like PI or 'e'. just as numbering systems are based on culture and convention.

the overall point is moot. whether DNA contains 10MB or 10,000 MB it certainly appears to be not enough and to accept that SOMEHOW thru some miraculous method DNA can perform all those functions is an act of FAITH not science.

Dave Lovell · 27 September 2008

jobby said: What is the point of arguing about numbers using words the numerical meaning of which you consider to vary by a factor six? When you are being interviewed for your first job and your prospective employer makes you a salary offer of a million Dollars, it would be prudent to establish this is US and not Zimbabwean Dollars before trying to negotiate an extra 10%. ...Whatever: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
I did answer this some time ago. but I'll try again. Since the human genome can be unambiguously stored in about 750MB, this sets an upper limit of about 750MB of raw data in human DNA. If significantly more data is required to build a human, the rest must be held on an array of invisible mass-less particles within the cell, or read through a wormhole to a parallel universe at the instant of cell division. I'll repeat, if you think it is worth spending your life investigating other possibilities, go ahead. Is is a path to a Nobel prize like a lottery ticket is a path to becoming the richest man in the world.

Dave Lovell · 27 September 2008

jobby said: ... the point is that the size of a 'byte' is arbitrary and based on 'convention' rather than a fixed math property like PI or 'e'. just as numbering systems are based on culture and convention.
No it isn't, but if it bothers you that much let's use 6400Mb instead of 800MB to avoid any ambiguity

stevaroni · 27 September 2008

J the troll says... Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Why are you afraid to answer??

Yes. Because that's all the space we have found, which is a statement of fact, not faith. Think it isn't? Then show us. Otherwise, we can safely surmise you're just taking it s a matter of faith, not fact.

iml8 · 27 September 2008

There's this concept in software development called
"code equivalence", mostly used as a metric for
programmer productivity. This issue relates to the
fact that some programming languages are more efficient
at some kind of tasks than others -- there are computer
languages I've worked with where I could write in one
line a program that would take pages of code in others.
So what they do is come up with standard benchmarks and
implement them in different languages, then compare how
much code it took. That gives conversion factors to
allow comparing programmer productivity depending on the
language used.

I was sitting marveling at the idea of comparing the
size of the human genome and MS Windows. Ah, so let's
determine the code equivalence between a computer and
... something that's not remotely a computer.
How about a miles-per-gallon comparison between me and
my Toyota?

I wondered if there were actually any creationist
websites that promoted this argument. I spent a little
time Googling and couldn't find any.
But I only mention this for the amusement value.
Everyone knows we're just playing games here. And
not very clever ones at that.

White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

iml8 · 27 September 2008

I got to thinking -- we COULD do a miles per gallon
comparison between a human and a car: "If you drink
a gallon of beer, then how far can you walk?"

However, the number of miles would actually FALL as the
gallons of beer increased.

White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

fnxtr · 27 September 2008

iml8 said: There's this concept in software development called "code equivalence", mostly used as a metric for programmer productivity. (lots of cool stuff sniffed)
Yeah, that's kind of what I got to wondering: 800Mb of what? The letter A means something to us (indefinite article, low front vowel, good grade in high school), but its ASCII hex equivalent, %41, (or 01000001 in binary) means "move the contents of register C to register B" in Z80 machine code. The 'language' of DNA is something else entirely. Comparisons are just garbage.

fnxtr · 27 September 2008

hahahahaha.
snipped, not sniffed.

I really should have my morning caffeine before I start typing. :-\

jobby · 27 September 2008

stevaroni said:

J the troll says... Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Why are you afraid to answer??

Yes. Because that's all the space we have found, which is a statement of fact, not faith. Think it isn't? Then show us. Otherwise, we can safely surmise you're just taking it s a matter of faith, not fact.
800 megabytes can do all those functions? truly miraculous!! makes the loaves and fishes story in the bible look more and more believable. and Noah's Ark even seem possible to hold all the animals! you have unending FAITH!

jobby · 27 September 2008

Ah, so let’s determine the code equivalence between a computer and … something that’s not remotely a computer.

.... Does the DNA contain instructions?

iml8 · 27 September 2008

fnxtr said: Yeah, that's kind of what I got to wondering: 800Mb of what?
It's basically an "information theory" type Darwin-basher argument, trying to compare the "information" in the genome to that of an OS. The sleight-of-hand is the vague and evasive definition of "information". I could go on here but I've done better elsewhere: http://www.vectorsite.net/tadarwin_24.html#m3 There are formal measures of "information", but they don't really address the issue of what the information DOES. Even restricted to computers the comparisons are dodgy. There are specialized CPUs for performing digital signal processing (DSP) -- they can blow the doors off a Pentium for signal processing tasks, but the Pentium can fly rings around them for general purpose computing. You can run a DSP program on a Pentium, but it will be bigger and slower than one run on a DSP chip (at least one running at the same clock speed). There's a saying in the industry: "There's lies, damn lies, statistics, damn statistics [FOUR OUT OF FIVE DOCTORS RECOMMEND!], and ... benchmarks." Now I suppose we can add "damn benchmarks". White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

fnxtr · 27 September 2008

jobby said: Ah, so let’s determine the code equivalence between a computer and … something that’s not remotely a computer. .... Does the DNA contain instructions?
Nice try, slippery one. Define "instructions".

PvM · 27 September 2008

jobby said: Ah, so let’s determine the code equivalence between a computer and … something that’s not remotely a computer. .... Does the DNA contain instructions?
Not really, in fact, looking at the DNA it is not always straightforward what the shape of the resulting proteins is and the so called tertiary structure is incredibly important for its function. Of course whether or not a particular gene is expressed or surpressed depends on the circumstances of other regulatory genes as well as chromatin which can hide certain genes. Remember that the DNA is first transcribed into RNA which then is turned into a protein, these proteins, based on the chemistry of the cells involved can spread and enable other cells to start expressing the same gene, or surpress them, turning the whole development into a complex interactions between cells, gravity and chemistry. Combine this with positive and negative feedback loops and you come to understand a hint of what happens during development.

PvM · 27 September 2008

800 megabytes can do all those functions? truly miraculous!!

— Jobby
Faith because we can actually see it happen and track the various developmentary processes and link them to genes and their networks. It seems to me that Bobby's understanding of genes is overly simplified. Perhaps Bobby can explain to us how envisions genes work.

iml8 · 27 September 2008

.... Does the DNA contain instructions?
Yep. But we don't know the code equivalence factor. Actually, there's no way to calculate it, because there's no way to establish benchmarks between two systems that don't remotely do the same things. It's as meaningful as comparing my MPG with that of my car. White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

PvM · 27 September 2008

jobby said: So DNA runs on the OS & Hardware of Chemistry. ... how fortunate that that chemistry thru pure happenstance is able to do that. How fortunate indeed.
Now you are getting it, it's not happen stance, its evolution. Let's not confuse evolution with pure happenstance, a common creationist fallacy. But Bobby should realize by now that his arguments hold no water and is moving the goalposts to chemistry. Soon we will hit the big bang and then Bobby will have accepted science.

stevaroni · 27 September 2008

Jobby asks: .… Does the DNA contain instructions? and Fnxrt replies: Nice try, slippery one. Define “instructions”.

Why is he asking us? This is his argument. He's the one who says that there isn't enough information in the only part of the cell that appears to actually contain any. He gets to explain where the rest isn't. Or is. Whatever. I don't even know what the hell he's babbling about anymore, and neither does he, but regardless, explaining it is his obligation.

jobby · 27 September 2008

Yep. But we don’t know the code equivalence factor.

.. so you disagree with PVM who thinks they do not??

stevaroni · 27 September 2008

It seems to me that Bobby’s understanding of genes is overly simplified.

But his understanding of stringing an argument along is pretty well advanced. He must have stayed awake that day in troll school.

iml8 · 27 September 2008

stevaroni said: But his understanding of stringing an argument along is pretty well advanced.
Yes, he was quick to hop sideways when I actually answered his question. But everyone on both sides of this discussion knows ... this is just playing games. White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

PvM · 27 September 2008

jobby said: Yep. But we don’t know the code equivalence factor. .. so you disagree with PVM who thinks they do not??
They do not what? Contain instructions like a computer? Again you have to read my response. The computer, if there exists any, is the whole organism and the interactions with the environment, which include neighboring cells as well as the surroundings of the organism all guided by laws of physics and chemistry. Look up gene regulatory network at Wikipedia to get a high level appreciation of what is involved here.

In multicellular animals the same principle has been put in the service of gene cascades that control body-shape[3]. Each time a cell divides, two cells result which, although they contain the same genome in full, can differ in which genes are turned on and making proteins. Sometimes a 'self-sustaining feedback loop' ensures that a cell maintains its identity and passes it on. Less understood is the mechanism of epigenetics by which chromatin modification may provide cellular memory by blocking or allowing transcription. A major feature of multicellular animals is the use of morphogen gradients, which in effect provide a positioning system that tells a cell where in the body it is, and hence what sort of cell to become. A gene that is turned on in one cell may make a product that leaves the cell and diffuses through adjacent cells, entering them and turning on genes only when it is present above a certain threshold level. These cells are thus induced into a new fate, and may even generate other morphogens that signal back to the original cell. Over longer distances morphogens may use the active process of signal transduction Such signalling controls embryogenesis, the building of a body plan from scratch through a series of sequential steps. They also control maintain adult bodies through feedback processes, and the loss of such feedback because of a mutation can be responsible for the cell proliferation that is seen in cancer. In parallel with this process of building structure, the gene cascade turns on genes that make structural proteins that give each cell the physical properties it needs.

There is enough information out there that cannot be ignored. Ignorance is no excuse Bobby for making ill informed claims.

PvM · 27 September 2008

stevaroni said:

It seems to me that Bobby’s understanding of genes is overly simplified.

But his understanding of stringing an argument along is pretty well advanced. He must have stayed awake that day in troll school.
Yes, if it were up to me, I would have since long cleaned up this thread. Instead, I think it may be educational for all to explore Bobby's fallacious thinking which is based on an overly simplistic view of DNA. Although he would have done well a century ago :-)

jobby · 27 September 2008

It’s as meaningful as comparing my MPG with that of my car.

.... wrong! yet again!

... both have miles per kilocalorie. and we can calculate in both cases.

human 4 miles per 500,000 calories

car 20 miles per 40 million calories

obviously from a use of fuel point of view a human is much more efficient unless you factor in the weight differential

but to move one human by car or by foot the human is about 20 times more efficient. hence the green advantage of travelling by foot. biking is even better. since a human can do about 10 miles with 500,000 calories. which would be 50 times more efficient.

and again these are ball park figures

jobby · 27 September 2008

They do not what? Contain instructions like a computer? Again you have to read my response

...the information for creating a human is not in the DNA??

iml8 · 27 September 2008

OK. Now calculate the code equivalence between the genome and a computer.

stevaroni · 27 September 2008

obviously from a use of fuel point of view a human is much more efficient unless you factor in the weight differential

Um, so what you're saying is that the important thing is to concentrate on the actual payload moved and not fixate on how much dead weight comes along for the ride?

iml8 · 27 September 2008

stevaroni said: Um, so what you're saying is that the important thing is to concentrate on the actual payload moved ...
Ahhh ... rather than digress along with an attempt to show how "miles per gallon of gasoline" applies to a human as well as a car let's get back to the real question of: how do we calculate the code equivalence factor between the genome and a computer? That's what this is all about. The first thing we have to do is develop a functional benchmark that we can then implement in both languages. White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

fnxtr · 27 September 2008

So now apparently KCal=gal. Interesting. Gallons of what? American or imperial gallons?

iml8 · 27 September 2008

fnxtr said: So now apparently KCal=gal. Interesting. Gallons of what? American or imperial gallons?
Oh, I could think of various oddities in the idea of human MPG ... but again, this is a digresssion. We really need to know the code equivalence factor between a genome and a computer. White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

fnxtr · 27 September 2008

But you're right, albino bunny (can I call you albino bunny? How about Ted?).

What benchmark would we use? How about a routine to sort a list? What kind of list? What kind of sort?

Yobbo? Any ideas?

PvM · 27 September 2008

It is, but you incorrectly calculate information by focusing on number of bits. Let me give you an example that may clarify this. Let's look at a snowflake shape, quite complex and yet the amount of information necessary to describe its formation quite small, since it is a combination of environment and laws of physics which lead to an exquisite shape. And yet the combination of information needed to describe a snowflake's structure is quite high. In other words, small initial information combined with laws of physics can form intricate, high information systems. Where did the additional information come from? The environment and the laws of physics. Much of the same applies to DNA and organisms, with the added understanding that organisms contain many more intricate networks of interactions.
jobby said: They do not what? Contain instructions like a computer? Again you have to read my response ...the information for creating a human is not in the DNA??

iml8 · 27 September 2008

fnxtr said: But you're right, albino bunny (can I call you albino bunny? How about Ted?). What benchmark would we use? How about a routine to sort a list? What kind of list? What kind of sort?
I usually go by "MrG". The code equivalence factor is a management tool, and so the benchmark has to be representative of the actual workday practices of programmers in general. Of course it is possible to pick benchmarks that unrealistically favor one language over another, but this is not what the management wants. This is, incidentally, why "benchmarks" are worse than "damn statistics" (wow, human gasoline MPG, we're in "damn benchmarks" now). So it is an interesting question of exactly what kind of benchmark could be defined in this case. I'm open to suggestions. But instead I think we will get digressions. White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

PvM · 27 September 2008

iml8 said: OK. Now calculate the code equivalence between the genome and a computer.
That's a trick question since a gene's expression in any particular cell may be surpressed, enhanced, and its expression may depend strongly on interactions with other cells and the environment. A good example is for instance temperature and 'sex' in crocodiles. Sex is temperature dependent and thus can be 'regulated' by the environment, including the parents.

iml8 · 27 September 2008

PvM said: That's a trick question ...
What was your first clue? White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

PvM · 27 September 2008

Well, first of all, Bobby seems to be ignoring it other than by repeating his statement that 800mbytes should not be sufficient. And yet imagine how a single switch, based on perhaps a few bytes of information in a regulatory part of the DNA can make the difference between expressing or not expressing a large genetic pathway? In Bobby's world, lengthening an arm would require the additional information to specify the paths for the longer veins, nerves, bones and other tissues, whereas science realizes that this is merely a self unfolding cascade where the length is determined by a single or few on/off switch(es). In other words, rather than looking at DNA as instructions they are far more like full subroutines where the input variables are set by environment, surrounding cells etc.
iml8 said:
PvM said: That's a trick question ...
What was your first clue? White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

PvM · 27 September 2008

How much information is contained in a recursive subroutine?

stevaroni · 27 September 2008

Sex ... can be ‘regulated’ by the environment, including the parents.

Yes... I remember this corollary from my younger days. If I recall correctly, the environment was especially well regulated by having her parents somewhere in the general vicinity.

iml8 · 27 September 2008

PvM said: Well, first of all, Bobby seems to be ignoring it other than by repeating his statement that 800mbytes should not be sufficient.
Yes, I noticed he was being atypically quiet after his exercise in "damn benchmarks". But then again, he might have gone off to get a Big Mac. White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

iml8 · 27 September 2008

stevaroni said: If I recall correctly, the environment was especially well regulated by having her parents somewhere in the general vicinity.
Somehow this reminds me of the guy I worked with who was telling an (actually plausible) story about going on a road trip with his girlfriend and parents in a station wagon. They were in the back, the parents were in the front. "You did WHAT? HOW!?" "Very carefully controlled breathing." I would say this was off topic but I'm not sure there is a topic any more. White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

eric · 27 September 2008

I know I'm many posts behind, but I'm hoping Jobby can answer a simple question - Do you think behavior is programmed in? If the answer is 'no' then your storage problem drops significantly. If your answer is yes, then homosexuality is not a sin because its not a free choice - its programmed in.
jobby said: well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no. Why can't any other poster state an educated guess on this?

PvM · 27 September 2008

Interesting question but a very valid one and if Bobby can answer this one correctly he has realized how the 'storage' problem is significantly reduced.
eric said: I know I'm many posts behind, but I'm hoping Jobby can answer a simple question - Do you think behavior is programmed in? If the answer is 'no' then your storage problem drops significantly. If your answer is yes, then homosexuality is not a sin because its not a free choice - its programmed in.
jobby said: well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no. Why can't any other poster state an educated guess on this?

tresmal · 27 September 2008

You realize, of course, that jobby doesn't want to understand, don't you? Understanding might make the aliens go away.

jobby · 27 September 2008

stevaroni said:

obviously from a use of fuel point of view a human is much more efficient unless you factor in the weight differential

Um, so what you're saying is that the important thing is to concentrate on the actual payload moved and not fixate on how much dead weight comes along for the ride?
.... Duh! how can the 'dead weight' be eliminated??

jobby · 27 September 2008

Where did the additional information come from? The environment and the laws of physics. Much of the same applies to DNA and organisms, with the added understanding that organisms contain many more intricate networks of interactions.

... interesting hypothesis. show me the peer reviewed study which validates this.

jobby · 27 September 2008

Do you think behavior is programmed in?

If the answer is ‘no’ then your storage problem drops significantly.

If your answer is yes, then homosexuality is not a sin because its not a free choice - its programmed in.

.. much behavior is programmed and much is not. ... is the real issue here homosexuality? it that really the underlying point?

jobby · 27 September 2008

wow are there a lot of trolls here.

does anyone want to SERIOUSLY discuss these issues??

David Stanton · 27 September 2008

Ban the boob.

stevaroni · 27 September 2008

.… Duh! how can the ‘dead weight’ be eliminated??

They, um, don't have fax machines on planet jobby? No jpeg? Nobody invented stenographic shorthand or uses acronyms there? When you hire a contractor on planet jobby to build a wall, you have to specify the exact location of every single brick? Everybody uses their full names all the time? "Jobby" isn't actually short for "Jobbert", or "Jobbadiah" or "Jobbarth Jobbly III, king of information elimination"?

jobby · 27 September 2008

In Bobby’s world, lengthening an arm would require the additional information to specify the paths for the longer veins, nerves, bones and other tissues, whereas science realizes that this is merely a self unfolding cascade where the length is determined by a single or few on/off switch(es).

... no I am quite aware of Hox genes etc.

but you are still believing that the DNA has enough space without proof that is still my point. we can argue a priori all day.

where is your test to validate your assertion?

jobby · 27 September 2008

well any neutral party reading this could see that my opposition has little but wise cracks

stevaroni · 27 September 2008

where is your test to validate your assertion?

Um, J, you stipulate that the human genome can hold somewhere north of 700Mb of information. Your guy Deasey says that only 15% of that space seems to hold necessary information. That means that you've already validated our assertion. Thanks for that. Anyhow, now the onus is on you to show that we're wrong, because there's no test to validate your assertion.

stevaroni · 27 September 2008

well any neutral party reading this could see that my opposition has little but wise cracks

Yeah. Well, just that and 227820 peer reviewed research papers on the subject. (as of this afternoon) http://www.ncbi.nlm.nih.gov/pubmed/

Wayne Francis · 27 September 2008

jobby said: So DNA runs on the OS & Hardware of Chemistry. ... how fortunate that that chemistry thru pure happenstance is able to do that. How fortunate indeed.
you know jobby ... this is why it is called "Biochemistry". Ultimately life as we know it follows the laws of physics. You might as well say "How fortunate that there is this thing called gravity". A universe without gravity would probably be VERY boring in deed. If chemical reactions didn't happen then we would not be hear to question to question it. It is just part of the anthropic principal. So Jobby, do you understand that DNA is not comparable to computer code? Just because people have stored messages in it, which also means that you need to know how they encoded said message to "read it", does mean squat. I can store the same messages using oranges, pebbles, a piece of string or almost anything else. You seem to have a problem understanding information theory and encoding data. You have no problem with binary value 00 representing a molecule like adenine but if I suggest that I want 00 to represent a larger molecule, lets say chromosome 21 of the human genome, you suddenly say something like
jobby said:
Wayne Francis said: I could then say binary value 01 = all the information to make up the earth, binary value 10 = chocolate cake, binary value 11 = Season 7 episode 1 of Smallville. WOW in 1 byte (binary value 00011011) I have stored the information about 4 of my favorite things!!! The aliens only have to understand how I encoded that data!
... well that is contrary to mainstream info theory. basically your decoder is more complex than your code. well you can go on tap dancing on this but it really doesnt matter.
the decoder for representing Adenine as binary value 00 is more complicated then the "code" too. In the real world we don't have to worry about this because the decoder for DNA is in the cells and produced by biochemical processes. This is another reason why your computer analogy fails with DNA. Even by your logic. The decoder for ASCII data is also more complex then a piece of ASCII data. Please point me to a paper showing that mainstream information theory says you can't represent a chocolate cake, or anything else, as binary value 00. Information theory is about the compression and communication of data. I have compressed chocolate cake down to binary value 10. As long as the sender and receiver agree on the compression mechanism the information is not lost. For the lurkers that still think Jobby might be on to something.... http://www.innovations-report.com/html/reports/life_sciences/report-57637.html is an article discussing 1 gene provides fruit fly both antenna and color vision or this very easy to understand page http://www.exploratorium.edu/exhibits/mutant_flies/mutant_flies.html shows just some of the neat things we can to by altering the DNA directly or indirectly by turning on or off different regulatory genes during development.

Wayne Francis · 27 September 2008

jobby said: In Bobby’s world, lengthening an arm would require the additional information to specify the paths for the longer veins, nerves, bones and other tissues, whereas science realizes that this is merely a self unfolding cascade where the length is determined by a single or few on/off switch(es). ... no I am quite aware of Hox genes etc. but you are still believing that the DNA has enough space without proof that is still my point. we can argue a priori all day. where is your test to validate your assertion?
Our test is there has not been found 1 protein produce in any cell that we have ever found that doesn't come from that cells DNA. This is what we call "Protein synthesis. You are making the claim that something else is needed. Well show us. Just 1 protein in any species that isn't coded for in that species DNA. All you need to do is show 1 protein. Your Nobel Prize awaits you Jobby.

jobby · 27 September 2008

stevaroni said:

well any neutral party reading this could see that my opposition has little but wise cracks

Yeah. Well, just that and 227820 peer reviewed research papers on the subject. (as of this afternoon) http://www.ncbi.nlm.nih.gov/pubmed/
pick one of those research papers out that validate Darwinism. and lets go over it

jobby · 27 September 2008

Our test is there has not been found 1 protein produce in any cell that we have ever found that doesn’t come from that cells DNA. This is what we call “Protein synthesis.

... producing a protein does not produce a body plan. the proteins are like bricks in a building

jobby · 27 September 2008

Your guy Deasey says that only 15% of that space seems to hold necessary information.

... no he does not. learn to read

stevaroni · 27 September 2008

pick one of those research papers out that validate Darwinism. and lets go over it

Pick a subject troll. Or at least define "Darwinism".

stevaroni · 27 September 2008

… producing a protein does not produce a body plan. the proteins are like bricks in a building

Then again, buildings don't build themselves. Proteins do. Demonstrate that this is not a factor in creating a body plan, troll.

PvM · 27 September 2008

jobby said: Plain observation which shows how a fetus develops. Simple really ... no one is denying that fetus develops. The question was whether the DNA has enough info storage capacity to soley guide this process. Is this really that hard to understand??
And the answer is, of course, as we can see how genes become expressed and surpressed guiding the development of the necessary structures. What makes you believe that DNA is insufficient? As we have shown, your understanding of how genes guide the development process is quite flawed.

PvM · 27 September 2008

jobby said: In Bobby’s world, lengthening an arm would require the additional information to specify the paths for the longer veins, nerves, bones and other tissues, whereas science realizes that this is merely a self unfolding cascade where the length is determined by a single or few on/off switch(es). ... no I am quite aware of Hox genes etc. but you are still believing that the DNA has enough space without proof that is still my point. we can argue a priori all day. where is your test to validate your assertion?
Observe the development of the fetus and observe how genes get expressed, how gradients form, and point out to Bobby that Hox genes are but one aspect of the story. In other words, contrary to the fact there appears no reason to doubt that DNA has sufficient information. Of course, Bobby could trivially prove us wrong by showing otherwise. After all, it's hard to prove a negative, which is the typical ID argument, causing ID to remain vacuous. So Bobby, what evidence do you have that DNA is not sufficient. None. I thought so.

PvM · 27 September 2008

Sure, search for evo devo, or evolutionary development which is all about tracking the genetics, the expressions, the gradients and how neighboring cells turn on and off genes of a cell. Furthermore science has identified many of these networks of interactions. I provided you with a starting link Donot let ignorance let you, as is so tempting, suggest 'design', or worse, conclude that since you cannot understand it, it could not possibly be true. If you come to a discussion lacking much of any relevant background and understanding in the necessary sciences then it is not surprising that you will end up looking foolish. So other than Hox genes, what else do you know about developmentary genetics? Show us some glimmer of understanding.
jobby said: Where did the additional information come from? The environment and the laws of physics. Much of the same applies to DNA and organisms, with the added understanding that organisms contain many more intricate networks of interactions. ... interesting hypothesis. show me the peer reviewed study which validates this.

PvM · 27 September 2008

jobby said: Do you think behavior is programmed in? If the answer is ‘no’ then your storage problem drops significantly. If your answer is yes, then homosexuality is not a sin because its not a free choice - its programmed in. .. much behavior is programmed and much is not. ... is the real issue here homosexuality? it that really the underlying point?
Nope, the underlying point is the absence of logic in your claims. So much behavior is programmed but not all, which is taught, through interactions with the environment, transferring information from the environment into the organism. So if not all information is preprogrammed in the DNA, then you at least have to accept that information transfer from the environment is possible. Now the question becomes, how well does this describe reality. You already claim you are familiar with limb development, so you are aware how the environment interacts with a cell, to turn on and off gene expressions causing a multitude of tissues be formed without the need for additional information beyond the original networks. Such is the power of recursive routines. No need to specify for a longer arm a gene to lengthen every little component of the arm, all that is needed is a slight variation in timing. This is not rocket science Bobby, so rather than presume that there is not enough information in DNA, which is a totally ad hoc claim, you need to show that you are familiar with how science explains body plan development and that there are problems which indicate that DNA is insufficient in explaining said body plan development. Until then, your claims are misguided at best, and based on an argument from ignorance. Surely you can do better than that and explain to us why you believe DNA does not contain sufficient information? In doing so you have to show that you have sufficient understanding of the biochemistry, genetics and developmentary processes involved.

jobby · 28 September 2008

Surely you can do better than that and explain to us why you believe DNA does not contain sufficient information?

... there seems to be enough reason to surmise that it is possible that there is not enough room in the DNA to justfiy doing experiment to validate that hypotheses instead of accepting that hypothesis as fact only on FAITH and a priori reasoning.

At one time most learned individuals assumed the geocentrism based on a priori reasoning. To know in this modern day to accept tenets as fact based on a priori reasoning is certainly a throwback to the middle ages.

jobby · 28 September 2008

Let me ask this:

Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc?

For instance the human genome had only 100 bytes would that be enough? I get the impression here and have heard it said that even ONE byte of info would be enough to construct the human body. Is that the general consensus here?

David Stanton · 28 September 2008

Just so no one will think any different, this boob has refused to answer at least 37 different questions that I posed to it, one of which I asked over a dozen times. Now he whines and cries and wonders why no one is interested in answering it's nonsensical questions.

Don't fall for the off-topic nonsense of this gramatically challenged fool.

Ban the boob.

jobby · 28 September 2008

David Stanton said: Just so no one will think any different, this boob has refused to answer at least 37 different questions that I posed to it, one of which I asked over a dozen times. Now he whines and cries and wonders why no one is interested in answering it's nonsensical questions. Don't fall for the off-topic nonsense of this gramatically challenged fool. Ban the boob.
... Yes the FAITH in Darwinism here is very strong here. They have passively admitted that even if the DNA held only ONE BYTE of info that would be enough to construct the whole human body. How ONE BYTE could do all of that is truly, truly miraculous!

Science Avenger · 28 September 2008

Another thread turned into Dorkfest. What purpose does this serve? It only takes one exchange to reveal handjobby's infantile games. After that it is all a rerun, hardly likely to attact new readers. No one on this site has ever given a sound, complete reason why this idiot isn't banned completely, for good, no exceptions. The only one I can think of is that you are trying to drive away your readers.

stevaroni · 28 September 2008

Jobby says.... … there seems to be enough reason to surmise that it is possible that there is not enough room in the DNA to justify doing experiment to validate that hypotheses instead of accepting that hypothesis as fact

”Seems”, “surmise”, “possible”. So many wiggle words. You only need wiggle words when you don't have evidence. In fact, jobby there is no reason at all that you've ever articulated. Just unsupported conjecture on your part. Regardless, if you believe this, despite the total lack of evidence for this conclusion, despite all the evidence against this conclusion, then by all means, go do that “experiment to validate that hypotheses instead of accepting that hypothesis as fact”. Money is available. Go to the Discovery Institutes's website and download a grant form. That's what serous scientists do. They actually test their crackpot ideas. The good ones work. And let's face it, if you can't make a claim the Discovery Institute, purveyor of any and all things that are ID pseudoscience, is sympathetic to, well, you don't have much of a case. Till then, you're just talking out your ass and stalling for time.

Is there an amount of DNA space that any one here would consider to be able to carry out the instructions for growth, body plan, innate behaviors etc?

Yes. 700Mb. We know all the “instructions” fit in there because that's the space available. That does not account for the effects of nurture and culture after the organism is born, but that's another story. In practice, much of what's in the 700Mb seems repetitive or inactive, so the actual “working payload” is probably considerably less, the current best guess is about 15-20% of the available space is actually used. There. I have directly answered your question, so will you please stop insisting that nobody will answer you.

For instance the human genome had only 100 bytes would that be enough? I get the impression here and have heard it said that even ONE byte of info would be enough to construct the human body. Is that the general consensus here.

No. That's not the “general consensus” here. That's just plain stupid quotemining, and it's not even good quotemining at that. The number “one” is from comment # 167428 where Robin points out that you claim a 700Mb genome is insufficient to encode the necessary data, yet you steadfastly refuse to provide any information on how much space it might actually take. She points out that you haven't proven it takes more than 700Mb, in fact you haven't proven that it takes more than one byte. Although, frankly, I'm willing to spot you the point that it probably takes more than one byte, she raises the very valid fact that you can't demonstrate that any of the information you claim is lacking from the (rather large) genome actually exists, because you can't say how much there should be in the first place. (comment http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-167428, just for those keeping me honest) So – oh geez, how do I say this technically – Quit lying, troll.

phantomreader42 · 28 September 2008

jobby said:
stevaroni said:

well any neutral party reading this could see that my opposition has little but wise cracks

Yeah. Well, just that and 227820 peer reviewed research papers on the subject. (as of this afternoon) http://www.ncbi.nlm.nih.gov/pubmed/
pick one of those research papers out that validate Darwinism. and lets go over it
Why, asshat? You'll just lie about reading it, like you did with the Wong/Mi paper. Everyone knows you don't give a flying fuck about the truth, you're just here to whine and lie. Go fuck yourself. You've spent countless pages babbling about how every scientist on earth is wrong, but you have yet to offer anything that even LOOKS like a single speck of evidence. You're a worthless waste of skin, a joke. But at least you're a perfect example of someone immune to evidence. The facts will never penetrate the delusions you've wrapped yourself in. Go away and stop making such an insufferable ass of yourself. If you have a problem with being exposed as a worthless lying troll, then go ahead and offer some damn evidence for your bullshit. Put up or shut up. But we all know you won't, because you can't.

phantomreader42 · 28 September 2008

David Stanton said: Just so no one will think any different, this boob has refused to answer at least 37 different questions that I posed to it, one of which I asked over a dozen times. Now he whines and cries and wonders why no one is interested in answering it's nonsensical questions. Don't fall for the off-topic nonsense of this gramatically challenged fool. Ban the boob.
Yes, it's time to have this fraud auto-junked. He's never had the slightest interest in an honest discussion.

PvM · 28 September 2008

Geocentrism was disproven by data and observations. You have nothing other than your ignorance. Nuff said
jobby said: Surely you can do better than that and explain to us why you believe DNA does not contain sufficient information? ... there seems to be enough reason to surmise that it is possible that there is not enough room in the DNA to justfiy doing experiment to validate that hypotheses instead of accepting that hypothesis as fact only on FAITH and a priori reasoning. At one time most learned individuals assumed the geocentrism based on a priori reasoning. To know in this modern day to accept tenets as fact based on a priori reasoning is certainly a throwback to the middle ages.

PvM · 28 September 2008

What do you think? Geez, now Jobby is arguing with his voices.
jobby said: Let me ask this: Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc? For instance the human genome had only 100 bytes would that be enough? I get the impression here and have heard it said that even ONE byte of info would be enough to construct the human body. Is that the general consensus here?

stevaroni · 28 September 2008

Jobby demands... pick one of those research papers out that validate Darwinism. and lets go over it

That's not even a question. It's like saying "Validate Kansas" Jobby has learned the fine art of looking like he's asked a significant question when he has in fact done nothing of the sort. To prove something is to demonstrate equivalence, and a question of proof needs a secondary verb, as in "Validate that evolution does this". The problem for J is that as soon as you put it in the form of a closed-end question, it's a trivial matter to search Pubmed and find hundreds of good research papers that have actual answers.

PvM · 28 September 2008

Ah but ID proponents have no answers, they at best have questions which originate from their poor understanding of science. I bet Bobby was not even familiar with developmental biology, or he would not have been so clueless in his claims. Fascinating case study though.
stevaroni said:

Jobby demands... pick one of those research papers out that validate Darwinism. and lets go over it

That's not even a question. It's like saying "Validate Kansas" Jobby has learned the fine art of looking like he's asked a significant question when he has in fact done nothing of the sort. To prove something is to demonstrate equivalence, and a question of proof needs a secondary verb, as in "Validate that evolution does this". The problem for J is that as soon as you put it in the form of a closed-end question, it's a trivial matter to search Pubmed and find hundreds of good research papers that have actual answers.

jobby · 28 September 2008

pick one of those research papers out that validate Darwinism. and lets go over it

... it has been claimed here there is overwhelming proof for Darwinism. I am simply asking for any of the posters to specify a study which they would like to go over and see if there really is proof there. This has never happened.

jobby · 28 September 2008

Let me ask this:

Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc?

... no answer yet. Seems like a simple question to me.

Science Avenger · 28 September 2008

Wouldn't you love to see what this guy actually looks like, where he works, and what his coworkers think of him, presuming he is even just one person instead of several? I can't imagine anyone with an even remotely fulfilling life would carry on so. Can you imagine his wife looking over his shoulder saying "Wow, you sure did that well"?

jobby · 28 September 2008

Ah but ID proponents have no answers, they at best have questions which originate from their poor understanding of science.

... I am not an ID nor Darwinism proponent. I am a science proponent.

well I have answered this:

Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc?

I answered that I thought the minimum about of info would be in the terabytes or petabyes.

... but no answer from the Darwinists. So how can the first sentence here be true??

jobby · 28 September 2008

Geocentrism was disproven by data and observations.

... that is exactly what I said. It was not disproven by a priori reasoning.

Is this too difficult of a concept for the Darwinists to grasp?

David Stanton · 28 September 2008

Just for the record, I never made any of the comments that hand jobby is attributing to me.

This jerk still hasn't answered one of my questions and still demands that everyone answer his questions. It even copied and pasted the comment where I pointed out that it hadn't answered the questions and still didn't try to answer even one of them. It just kept repeating the same irrelevant nonsense about FAITH. How is anyone supposed to infer that it has any intelligence or understanding at all if it won't answer reasonable questions, FAITH???

Ban the boob.

PvM · 28 September 2008

Not at all, that's why we have asked you to support your viewpoints. Given the fact that 1. You lack any supporting evidence, logic and reasoning 2. Science shows how indeed gene expression, gene networks seem to be perfectly capable of explaining the development of an embryp we have but to conclude that your position is one of ignorance. Simple really. And I predict, yes a prediction, that Bobby will continue based on his ignorance of science, to argue that since he could not possibly understand it, that science must be wrong.
jobby said: Geocentrism was disproven by data and observations. ... that is exactly what I said. It was not disproven by a priori reasoning. Is this too difficult of a concept for the Darwinists to grasp?

PvM · 28 September 2008

jobby said: Ah but ID proponents have no answers, they at best have questions which originate from their poor understanding of science. ... I am not an ID nor Darwinism proponent. I am a science proponent.

Your ignorance of science places some reasonable doubt on this claim. Again, if it looks like a duck, talks like a duck and is as ignorant as a duck, it must be ... a duck.

PvM · 28 September 2008

Let's make a deal, you show us evidence beyond your appeal to ignorance that DNA lacks the information to generate an embryo and we will provide you with specifics of a relevant research paper which validates Darwinism. I understand why you want to change topics though.
jobby said: pick one of those research papers out that validate Darwinism. and lets go over it ... it has been claimed here there is overwhelming proof for Darwinism. I am simply asking for any of the posters to specify a study which they would like to go over and see if there really is proof there. This has never happened.

PvM · 28 September 2008

jobby said: I answered that I thought the minimum about of info would be in the terabytes or petabyes.
In other words, a clear argument from personal incredulity.

PvM · 28 September 2008

He was banned and returned under another alias, until the moderator of this thread does his job, his presence will continue as a good example of the scientific vacuity of his position. It's a win win really
David Stanton said: Just for the record, I never made any of the comments that hand jobby is attributing to me. This jerk still hasn't answered one of my questions and still demands that everyone answer his questions. It even copied and pasted the comment where I pointed out that it hadn't answered the questions and still didn't try to answer even one of them. It just kept repeating the same irrelevant nonsense about FAITH. How is anyone supposed to infer that it has any intelligence or understanding at all if it won't answer reasonable questions, FAITH??? Ban the boob.

stevaroni · 28 September 2008

… no answer yet. Seems like a simple question to me.

Less than 700Mb, troll. That's a simple answer. Now, you show me where that's not enough.

PvM · 28 September 2008

For instance, propose other sources of information to 'supplement' that which you believe, on faith, is lacking?
stevaroni said:

… no answer yet. Seems like a simple question to me.

Less than 700Mb, troll. That's a simple answer. Now, you show me where that's not enough.

jobby · 28 September 2008

Less than 700Mb, troll.

That’s a simple answer.

Now, you show me where that’s not enough.

... why do you believe that less than 700 MB would not be enough info? FAITH?

stevaroni · 28 September 2008

Oh, and while I'm at it, start with this paper, troll.

Darwin's greatest discovery: design without designer.
http://www.ncbi.nlm.nih.gov/pubmed/17494753

or this one

Darwin's artificial selection as an experiment.
http://www.ncbi.nlm.nih.gov/pubmed/16473266

or this one

The modern theory of biological evolution: an expanded synthesis.
http://www.ncbi.nlm.nih.gov/pubmed/15241603

or this one

Endosymbiosis, cell evolution, and speciation.
http://www.ncbi.nlm.nih.gov/pubmed/17046345

or this one, an oldie, but a goodie on symbiotic evolution.

From extracellular to intracellular: the establishment of mitochondria and chloroplasts.
http://www.ncbi.nlm.nih.gov/pubmed/36620

Now, it's your turn troll.

Either show me your evidence that 700Mb is not big enough or shut up.

(Note, I know he will not actually answer the question, of course, he'll just say the papers are insufficient and change the subject. At this point, I'll just cut and paste my question again, since it's not good to let him play the martyr.

Since he'll never answer the question {he can't answer it}, our exchange may get even more tedious than it has been, so I'll apologize in advance, and suggest the moderator simply close this thread.)

jobby · 28 September 2008

In other words, a clear argument from personal incredulity.

... no from comparisons to other machines.

What do YOU feel would be too little MBs?

stevaroni · 28 September 2008

… why do you believe that less than 700 MB would not be enough info? FAITH?

Because that's the space available. OBSERVATION. Why do you believe that more than 700 MB would required? FAITH?

stevaroni · 28 September 2008

… no from comparisons to other machines.

So show your work. How do you figure out the information required? Faith? Incredulity? Total ignorance? Gotta be one of those, because you've got no data. Either show me your evidence that 700Mb is not big enough or shut up.

PvM · 28 September 2008

Nope. Nice try though. So lets instead focus on Bobby's faith (aka ignorance) which leads him to claim, without any evidence that 700mb may not be enough
jobby said: ... why do you believe that less than 700 MB would not be enough info? FAITH?

PvM · 28 September 2008

Again, you have provided no logical argument especially when people explained to your developmental biology. So stop moving the goalposts and admit you have no arguments. A usual that is.
jobby said: In other words, a clear argument from personal incredulity. ... no from comparisons to other machines. What do YOU feel would be too little MBs?

PvM · 28 September 2008

Bobby won't shut up of course because he lacks the capability to admit his ignorance. We will see more of the usual, moving goalposts, arguments from ignorance, all the while exposing the scientific vacuity of ID.
stevaroni said:

… no from comparisons to other machines.

So show your work. How do you figure out the information required? Faith? Incredulity? Total ignorance? Gotta be one of those, because you've got no data. Either show me your evidence that 700Mb is not big enough or shut up.

stevaroni · 28 September 2008

PvM Bobby won’t shut up of course because he lacks the capability to admit his ignorance. We will see more of the usual, moving goalposts, arguments from ignorance, all the while exposing the scientific vacuity of ID.

Yeah, I know it's hopeless. I've just been calling him on his crap for the sake of the lurkers. That, and I've been in the middle of a monster circuit board layout session for the last 2 weeks and I have to find something to amuse me while I wait for runs to finish. You can only surf so much news, and you can't get real writing done 12 minutes at a time. But bobby is such a dimwitted robot even troll-baiting is getting old. PT should just flush this thread because it has conclusively proved it's premise. IDiots are immune to all data.

jobby · 28 September 2008

Either show me your evidence that 700Mb is not big enough or shut up.

....Either show me your evidence that 700Mb is big enough or shut up.

I feel there is no solid evidence either way on this.

How about YOU???

jobby · 28 September 2008

Oh, and while I’m at it, start with this paper, troll.

Darwin’s greatest discovery: design without designer. http://www.ncbi.nlm.nih.gov/pubmed/17494753

.... lets start with this one. have you read it??

PvM · 28 September 2008

Now Jobby is moving from "700 mb is not enough" to "there is no evidence that DNA contains sufficient information". While a start, Bobby is still ignoring the evidence provided by development biology. How about doing some homework Bobby?
jobby said: Either show me your evidence that 700Mb is not big enough or shut up. ....Either show me your evidence that 700Mb is big enough or shut up. I feel there is no solid evidence either way on this. How about YOU???

PvM · 28 September 2008

Nice attempt to distract. I assume you have abandoned your argument about DNA not containing sufficient information now that you have reduced it to an argument based on personal ignorance? As to the paper, it shows how Darwin, by providing scientific explanations for the facts of evolution allowed for 'design' without the requirement of an intelligent designer (read God). While earlier people had abandoned science in favor for "God created", Darwin showed how the 'design' in nature could be well explained by appeal to laws of nature such as variation and selection. Of course, while Darwin relied on a lot of evidence, science has since then uncovered many more that supported Darwin's thesis. For instance that selection and variation can explain the increase in information in the genome. Of course that's just a tiny fragment of scientific knowledge here. Compare this accomplishment with ID's, which has contributed nothing to our scientific understanding other than insisting we move to the pre-Darwinian days of ignorance and superstition.
jobby said: Oh, and while I’m at it, start with this paper, troll. Darwin’s greatest discovery: design without designer. http://www.ncbi.nlm.nih.gov/pubmed/17494753 .... lets start with this one. have you read it??

PvM · 28 September 2008

To understand how science has been expanding its understanding of how genes form networks of interactions, see for starters

Notes: Graphical Gaussian Models for Genome Data

these gene networks are part of the answer to Bobby's argument from ignorance.

Let's see how Bobby deals with science.

jobby · 28 September 2008

As to the paper, it shows how Darwin, by providing scientific explanations for the facts of evolution allowed for ‘design’ without the requirement of an intelligent designer (read God).

... it seems that this article is a discussion and not an experiment or analysis of data of any kind. Can you show me where data is analyzed??

jobby · 28 September 2008

Now Jobby is moving from “700 mb is not enough” to “there is no evidence that DNA contains sufficient information”.

... well do YOU have evidence it does contain enough info MBs? Or do you base your belief on FAITH?

.... I have said many times before there is not convincing evidence either way. If you have any can you show us???

jobby · 28 September 2008

PvM said: To understand how science has been expanding its understanding of how genes form networks of interactions, see for starters Notes: Graphical Gaussian Models for Genome Data these gene networks are part of the answer to Bobby's argument from ignorance. Let's see how Bobby deals with science.
... Are you trying to make some sort of point or just giving URLs as general information?

jobby · 28 September 2008

Is there any evidence 750 MB are sufficient or is this again a matter of FAITH?

stevaroni · 28 September 2008

Jobby says... I feel there is no solid evidence either way on this.

Bullshit. You've been vigorously arguing against it for 7 days, troll. If you don;t "feel" that way, then you're just agitating, and you should be ignored. So again, why do you think the available space is inadequate, the cornerstone of your entire argument? To quote a certain troll "Could it be - blind FAITH?"

How about YOU???

I've made my view clear. By direct observation, the container is no bigger than 700Mb. There are no other apparent sources of significant "information", nor do any more sources seem to be necessary. That means there is likely at most 700Mb worth of information, whatever "information" might be. My answer, < 700Mb, has not varied, and unlike you, I have a simple, rational, explanation to back up my assertion. One more time, J. How much space do you say we need?

jobby · 28 September 2008

...Can you give me a test that would falsify your assertion that 750 MBs are sufficient.

Of course you know if you cannot, then your hypothesis is not scientific.

jobby · 28 September 2008

One more time, J. How much space do you say we need?

... I answered this already. And I am of course guessing. There would have to be an experiment to validate.

jobby · 28 September 2008

I’ve made my view clear. By direct observation, the container is no bigger than 700Mb. There are no other apparent sources of significant “information”, nor do any more sources seem to be necessary.

... weasel words: apparent, seem.

GOT ANY VERIFIABLE EVIDENCE??

jobby · 28 September 2008

So again, why do you think the available space is inadequate, the cornerstone of your entire argument?

... I answered this already. Look thru the posts.

PvM · 28 September 2008

Of course, that's the nature of this paper.
jobby said: As to the paper, it shows how Darwin, by providing scientific explanations for the facts of evolution allowed for ‘design’ without the requirement of an intelligent designer (read God). ... it seems that this article is a discussion and not an experiment or analysis of data of any kind. Can you show me where data is analyzed??

jobby · 28 September 2008

PvM said: Of course, that's the nature of this paper.
jobby said: As to the paper, it shows how Darwin, by providing scientific explanations for the facts of evolution allowed for ‘design’ without the requirement of an intelligent designer (read God). ... it seems that this article is a discussion and not an experiment or analysis of data of any kind. Can you show me where data is analyzed??
... but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE?

PvM · 28 September 2008

Assuming that your 750 MB is relevant estimate of information, the answer is still that it is not a matter of faith. We observe DNA, we observe how DNA is expressed, we observe how information in DNA is amplified with information from chemistry and physics and local boundary conditions, we know how regulatory networks are involved in creating the necessary features. So all in all, there appears to be no evidence that DNA is not sufficient. Of course, logically speaking there is always a possibility that we find evidence to support Bobby's appeal from personal incredulity but why should we accept his ignorance as evidence of something he has failed to support to be a real objection.
jobby said: Is there any evidence 750 MB are sufficient or is this again a matter of FAITH?

PvM · 28 September 2008

jobby said:
PvM said: Of course, that's the nature of this paper.
jobby said: As to the paper, it shows how Darwin, by providing scientific explanations for the facts of evolution allowed for ‘design’ without the requirement of an intelligent designer (read God). ... it seems that this article is a discussion and not an experiment or analysis of data of any kind. Can you show me where data is analyzed??
... but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE?
Sure, but not until we have finished your argument from personal incredulity. After all, no reason to allow you to move your goalposts once again, especially since your ignorance continues to be exposed.

PvM · 28 September 2008

jobby said:
PvM said: To understand how science has been expanding its understanding of how genes form networks of interactions, see for starters Notes: Graphical Gaussian Models for Genome Data these gene networks are part of the answer to Bobby's argument from ignorance. Let's see how Bobby deals with science.
... Are you trying to make some sort of point or just giving URLs as general information?
My point is to show how you deal with science. I bet you did not even realize the existence of these models. It's an attempt to educate you. Perhaps I am expecting too much here.

PvM · 28 September 2008

jobby said: I’ve made my view clear. By direct observation, the container is no bigger than 700Mb. There are no other apparent sources of significant “information”, nor do any more sources seem to be necessary. ... weasel words: apparent, seem. GOT ANY VERIFIABLE EVIDENCE??
First you...

PvM · 28 September 2008

Once again Bobby has shown us how he proceeds from a position of ignorance while ignoring valid contributions to science. He refuses to acknowledge the data presented to him

What a crock

jobby · 28 September 2008

jobby said:

I’ve made my view clear. By direct observation, the container is no bigger than 700Mb. There are no other apparent sources of significant “information”, nor do any more sources seem to be necessary.

… weasel words: apparent, seem.

GOT ANY VERIFIABLE EVIDENCE??

First you…

... again I do not believe there is sufficient data to say either way on this issue.

... DO YOU AGREE WITH THAT??

jobby · 28 September 2008

My point is to show how you deal with science. I bet you did not even realize the existence of these models.

It’s an attempt to educate you. Perhaps I am expecting too much here.

... I think you are diverting.

… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE?

.... Is there any evidence 750 MB are sufficient or is this again a matter of FAITH?

these are the main focus areas of the thread

PvM · 28 September 2008

Of course not, I have shown how science has progressed and found so far no evidences to support your claims. In fact I have shown how DNA information content is amplified by various processes such as modularity, recursivity and so on. So compare this to your 'argument' which is basically "I am not convinced as I could not possibly envision this to be enough" In other words, science has shown so far that evolutionary development seems sufficient in explaining the formation of an embryo, while all you can do is claim that it may be possible that science is wrong. Sure, such a possibility exists but until there exists any evidence, it is also a vacuous position. I am thus not surprised, given your history, that you once again let your ignorance guide you to support a scientifically vacuous position.
jobby said: jobby said: I’ve made my view clear. By direct observation, the container is no bigger than 700Mb. There are no other apparent sources of significant “information”, nor do any more sources seem to be necessary. … weasel words: apparent, seem. GOT ANY VERIFIABLE EVIDENCE?? First you… ... again I do not believe there is sufficient data to say either way on this issue. ... DO YOU AGREE WITH THAT??

PvM · 28 September 2008

jobby said: My point is to show how you deal with science. I bet you did not even realize the existence of these models. It’s an attempt to educate you. Perhaps I am expecting too much here. ... I think you are diverting. … but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE? .... Is there any evidence 750 MB are sufficient or is this again a matter of FAITH? these are the main focus areas of the thread
I am not diverting, you should not presume that everyone uses diversion like you tend to do. In fact, I want to focus on your 'arguments' or lack thereof. As I have shown, it is not a matter of faith, it is a matter of plain observation based on many studies of embryological development. if you have ANY evidence to the contrary then show it. But as you have already admitted you have no such evidence other than your ignorance. That's quite a lot but still not much worth anything. If you know what I mean.

jobby · 28 September 2008

...Many people believe ID is not science because they feel it is not falsifiable.

....Do any here agree with that analysis??

jobby · 28 September 2008

As I have shown, it is not a matter of faith, it is a matter of plain observation based on many studies of embryological development.

... you have shown me a test that demonstrates that only 750 MB are are needed? I did not see that.

jobby · 28 September 2008

In other words, science has shown so far that evolutionary development seems sufficient in explaining the formation of an embryo,

... *** seems *** ?????? And many people think life *** seems *** designed. I think we should do some testing. Are you against that?

PvM · 28 September 2008

It's not falsifiable because it contains no content. Showing that a Creator is not necessary is not a falsification of ID, just a falsification that a Creator is necessary. The existence of such a Creator is independent of science's abilities to explain.
jobby said: ...Many people believe ID is not science because they feel it is not falsifiable. ....Do any here agree with that analysis??

PvM · 28 September 2008

jobby said: As I have shown, it is not a matter of faith, it is a matter of plain observation based on many studies of embryological development. ... you have shown me a test that demonstrates that only 750 MB are are needed? I did not see that.
I have shown that the information content in DNA appears to be sufficient when studying embryological development. Of course, there could be evidence to suggest that more information is needed but so far that evidence is lacking in details. So in fact, we have the hard work of scientists who show how the expression and suppression of genes explain the development of embryos, I have shown you how little information is needed to create a limb, and how the extension of the length of a limb for instance requires minimal additional information. Let's look at this in a bit more detail to show where you may have gone wrong. We know that the human body contains around 10-100 * 10^12 cells, now assume that a cell requires a single byte to specify it, which allows for 256 different cell types we have 10-100 trillion bytes, which seems to be a reasonable estimate. However, this presumes that each cell requires an independent specification which we know is wrong from our example of the limb: a lengthening of a limb does not require millions of additional bytes to specify the additional cells individually rather the cells divide from previous cells which together with other neighboring cells, gradients, and on/off switches, determine the fate of said organism. Now for simple organisms, science has mapped the exact fate of every single cell involved and can track how gene networks interact to result in said organism. No need for missing information, and of course, while a different picture may emerge when fully mapping the human fate maps, so far the evidence not only strongly supports my position but fails to lend any credibility to yours.

PvM · 28 September 2008

jobby said: In other words, science has shown so far that evolutionary development seems sufficient in explaining the formation of an embryo, ... *** seems *** ?????? And many people think life *** seems *** designed. I think we should do some testing. Are you against that?
Of course not, as I have shown my comments are based on the testing we have done. Now if you have any testing to support your position, then fine. So far, you have shown that the design inference is based on your personal ignorance. I have shown how my claims are based on positive scientific facts. Quite a difference.

PvM · 28 September 2008

On Pharyngula, PZ Myers has provided us with a fascinating example of how a vulva in the nematode C. Elegans evolves.

The fate maps of the c elegans are well known and science is now filling in quickly the developmental pathways that generate these maps.

PvM · 28 September 2008

Other research expands on this

The C. elegans vulva normally derives from three vulval precursor cells (VPCs) that are members of a larger set of six VPCs, P3.p–P8.p. Each of the six VPCs is multipotent, capable of adopting one of three fates, termed primary (10), secondary (20), or tertiary (30) (13–15). The actual fate that each cell adopts depends on intercellular signals: an inductive signal emanating from the gonadal anchor cell (AC), a lateral signal between VPCs, and an inhibitory signal from the surrounding hypodermal syncytium. Despite the ability of each cell to adopt any of the three fates, the pattern of fates adopted by P3.p–P8.p in wild-type animals is always 30 30 20 10 20 30, respectively. VPC fates in wild-type animals are influenced by their distance from the AC: the cell closest to the AC (P6.p) becomes 10, the next closest (P5.p and P7.p) become 20, and the most distant cells (P3.p, P4.p, and P8.p) become 30 (17–19).

Note how intra and inter cellular signalling determine the fate of the various cells involved?

stevaroni · 28 September 2008

… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE?

Again, the question is akin to "Prove Kansas". There are millions of data points that prove various aspects of evolution. I was nice enough to give you 227,000. What specific aspect are you asking about? With 227,000+ possible sources on hand, I can't give you an answer till you ask a specific question. Phrase it in the form of "How does evolution account for this" then I will be happy to give you a more specific answer. Right now, you're asking "Validate Battleship", which means nothing.

stevaroni · 28 September 2008

Once again, Jobby yammers... Many people believe ID is not science because they feel it is not falsifiable. Do any here agree with that analysis??

Well, then, tell me how to falsify it.

stevaroni · 28 September 2008

… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE?

Actually, now that I think of it, the answer to jobby's question is more akin to a textbook treatment rather than a research paper (because, as I noted, research papers tend to concentrate on one specific data point, and jobby wants "the big picture"). Textbooks, especially good, scholarly work aimed at the undergrad level (which is roughly the point where enough prerequisites are on the table that the question "Yes, yes, we have lots of data, but what does it all mean?" can be rationally addressed) might be the more appropriate vehicle for a broad based review. Good collegiate textbooks also have the good habit of scrupulously noting references (research papers are apparently quite important to jobby, wouldn't want to let any sloppy scholarship into our discussions, now would we?). Anybody have a good, solid, textbook they can refer J to?

Stanton · 28 September 2008

Intelligent Design is not science because: a) Intelligent Design explains nothing b)Intelligent Design is a combination of an Appeal to Ignorance and an Appeal to Authority that literally kills scientific inquiry, in that it states that "(insert biological system here) is too complicated to have arisen naturally, therefore, it is evidence of an unknowable, unapproachable, incomprehensible Intelligent Designer who works in ways mortals don't need to understand."
jobby said: ...Many people believe ID is not science because they feel it is not falsifiable. ....Do any here agree with that analysis??

Stanton · 28 September 2008

stevaroni said: Anybody have a good, solid, textbook they can refer J to?
A textbook is only good if the person possesses the all-consuming white-hot desire, unbreakable iron will and bodhisattva-like mental fortitude required to open, read and comprehend it. If the person does not possess these particular attributes, then a textbook is nothing but a useless, kaolin-covered clump of tree carcass.

stevaroni · 28 September 2008

Now, now, now, Stanton, be nice.

It's not jobby's fault that he didn't know what to ask for, after all this is probably the first time he's dealt with science.

I see this all the time in my work, where people come in all day long insisting that they need widget X, and after you talk to them you realize that what they're really after is something completely different, it's just that they don't know the subject, they only know the name of widget X.

Management types, mostly, who think they know a lot more about it than they really do because they read about it in "Popular Science".

I suspect that doctors feel like this all the time when patients come in for erectile dysfunction products. But I digress.

Anyhow, don't feel bad jobby, data confusion happens to us all at one point or another. After all, that's the only explanation, otherwise you'd have to chalk it up to malice or incompetence.

I mean, really, you'd have to be pretty stupid not to understand the scope of a research paper, and we know that isn't the case, right J?

What jobby wants is a definitive picture of the globe, but he's asking for a streetmap. But maps aren't big enough to show what J wants to see. What he needs is an atlas, an anthology of street maps, right J?

After all, I can only assume you're totally motivated by the search for answers, right?

Science Avenger · 28 September 2008

Intelligent design is not science because it is a political creation that amounts to creationism stripped of all its overt references to the gods (in an attempt to get into classrooms past the courts), and all its predictive power (so it can't be disproven). Let's not pretend we haven't caught the magicians at their tricks and don't know exactly what they are doing.

Wayne Francis · 29 September 2008

jobby said: Let me ask this: Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc? For instance the human genome had only 100 bytes would that be enough? I get the impression here and have heard it said that even ONE byte of info would be enough to construct the human body. Is that the general consensus here?
You just don't get it. Your comparison is flawed. You can encode the entire human genome to 1 bit of binary data if you wanted to. That doesn't mean anything. That is your encoding mechanism. It is the same as encoding 1 nucleotide as a 2 digit binary value. Both use compression and encoding techniques. Encoding the human genome to ~750Mb makes the following encoding assumptions. 1) we are representing a complex molecule (nucleotide) as a 2 bit binary value even though each nucleotide represents a few dozen atoms in a specific configuration. Thymine, for instance, has like 34 atoms. 2) we are making the assumption that we are representing only 4 types of nucleotides, adenine, cytosine, guanine and thymine. I personally can ramble off the names of about a dozen more nucleotides that our encoding scheme just ignores to save space. I'm pretty sure there are like another dozen that I don't know the names of. 3) we are ignoring half of the DNA molecule, ie if someone new about RNA/DNA how would they know our string was representing a DNA or RNA molecule? So comparing and binary encoded DNA sequence to an actual DNA sequence means nothing unless you know the encoding mechanism. So would 100 bytes be enough to code for the human genome? Yes, 1 bit would be enough as long as you know the encoding mechanism. Now before you say something like
jobby said on September 27, 2008 7:43 AM : well that is contrary to mainstream info theory. basically your decoder is more complex than your code. well you can go on tap dancing on this but it really doesnt matter.
again learn what information theory really says. Now your real question should be something like, is 450,000,000 base pairs enough information to produce a human. I think not. I think it is some where between 450 million and 3 billion base pairs. Right now we have identified about 450 million base pairs worth of DNA that encode proteins. I'm pretty sure that number will go up and that that more of the 2,550,000,000 remaining base pairs will be found to have some contribution to the development of humans or at least the preservation of the DNA sequence. But then I'm not a biologist. Let me take your misunderstanding of data storage at face value. Given 2 bits = 1 nucleotides would anyone say that 100 bytes would be enough to produce a human. No person with any understanding of DNA would say yes as that is only 400 base pairs long. The answer is "NO" Look here http://www.chr7.org/project.php for information about the human chromosome 7. The smallest gene is 174bp and there are another 862 known genes for chromosome 7. To Jobby, learn a little about what you are reading and trying to say before you open your mouth and say it. That or come in and ask questions. Coming in and saying ~3 billion base pairs is not enough "information" to produce a human is just ignorance. Quote mining, which is what you are doing, does not help your case. When statements like
Human Genome Project he International Human Genome Sequencing Consortium, led in the United States by the National Human Genome Research Institute (NHGRI) and the Department of Energy (DOE), reduce the estimated number of human protein-coding genes from 35,000 to only 20,000-25,000, a surprisingly low number for our species (7).
are made doesn't mean that they don't think that 20,000-25,000 is enough. It means that at that time they expected more but the evidence say that the original assumption of 35,000 was wrong.

Wayne Francis · 29 September 2008

jobby said:
David Stanton said: Just so no one will think any different, this boob has refused to answer at least 37 different questions that I posed to it, one of which I asked over a dozen times. Now he whines and cries and wonders why no one is interested in answering it's nonsensical questions. Don't fall for the off-topic nonsense of this gramatically challenged fool. Ban the boob.
... Yes the FAITH in Darwinism here is very strong here. They have passively admitted that even if the DNA held only ONE BYTE of info that would be enough to construct the whole human body. How ONE BYTE could do all of that is truly, truly miraculous!
No you not understanding what you are asking, as I have pointed out many times, including the post of mine above this one, is the problem. if you are asking if 1 byte = 4bp is enough to produce a human then NO. What we are saying is that 1bit could be used to represent ~3,000,000,000bp and that IS enough to produce a human. Let me ask you this what holds more "information". 10,000 pennies or $100 bill? It depends on the "information" you are talking about if it is the over all money then both have the same amount of "information" yet the 1 bill is much easier to store then the 10,000 pennies. The 10,000 pennies tho have MUCH more information as there is more mass in the 10,000 pennies, much more surface area to the 10,000 pennies. The positions of all the pennies is more then the bill and even if you factor in the complex artwork of the $100 bill to the artwork of the 10,000 pennies there is still more "information" in the pennies. Again, my post while directed at jobby are for the lurkers to give them a better understanding of this discussion and why jobby is an idiot. Not for asking questions but for asking question, making statements (about topics he clearly has no understanding of) and most importantly ignoring the meaning behind the answers that are given to him.

Stanton · 29 September 2008

Also, trying to "convert" DNA into binary or ASCII like jobby/bobby/jacob/hamstrung/balanced/goff is trying to do ignores the fact that the genomic product may be a protein, or some sort of RNA, nor would assuming that a gene is simply biological computer code give any hint of the conformation or structure of the genomic product. And any biologist worth his amylase will tell you that knowing the conformation of a protein or RNA-ase is vital for understanding its function.

But, if you ask me, jobby/bobby/jacob/hamstrung/balanced/goff is just yanking our chains with his claim of how the human genome isn't enough information to produce a human. It's a moronic rehash of his moronic arguments of "why can't a whale go from terrestrial to aquatic in 1000 years," or "if you can't tell me how many miles per hour a whale's nostril moves with each generation, Darwinism doesn't exist," or "transitional forms don't exist" that he was spouting 5 months ago.

He refused to acknowledge anyone's points correcting his maliciously stupid claims then, and he refuses to acknowledge the corrections to his maliciously stupid claims now, as well.

Stanton · 29 September 2008

Wayne Francis said: Again, my post while directed at jobby are for the lurkers to give them a better understanding of this discussion and why jobby is an idiot. Not for asking questions but for asking question, making statements (about topics he clearly has no understanding of) and most importantly ignoring the meaning behind the answers that are given to him.
One slight correction, Wayne: jobby/bobby/jacob/balanced/hamstrung/goff not only ignores the meanings behind the answers given to him, but, ignores the entire answers.

jobby · 29 September 2008

PvM said: Other research expands on this

The C. elegans vulva normally derives from three vulval precursor cells (VPCs) that are members of a larger set of six VPCs, P3.p–P8.p. Each of the six VPCs is multipotent, capable of adopting one of three fates, termed primary (10), secondary (20), or tertiary (30) (13–15). The actual fate that each cell adopts depends on intercellular signals: an inductive signal emanating from the gonadal anchor cell (AC), a lateral signal between VPCs, and an inhibitory signal from the surrounding hypodermal syncytium. Despite the ability of each cell to adopt any of the three fates, the pattern of fates adopted by P3.p–P8.p in wild-type animals is always 30 30 20 10 20 30, respectively. VPC fates in wild-type animals are influenced by their distance from the AC: the cell closest to the AC (P6.p) becomes 10, the next closest (P5.p and P7.p) become 20, and the most distant cells (P3.p, P4.p, and P8.p) become 30 (17–19).

Note how intra and inter cellular signalling determine the fate of the various cells involved?
Please make a synopsis of this article in your own words.

jobby · 29 September 2008

What we are saying is that 1bit could be used to represent ~3,000,000,000bp and that IS enough to produce a human.

... any studies to validate this? Or again just FAITH?

jobby · 29 September 2008

I have shown that the information content in DNA appears to be sufficient when studying embryological development.

... where have you SHOWN this?

jobby · 29 September 2008

In other words, science has shown so far that evolutionary development seems sufficient in explaining the formation of an embryo,

...'SEEMS SUFFICIENT'?? sure I agree that a logical case can be made for that. But where is the supporting experimentation? SCIENCE is not based on a priori reasoning. Well at least not since the rennaisance.

jobby · 29 September 2008

the inability of ID to predict anything about the designer,

... Behe never said this.

jobby · 29 September 2008

Well lets see where we are at:

UNANSWERED:

1…Many people believe ID is not science because they feel it is not falsifiable.

.…Do any here agree with that analysis??

2… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE?

3… again I do not believe there is sufficient data to say either way that DNA has info info to construct and operate a human.

… DO YOU AGREE WITH THAT??

phantomreader42 · 29 September 2008

And now the asshat is trying to distract attention from the dozens of questions he has fled in abject terror from.
jobby said: Well lets see where we are at: UNANSWERED: 1…Many people believe ID is not science because they feel it is not falsifiable. .…Do any here agree with that analysis?? 2… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE? 3… again I do not believe there is sufficient data to say either way that DNA has info info to construct and operate a human. … DO YOU AGREE WITH THAT??
1. ID is not science because IDiots have no interest whatsoever in reality, the whole thing is a scam to lie about creationism. It's fraud from beginning to end. 2. You've been shown countless examples, you just refuse to listen, and lie about reading them. 3. This is just a blatant lie, you've been claiming explicitly, for many pages, that there definitely ISN'T enough information in DNA to do the job, but you can't even pretend to show your work or offer the slightest speck of evidence. In conclusion, Bobby the boob is a worthless lying sack of shit and all his future posts should be automatically deleted as spam.

jobby · 29 September 2008

phantomreader42 said: And now the asshat is trying to distract attention from the dozens of questions he has fled in abject terror from.
jobby said: Well lets see where we are at: UNANSWERED: 1…Many people believe ID is not science because they feel it is not falsifiable. .…Do any here agree with that analysis?? 2… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE? 3… again I do not believe there is sufficient data to say either way that DNA has info info to construct and operate a human. … DO YOU AGREE WITH THAT??
1. ID is not science because IDiots have no interest whatsoever in reality, the whole thing is a scam to lie about creationism. It's fraud from beginning to end. ... that was not the question. trouble reading? 2. You've been shown countless examples, you just refuse to listen, and lie about reading them. ... show me JUST ONE!! 3. This is just a blatant lie, you've been claiming explicitly, for many pages, that there definitely ISN'T enough information in DNA to do the job, but you can't even pretend to show your work or offer the slightest speck of evidence. ... never 'claimed explicitly'. are you lying or just not able to read? In conclusion, Bobby the boob is a worthless lying sack of shit and all his future posts should be automatically deleted as spam.
Either this person cannot read or does not want to answer these very simple questions.

David Stanton · 29 September 2008

Ah yes, the "I know you are but what am I" argument rears it's ugly head once again.

Ban the boob.

fnxtr · 29 September 2008

Man I hope this guy gets laid soon.

phantomreader42 · 29 September 2008

jobby the worthless lying troll said:
phantomreader42 said: 3. This is just a blatant lie, you've been claiming explicitly, for many pages, that there definitely ISN'T enough information in DNA to do the job, but you can't even pretend to show your work or offer the slightest speck of evidence.
... never 'claimed explicitly'. are you lying or just not able to read?
No, you're the illiterate liar, as always. Once again, your post, on September 22 at 7:43PM, in THIS VERY THREAD, explicitly stated this. Here are YOUR OWN WORDS, repeatedly quoted back to you, that you hide from now that it's obvious you don't have the slightest fucking clue what you're talking about.
Jobby the illiterate liar said, and lied about saying: The human genome consists of the equivalent of approximately 750 megabytes of data . This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
You said, in as many words, that there is "no where enough storage space to account for body structures and development info." When asked how much space was needed, or how you determined this, or where the extra info came from, you babbled and whined for pages. Not once did you even attempt to show your work. Because you didn't do any work, you just made an idiotic, unsupported assertion, and demanded everyone take you seriously simply because you're an obnoxious asshole. You've got nothing, you've never had anything, you never will have anything. ID is intellectually and morally bankrupt, just like you. You're the perfect example of an IDiot, whining about bullshit, incapable of supporting your asinine assertions, lying constantly, fleeing in terror from evidence. You demand references, then lie about reading them. You ask the same stupid questions over and over, but you never even bother to clarify your own position, you just lie about what you said, no matter how many times it's pointed out. You've wrapped yourself so tightly in delusions that reality will never penetrate. You're a pathetic, useless dead husk of what may have once been a human being. You've been accused of being a bot, and you might as well be, there's no hope of getting anything out of you but preprogrammed regurgitated bullshit. In conclusion, Bobby the boob shows again that he is a worthless lying sack of shit and all his future posts should be automatically deleted as spam.

SWT · 29 September 2008

Hmmm ...
jobby said:
phantomreader42 said: ...
jobby said: Well lets see where we are at: ...
... 3. This is just a blatant lie, you've been claiming explicitly, for many pages, that there definitely ISN'T enough information in DNA to do the job, but you can't even pretend to show your work or offer the slightest speck of evidence. ... never 'claimed explicitly'. are you lying or just not able to read? ...
...
Time for a playback from 9/25/2008:
jobby said: well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no. Why can't any other poster state an educated guess on this?
It would appear that our friend either has memory issues or has changed his opinion since last week.

phantomreader42 · 29 September 2008

SWT said: Hmmm ...
jobby said:
phantomreader42 said: ...
jobby said: Well lets see where we are at: ...
... 3. This is just a blatant lie, you've been claiming explicitly, for many pages, that there definitely ISN'T enough information in DNA to do the job, but you can't even pretend to show your work or offer the slightest speck of evidence. ... never 'claimed explicitly'. are you lying or just not able to read? ...
...
Time for a playback from 9/25/2008:
jobby said: well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no. Why can't any other poster state an educated guess on this?
It would appear that our friend either has memory issues or has changed his opinion since last week.
So, he's explicitly said this at least twice, on two separate days, and yet he feels he can get away with lying about his own statements. In conclusion, bobby the boob has once again shown that he is a worthless lying sack of shit, and all his future posts should be immediately deleted as spam.

jobby · 29 September 2008

So, he’s explicitly said this at least twice, on two separate days, and yet he feels he can get away with lying about his own statements.

... where liar??

Robin · 29 September 2008

jobby said: My point is that whether the DNA has enough info is unkown. However you are saying you KNOW it does.
False. Nobody has said that this is known. Science just doesn't care about the issue since there is no indication that there is insuffient space.
Must we accept what you say on FAITH or do you have evidence to back up what you believe in?
Nobody except YOU has made any assertion requiring faith. YOU are the one claiming that YOU THINK that 750 MB is insuffient because YOU THINK there's an analogy between computer information storage and human genome information storage. Yet YOU haven't provided any evidence for such. None. So there is no reason for science or any scientists to take your claim seriously.

ben · 29 September 2008

David Stanton said: Ah yes, the "I know you are but what am I" argument rears it's ugly head once again. Ban the boob.
He's already banned, the moderation is just useless. Not feeding the troll might help.

PvM · 29 September 2008

In my previous postings addressing fate maps, developmental biology etc.
jobby said: I have shown that the information content in DNA appears to be sufficient when studying embryological development. ... where have you SHOWN this?

PvM · 29 September 2008

Dembski did, geez, I banned you from my thread and then you repeat the nonsense claim here with no reference.
jobby said: the inability of ID to predict anything about the designer, ... Behe never said this.

PvM · 29 September 2008

I agree with your ignorant statements about Darwinism, that's exactly what I'd expect you to believe. Let's not get distracted though, first it's time to educate you on information in the genome and your ignorance about science. Fair deal? And I did address your first observation. But I guess, you may not have realized that I did. So your homework is to find the thread in which I responded to your first question.
jobby said: Well lets see where we are at: UNANSWERED: 1…Many people believe ID is not science because they feel it is not falsifiable. .…Do any here agree with that analysis?? 2… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE? 3… again I do not believe there is sufficient data to say either way that DNA has info info to construct and operate a human. … DO YOU AGREE WITH THAT??

stevaroni · 29 September 2008

He’s already banned, the moderation is just useless. Not feeding the troll might help.

Yeah. I'm through. I normally respond on the facts, just for the benefit of the lurkers and those who drop in via Google. That way the IDiot talking points don't go unaddressed. But this is ridiculous, even by troll standards. Jobby: "X is true" everybody else: "No. X is false. Here's the data that supports Y" Jobby: "So you agree X is true" everybody else: "No. X is false. We've already told you that. Here's even more data that supports Y" Repeat several hundred times till everybody else gives up... I think at this point the patient, detailed, response of the group, and the vapid emptiness of jobby's one-line replies speaks eloquently enough that I no longer have to worry about casual readers getting any idea that he has a point, or that something is being evaded. (As if there are any casual readers still left at this point). Sure, jobby will go over to Uncommon Descent and claim victory, but he was going to do that anyway, and honesty was never an issue over there to begin with. Goodbye troll. It's been a slice.

jobby · 29 September 2008

Dembski did, geez, I banned you from my thread and then you repeat the nonsense claim here with no reference.

... where? give me the quote! and why are you spamming here?

jobby · 29 September 2008

So your homework is to find the thread in which I responded to your first question.

... you never answered it

PvM · 29 September 2008

Nope logic and observation. Remember how complex a snowflake is and yet the complexity requires quite little information because it is a combination of physics laws, and environment which define how snowflakes form. I understand that you are struggling with your ignorant statement but contrary to you we have indeed outlined the how and what. How does your ignorance compare to how science has progressed? Of course that requires one to be familiar with the status of science. Never mind...
jobby said: What we are saying is that 1bit could be used to represent ~3,000,000,000bp and that IS enough to produce a human. ... any studies to validate this? Or again just FAITH?

jobby · 29 September 2008

In my previous postings addressing fate maps, developmental biology etc.

jobby said:

I have shown that the information content in DNA appears to be sufficient when studying embryological development.

… where have you SHOWN this

---------------- no you have not. quit lying.

PvM · 29 September 2008

In the same thread you responded to. Let's see if you even can support your ignorant statements about what Dembsksi did and did not say.
jobby said: Dembski did, geez, I banned you from my thread and then you repeat the nonsense claim here with no reference. ... where? give me the quote! and why are you spamming here?

PvM · 29 September 2008

Since I have done so, Jobby has all but admitted defeat. All he can do is pretend that it never happened. Fine with me, he will be back with more igorance which we get to pwn and Jobby will continue his ignorance by avoiding anything that was said or argued on this thread.
jobby said: In my previous postings addressing fate maps, developmental biology etc. jobby said: I have shown that the information content in DNA appears to be sufficient when studying embryological development. … where have you SHOWN this ---------------- no you have not. quit lying.

jobby · 29 September 2008

Science just doesn’t care about the issue since there is no indication that there is insuffient space.

... so if there is no indication you ASSUME the assertion is true.

SORRY that is not SCIENCE that is FAITH

PvM · 29 September 2008

Yes I did. Is this your final answer?
jobby said: So your homework is to find the thread in which I responded to your first question. ... you never answered it

PvM · 29 September 2008

In your confused world, anything with which you do not agree appears to be faith and yet when compared to how science explains development, it observes no missing information for the reasons outlined here several times now. And yet, based on ignorance Jobby insists that science does not know enough yet. That's just sad and hilarious at the same time but it exposes the level of scientific vacuity which is so common amongst ID creationists.
jobby said: Science just doesn’t care about the issue since there is no indication that there is insuffient space. ... so if there is no indication you ASSUME the assertion is true. SORRY that is not SCIENCE that is FAITH

jobby · 29 September 2008

n your confused world, anything with which you do not agree appears to be faith

... no I believe since needs data that supports hypotheses. Obviously you do not.

...... Show me the studies that show:

1.750 MB is sufficient
2. complex body plans can evolve from simpler ones via NS

go ahead!

jobby · 29 September 2008

Remember how complex a snowflake is

... a snowflake has little info content while the human body does. really have you ever really studied any of this?

PvM · 29 September 2008

My pleasure. But with one caveat, I am not convinced that your estimate of 750MB has any value, and I'd rather rephrase it to "the information in the DNA is sufficient to create a new organism". As to the second question, I can show you how new complex bodyplans evolved as supported by fossil data, genetic data.I can show you how simple processes of variation and chance inevitably increase the information in the genome. Let me know if you are willing to listen to the arguments this time since you have refused to address the earlier logic and scientific data and I do not want to go through the whole shabam again only to have you deny that I ever presented you data, a position which is trivially shown wrong by my postings, postings which you have either not read or are ignoring. That's not how science works and your behavior belies any of your claims that you are interested in science and data.
jobby said: n your confused world, anything with which you do not agree appears to be faith ... no I believe since needs data that supports hypotheses. Obviously you do not. ...... Show me the studies that show: 1.750 MB is sufficient 2. complex body plans can evolve from simpler ones via NS go ahead!

PvM · 29 September 2008

Aha, now we are getting somewhere. You made a positive argument about the information content of the human body. Surely you can show us how much information content is contained in the human body? Remember the similarity with the snowflake is that much of the information content comes from the laws of physics and the environment. I am pleased to hear you make a claim that requires supporting evidence. Your turn to show how much information content the human body contains. Good luck my dear friend. Show us your data, as you seem to suggest you have studied this.
jobby said: Remember how complex a snowflake is ... a snowflake has little info content while the human body does. really have you ever really studied any of this?

PvM · 29 September 2008

Now some papers

Abstract Complex spatial or temporal patterns emerge when simple systems are driven from equilibrium in ways that cause them to undergo instabilities. Dendritic (i.e. snowflake-like) crystal growth is a specially clear example of such phenomena. We now have a well tested and remarkably detailed theory of how dendrites form and grow. We understand the role of intrinsically small effects such as crystalline anisotropy, and we even can trace the growth of dendritic sidebranches all the way back to their origins as microscopic thermal fluctuations. This extreme sensitivity to perturbations explains many long-standing puzzles about snowflakes. It is likely to be a characteristic feature of pattern-forming systems in general, including those that occur in biology. If so, we must be prepared for many challenges and surprises in this field.

Robin · 29 September 2008

jobby said: Science just doesn’t care about the issue since there is no indication that there is insuffient space. ... so if there is no indication you ASSUME the assertion is true. SORRY that is not SCIENCE that is FAITH
What assertion? There is no assertion about the storage being suffient. There is only YOUR assertion that it isn't and yet you STILL haven't provided any evidence for why anyone should accept your claim. So at this point I'm done with you Jobo since you refuse to provide anything of value. Have a fun in your delusions.

jobby · 29 September 2008

What assertion? There is no assertion about the storage being suffient.

... You do not feel the storage is sufficient?

PvM · 29 September 2008

The claim that a snowflake has little information content appears to be a common fallacy, understandably because many people may presume that snowflakes are incredibly symmetric and thus, a description shape and form can be reduced, meaning, that fewer information is needed to generate what appears to be quite complex forms. However, contrary to common opinion, snowflakes seldomly tend to be perfectly symmetric nor do they have the same basic shape. Both the shape and the symmetry depend strongly on the local parameters when these shapes are formed. A good example can be found here In otherwords, these pattern formation are typically at 'far from equilibrium' and 'emergent' where the sum of the cells/molecules is less than the final pattern because they are guided by complex interactions. These emergent properties, which are caused by local parameters help understand why embryogenesis is more than just determined by the information in the genes. It depends strongly on the surroundings, and neighboring cells for instance, where patterns are shaped through laws of physics as well as feedback and feedforward loops in a complex genetic network.
PvM said: Aha, now we are getting somewhere. You made a positive argument about the information content of the human body. Surely you can show us how much information content is contained in the human body? Remember the similarity with the snowflake is that much of the information content comes from the laws of physics and the environment. I am pleased to hear you make a claim that requires supporting evidence. Your turn to show how much information content the human body contains. Good luck my dear friend. Show us your data, as you seem to suggest you have studied this.
jobby said: Remember how complex a snowflake is ... a snowflake has little info content while the human body does. really have you ever really studied any of this?

jobby · 29 September 2008

PvM said: Now some papers

Abstract Complex spatial or temporal patterns emerge when simple systems are driven from equilibrium in ways that cause them to undergo instabilities. Dendritic (i.e. snowflake-like) crystal growth is a specially clear example of such phenomena. We now have a well tested and remarkably detailed theory of how dendrites form and grow. We understand the role of intrinsically small effects such as crystalline anisotropy, and we even can trace the growth of dendritic sidebranches all the way back to their origins as microscopic thermal fluctuations. This extreme sensitivity to perturbations explains many long-standing puzzles about snowflakes. It is likely to be a characteristic feature of pattern-forming systems in general, including those that occur in biology. If so, we must be prepared for many challenges and surprises in this field.

... well what does this show??

jobby · 29 September 2008

The claim that a snowflake has little information content appears to be a common fallacy,

... mainstream science seems to think so. well of course you might not be in step with them.

PvM · 29 September 2008

Begging the question, another common logical fallacy, predicted by at least a poster on this thread as to how Jobby behaves. Jobby is apparently not that interested in exploring the facts and actual position of people, but rather likes to think in overly simplistic terms. Of course, Bobby has made a positive claim now about the complexity and information content of the human body, and let's hold him to support his claims. My prediction 1) Bobby will ignore the requests 2) Bobby will attempt to change the topic 3) Bobby will disappear for a while only to return later in another thread pretending that nothing happened.
jobby said: What assertion? There is no assertion about the storage being suffient. ... You do not feel the storage is sufficient?

PvM · 29 September 2008

Let's not confuse Dembski with 'mainstream science'. Why not focus on my claims. Or read some factual materials such as this faq at Caltech Surprise us and engage in an actual conversation based on facts rather than on meaningless one liners. After all, you did claim you are interested in science and data, so why do you have to ignore such science and data when presented to you?
jobby said: The claim that a snowflake has little information content appears to be a common fallacy, ... mainstream science seems to think so. well of course you might not be in step with them.

PvM · 29 September 2008

Can you not read? Complex patterns emerge when simple systems are driven from equilibrium, which is likely a common theme in pattern formation, including those found in biology. Simple systems, can become emergent systems through the interactions of local gradients, local feedback and feedforward patterns to lead to complex patterns which could not have been predicted from the overall properties without understanding the local parameters. Morphogenesis, emergent systems... Surely you should be interested in such systems since you claim that based on your best understanding of science, you consider the amount of information in DNA to be insufficient? Or was your negative argument based, as is so typical with ID claims, on a position of ignorance and personal incredulity? You in fact hinted at such when you 'refined' your claims to meet the standards of personal incredulity? Show us some hint that you understand how patterns form in biology? Surely you do not seem to believe that to add another inch of leg, millions of bytes of information are necessary. The answer to this riddle can be found in the answer to the larger issue as to whether or not DNA contains sufficient information.
jobby said:
PvM said: Now some papers

Abstract Complex spatial or temporal patterns emerge when simple systems are driven from equilibrium in ways that cause them to undergo instabilities. Dendritic (i.e. snowflake-like) crystal growth is a specially clear example of such phenomena. We now have a well tested and remarkably detailed theory of how dendrites form and grow. We understand the role of intrinsically small effects such as crystalline anisotropy, and we even can trace the growth of dendritic sidebranches all the way back to their origins as microscopic thermal fluctuations. This extreme sensitivity to perturbations explains many long-standing puzzles about snowflakes. It is likely to be a characteristic feature of pattern-forming systems in general, including those that occur in biology. If so, we must be prepared for many challenges and surprises in this field.

... well what does this show??

jobby · 29 September 2008

The snowflake is an very simple example of self-assembly. There is no blueprint or genetic code that guides the growth of a snowflake, yet marvelously complex structures appear,

.... well of course those information-poor repetitive structures can happen but not an asymetrical complex plan like the human body. 2 different scenarios

... anyhow enough apriori.... where is your experiment to validate your hypothesis.... you do believe in the scientific method.. dont YOU??

jobby · 29 September 2008

Let’s not confuse Dembski with ‘mainstream science’.

... never said Dembski was mainstream... really where do you get these ideas??

Robin · 29 September 2008

Quite so, PvM. After reading a few posts from this weekend, it has become quickly apparent that posting the same responses to Jobo's claims while expecting Jobo to a) read them, b) understand them, and c) provide evidence for his claims is the definition of insanity.
PvM said: Begging the question, another common logical fallacy, predicted by at least a poster on this thread as to how Jobby behaves. Jobby is apparently not that interested in exploring the facts and actual position of people, but rather likes to think in overly simplistic terms. Of course, Bobby has made a positive claim now about the complexity and information content of the human body, and let's hold him to support his claims. My prediction 1) Bobby will ignore the requests 2) Bobby will attempt to change the topic 3) Bobby will disappear for a while only to return later in another thread pretending that nothing happened.
jobby said: What assertion? There is no assertion about the storage being suffient. ... You do not feel the storage is sufficient?

David Stanton · 29 September 2008

It shows that there is more that enough information in the snowflake genome to produce the structure of the snow flake!!!

jobby · 29 September 2008

Surely you do not seem to believe that to add another inch of leg, millions of bytes of information are necessary.

... adding another inch of leg is not that easy. it would require at least megs if not gigs.

... you do know the femur and and the tibia are not uniform in shape and width thru its length. and the nerve attachments are in different places and the plantaris adheres in a very odd way and the capella.

it is far, far, far more complex than adding another layer of bricks to a wall. even the skin which is prob the most simplistic organ has myriads of variations and structure differentiations.

have you studied any of this at all?

phantomreader42 · 29 September 2008

jobby said:
PvM said: Now some papers

Abstract Complex spatial or temporal patterns emerge when simple systems are driven from equilibrium in ways that cause them to undergo instabilities. Dendritic (i.e. snowflake-like) crystal growth is a specially clear example of such phenomena. We now have a well tested and remarkably detailed theory of how dendrites form and grow. We understand the role of intrinsically small effects such as crystalline anisotropy, and we even can trace the growth of dendritic sidebranches all the way back to their origins as microscopic thermal fluctuations. This extreme sensitivity to perturbations explains many long-standing puzzles about snowflakes. It is likely to be a characteristic feature of pattern-forming systems in general, including those that occur in biology. If so, we must be prepared for many challenges and surprises in this field.

... well what does this show??
That you are an illiterate liar who demands references then makes no effort whatsoever to read or understand them.

phantomreader42 · 29 September 2008

jobby the illiterate fraud said: What assertion? There is no assertion about the storage being suffient. ... You do not feel the storage is sufficient?
Once again, since you're obviously stupid and illiterate as well as dishonest, YOU are the one who has been claiming the storage is insufficient FOR AN ENTIRE WEEK, without even attempting to provide the slightest speck of evidence in support of this idiotic assertion. And don't bother saying you never said that, you've been quoted enough times.
Jobby the illiterate liar said, and lied about saying: The human genome consists of the equivalent of approximately 750 megabytes of data . This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
jobby the worthless lying troll said, and lied about saying: well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no. Why can’t any other poster state an educated guess on this?
In conclusion, bobby the boob is a worthless lying troll in the advanced stages of clinical brain death, and all his future posts should be automatically deleted as spam.

David Stanton · 29 September 2008

Is there enough information in the human genome to make that guy who played "mini me" in the Austin powers movies? Now, is there enough information in the human genome in order to produce Shaqeal ONeil? Now, is the amount of DNA in each genome the same? Now, will somebody please ban the boob?

PvM · 29 September 2008

Yes, developmental biology it's called. Your ignorance of this was successfully predicted and you inabilities to define the amount of information in the human body, all show a basic level of scientific vacuity
jobby said: Surely you do not seem to believe that to add another inch of leg, millions of bytes of information are necessary. ... adding another inch of leg is not that easy. it would require at least megs if not gigs. ... you do know the femur and and the tibia are not uniform in shape and width thru its length. and the nerve attachments are in different places and the plantaris adheres in a very odd way and the capella. it is far, far, far more complex than adding another layer of bricks to a wall. even the skin which is prob the most simplistic organ has myriads of variations and structure differentiations. have you studied any of this at all?

jobby · 29 September 2008

PvM said: Yes, developmental biology it's called. Your ignorance of this was successfully predicted and you inabilities to define the amount of information in the human body, all show a basic level of scientific vacuity
jobby said: Surely you do not seem to believe that to add another inch of leg, millions of bytes of information are necessary. ... adding another inch of leg is not that easy. it would require at least megs if not gigs. ... you do know the femur and and the tibia are not uniform in shape and width thru its length. and the nerve attachments are in different places and the plantaris adheres in a very odd way and the capella. it is far, far, far more complex than adding another layer of bricks to a wall. even the skin which is prob the most simplistic organ has myriads of variations and structure differentiations. have you studied any of this at all?
YOU are the one that is IGNORANT. WHY ARE YOU IN THIS THREAD??? You 'banned' me from yours but cannot stay away from me down here. You need help!

jobby · 29 September 2008

Once again, since you’re obviously stupid and illiterate as well as dishonest, YOU are the one who has been claiming the storage is insufficient FOR AN ENTIRE WEEK, without even attempting to provide the slightest speck of evidence in support of this idiotic assertion.

... you must be hallucintating. where did I claim the storage was insufficient?

DO YOU FEEL THE STORAGE IS SUFFICIENT???? Y/N???

jobby · 29 September 2008

phantomreader42 said:
jobby said:
PvM said: Now some papers

Abstract Complex spatial or temporal patterns emerge when simple systems are driven from equilibrium in ways that cause them to undergo instabilities. Dendritic (i.e. snowflake-like) crystal growth is a specially clear example of such phenomena. We now have a well tested and remarkably detailed theory of how dendrites form and grow. We understand the role of intrinsically small effects such as crystalline anisotropy, and we even can trace the growth of dendritic sidebranches all the way back to their origins as microscopic thermal fluctuations. This extreme sensitivity to perturbations explains many long-standing puzzles about snowflakes. It is likely to be a characteristic feature of pattern-forming systems in general, including those that occur in biology. If so, we must be prepared for many challenges and surprises in this field.

... well what does this show??
That you are an illiterate liar who demands references then makes no effort whatsoever to read or understand them.
DDDDDDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHHHHH!!!!!!!!!!!!! of course the above is true but it is not apply to any issues here? Do you people even read what you post here?

Dave Lovell · 29 September 2008

jobby said: ... adding another inch of leg is not that easy. it would require at least megs if not gigs.
Are you aware that some people have their limb length corrected by breaking bones and slowly jacking the ends apart at the bone grows? Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely?

jobby · 29 September 2008

Well observers: we can see that none of the posters will say that 750 MB is enough storage. And they cannot even say 1 MB is to few.

Here is the reason: this cannot be falsified. And tho they claim ID cannot be falsfied and therefore not science in reality this storage amount cannot be falsified making also Darwinism not science by this criteria.

jobby · 29 September 2008

Are you aware that some people have their limb length corrected by breaking bones and slowly jacking the ends apart at the bone grows? Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely?

.........DDDDDDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHH!!!!!!!!!!

that lengthening is done by ID. The amount of bits of information used by the humans doing that is enormous.

You really dont get all of this do you?

PvM · 29 September 2008

I understand that Bobby may not appreciate the sciences, and again in this case, the breaking of the bones are indeed by ID, however the reconstruction is done through natural processes. Of course, one can extend this to animals which can regrow a whole limb. And note how Bobby still not has addressed the information contained in a human body. I am a patient person, no worries Bobby, you get all the time to expose your 'knowledge'. When can we expect the first attempt?
jobby said: Are you aware that some people have their limb length corrected by breaking bones and slowly jacking the ends apart at the bone grows? Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely? .........DDDDDDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHH!!!!!!!!!! that lengthening is done by ID. The amount of bits of information used by the humans doing that is enormous. You really dont get all of this do you?

PvM · 29 September 2008

jobby said: YOU are the one that is IGNORANT. WHY ARE YOU IN THIS THREAD??? You 'banned' me from yours but cannot stay away from me down here. You need help!
Oh, I don't think I am the one needing help. So remind us again how much information does the human body contain? Or was that just one of your vacuous comments?

PvM · 29 September 2008

A classical logical fallacy based on ignorance. As to the storage amount, how much information is contained in the human body? Perhaps then we can determine if the information stored in the DNA is insufficient, independent of meaningless measurements of 'information'. So let's start with another example: How much information is contained in a protein with let's say 200 bases? A zeroth order estimate is 2 bits per nucleotide, or 400 bits. Now ask yourself, how much information exists in the primary structure, tertiary structure and quaternary structures of proteins?

Like all other complex biological systems, proteins exhibit properties not seen in free amino acids (i.e., emergent properties). The present investigation arose from the deduction that proteins should offer a good model to approach the reverse phenomenon, namely top-down constraints experienced by protein residues compared to free amino acids. The crystalline structure of profilin Ib, a contractile protein of Acanthamoeba castel-lanii, was chosen as the object of study and submitted to 2-ns molecular dynamics simulation. The results revealed strong conformational constraints on the side chain of residues compared to the respective free amino acids. A Shannon entropy (SE) analysis of the conformational behavior of the side chains showed in most cases a strong decrease in the SE of the Χ1 and Χ2 dihedral angles compared to free amino acids. This is equivalent to stating that conformational constraints on the side chain of residues increase their information content and hence recognition specificity compared to free amino acids. In other words, the vastly increased information content of a protein relative to its free monomers is embedded not only in the tertiary structure of the backbone, but also in the conformational behavior of the side chains. The postulated implication is that both backbone and side chains, by virtue of being conformationally constrained, contribute to the recognition specificity of the protein toward other macromolecules and ligands.

the complexity in proteins emerges from the properties of independent base nucleotides and the laws of physics, where the various angles and rotations are determined by the interaction of all the nucleotides. At all levels we find how complexity is affected by emergent processes.
jobby said: Well observers: we can see that none of the posters will say that 750 MB is enough storage. And they cannot even say 1 MB is to few. Here is the reason: this cannot be falsified. And tho they claim ID cannot be falsfied and therefore not science in reality this storage amount cannot be falsified making also Darwinism not science by this criteria.

fnxtr · 29 September 2008

POE!

jobby · 29 September 2008

however the reconstruction is done through natural processes

... the setting of the bones is done by humans. PUUUULLLLLEEEEZZZZZ!

jobby · 29 September 2008

the complexity in proteins emerges from the properties of independent base nucleotides and the laws of physics, where the various angles and rotations are determined by the interaction of all the nucleotides.

.....SO WHAT!!

the proteins a merely bricks in the building. JEEEZZZ!

David Stanton · 29 September 2008

RIGHT. PROTEINS ARE MERELY BRICKS. HA HA HA.

Now, according to hand jobby, Shaqeal should have a genome size about five times the size of Vern's. And it expects us to accept this on FAITH!!!

Ban the boob.

jobby · 29 September 2008

David Stanton said: RIGHT. PROTEINS ARE MERELY BRICKS. HA HA HA. Now, according to hand jobby, Shaqeal should have a genome size about five times the size of Vern's. And it expects us to accept this on FAITH!!! Ban the boob.
WOW! what else can I say?

PvM · 29 September 2008

This is rather helpful as it shows the level of scientific vacuity to which Bobby is willing to sink. If he does not even understand how the information of the DNA is expressed in the organism and refuses to learn then indeed, he is doomed to ignorant 'observations' and 'claims'.

PvM · 29 September 2008

A good example of how the overly simplistic view of the genome by Bobby ignores the various fascinating findings. For instance alternative splicing. From Wikipedia

Alternative splicing is of great importance to genetics - it invalidates the old theory of one DNA sequence coding for one polypeptide (the "one-gene-one-protein" hypothesis). External information is needed in order to decide which polypeptide is produced, given a DNA sequence and pre-mRNA. (This does not necessarily negate the central dogma of molecular biology which is about the flow of information from genes to proteins). Since the methods of regulation are inherited, the interpretation of a mutation may be changed.

I'd suggest Bobby reads "Alternative splicing and genome complexity" in Nature to get up to date with science here.

Another source may be post-translational modifications; more than 200 different types are known, and it is predicted that, on average, for each human gene three different modified proteins with different functions are produced (reviewed in ref. 3). Finally, alternative splicing of human genes might provide many more proteins per gene than in other organisms4, 6. Although it has long been assumed that only five percent of human genes are alternatively spliced7, more recent estimates based on ESTs mapped onto mRNA sequences indicate a much higher rate of alternative splicing in human genes8, 9, 10. It has also become clear that the estimates increase with EST coverage (Fig. 1)6, 11, and, by including human genomic data, it was predicted that at least 50% of the human genes are subjected to alternative splicing1, 2

And that's just in the first few steps of DNA to protein...
PvM said: This is rather helpful as it shows the level of scientific vacuity to which Bobby is willing to sink. If he does not even understand how the information of the DNA is expressed in the organism and refuses to learn then indeed, he is doomed to ignorant 'observations' and 'claims'.

r · 29 September 2008

jobby/bobby/whatever reminds me of some students I knew at university who would disagree about anything and who did not care (or perhaps know) how inane their arguments were. They clearly thought they had reached the pinnacle of debating ability and astuteness; as far as I was concerned they were a juvenile bunch of oxygen thieves.

David Stanton · 29 September 2008

Nice try PvM. I tried to get this dill weed to learn something about alternative splicing about four days ago. Good luck. Oh well, at least you are doing a good job of preventing it from contaminating other threads.

Ban the boob.

Science Avenger · 29 September 2008

jobby said: WOW! what else can I say?
How about "I'm an ignorant jerk off who needs to get laid". That would pretty much cover it.

Science Avenger · 29 September 2008

Hamdjobby reminds me of some ignorant biker chicks I lived with in college who thought "never losing an argument" meant "never willing to STFU". The idea of an objective, logical standard of measurement never occurred to them.

Wayne Francis · 29 September 2008

jobby said:
PvM said: Now some papers

Abstract Complex spatial or temporal patterns emerge when simple systems are driven from equilibrium in ways that cause them to undergo instabilities. Dendritic (i.e. snowflake-like) crystal growth is a specially clear example of such phenomena. We now have a well tested and remarkably detailed theory of how dendrites form and grow. We understand the role of intrinsically small effects such as crystalline anisotropy, and we even can trace the growth of dendritic sidebranches all the way back to their origins as microscopic thermal fluctuations. This extreme sensitivity to perturbations explains many long-standing puzzles about snowflakes. It is likely to be a characteristic feature of pattern-forming systems in general, including those that occur in biology. If so, we must be prepared for many challenges and surprises in this field.

... well what does this show??
That you ask for something and when given it you don't read it and pretend that it doesn't answer your question.

Wayne Francis · 29 September 2008

jobby said: The claim that a snowflake has little information content appears to be a common fallacy, ... mainstream science seems to think so. well of course you might not be in step with them.
Jobby keeps making this claim that mainstream science/information theory/some other shit says something. Either he doesn't provide a reference or quote mines/misinterprets the quote. Please Jobby, site the many papers you have read that says that snowflakes have little information content. Your "gut feel" does NOT constitute mainstream anything views.

tresmal · 29 September 2008

fnxtr said: Man I hope this guy gets laid soon.
That is by far the most misogynistic statement I have ever encountered on the web. You should be ashamed of yourself. :)

Stanton · 30 September 2008

tresmal said:
fnxtr said: Man I hope this guy gets laid soon.
That is by far the most misogynistic statement I have ever encountered on the web. You should be ashamed of yourself. :)
No, he meant "laid" as in "laid out on a psychiatrist's couch"

Wayne Francis · 30 September 2008

jobby said: Once again, since you’re obviously stupid and illiterate as well as dishonest, YOU are the one who has been claiming the storage is insufficient FOR AN ENTIRE WEEK, without even attempting to provide the slightest speck of evidence in support of this idiotic assertion. ... you must be hallucintating. where did I claim the storage was insufficient? DO YOU FEEL THE STORAGE IS SUFFICIENT???? Y/N???
I'll answer the "DO YOU FEEL..." question first. Yes, I know that ~3 billion base pairs of DNA is sufficient to produce a human because we see the DNA produce proteins that build, control, facilitate cell division and development every day in the lab. Now to your "you must be hallucintating. where did I claim the storage was insufficient?" comment. Below are over a dozen times where you have made JUST that claim. As 'Rev Dr' Lenny Flank would say Jobby is a liar. A deliberate, bare, bald-faced, unashamed liar. With malice aforethought.
jobby said on September 22, 2008 7:43 PM : The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
jobby said on September 23, 2008 2:54 PM “Human DNA doesn’t contain enough information to make a human”. And then you have to try to explain where babies come from. DDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHHH!!!!!!!!!!1 There could be other information sources.
jobby said on September 23, 2008 4:15 PM Where did the information come from if not the DNA? The world of physics is much stranger than what our intuitive knowledge can comprehend. We have gone from atoms to electrons to quarks to strangeness to kaons etc. At each stage they were surprised that smaller and smaller particles. The DNA was a big shock. One gig is cannot store enough info to account for the mappings or all the body structures AND the the physiology. A computers OS cannot run on one gig how can an animals body. And that does not include the developmental instructions. I know you want to believe in your world view. But your faith is making you blind.
jobby said on September 23, 2008 6:31 PM ...removed way to much spam... Jeez say he is off by a factor of 1000 say it stores 750 gigs. still not enough.
jobby said on September 24, 2008 6:01 AM
Wayne Francis said : The genetic “blue print” is so robust that the builders (Cells) can cope with unexpected changes like while building the spinal cord and finding there is not far away it can merge the 2.
… and all of this is done in 750 megs of instructions! Truly miraculous!
jobby said on September 25, 2008 7:25 AM Seems to me that the amount of information to make a human might only require 1 byte of space TOTAL and thus our genome may well have 749.99999 MB of space left. … I just love this one. Wow all the instructions for the human body plan, the physiology and behavior insturctions in one little byte. Truly truly miraculous. And you think that feeding 50 people with a couple of fish and loaves is a miracle
Let it be known that hand jobby didn't even quote mine to get the first sentence. he jerked off is own stupid logic to arrive at that. It was said that the human genome could be encoded into 1 byte. NOT that if the human genome is encoded to 750Mb that there would be 749Mb 1023Kb 1023b of unnecessary information.
jobby said on September 25, 2008 12:50 PM Where is the proof that there is enough info in the DNA?
jobby said on September 25, 2008 4:38 PM Youre a dummy: How do we know the DNA has enough space, imbecile??
jobby said on September 25, 2008 7:47 PM well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no. Why can’t any other poster state an educated guess on this?
jobby said on September 26, 2008 6:24 AM I’m quiet sure that the book would end up orders of magnitude smaller then the original. … there is limit to how far info can be compressed you never answered: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Why cant you just say yes or no? I said no. I am forthcoming and not a coward to make a claim. Obviously you are neither
jobby said on September 26, 2008 8:14 AM you never answered: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Why cant you just say yes or no? I said no. I am forthcoming and not a coward to make a claim. Obviously you are neither
Note the 2 post above ARE different, posted about 1 hour and 45 min apart.
jobby said on September 26, 2008 3:26 PM So this sets an upper limit of about 750MB of raw information in human DNA. Is this enough to build a human? It seems to work millions of times every day, so surely the question for a scientist is to try to explain how, as there is no other source of larger amounts of information without resorting to particle physics (or homeopathy). .….wrong again: how do you know there is no other source?
jobby said on September 26, 2008 4:45 PM So there you go. 750 - 800 megabytes is plenty of information to make a picture of a human being. .….… DUH. were not making pictures here. We are constructing a very, very complicated machine.
jobby said on September 27, 2008 12:23 PM 800 megabytes can do all those functions? truly miraculous!! makes the loaves and fishes story in the bible look more and more believable. and Noah’s Ark even seem possible to hold all the animals! you have unending FAITH!
jobby said on September 28, 2008 9:34 AM Yes the FAITH in Darwinism here is very strong here. They have passively admitted that even if the DNA held only ONE BYTE of info that would be enough to construct the whole human body. How ONE BYTE could do all of that is truly, truly miraculous!
Now again this is Hand Jobby's own style of quote mining. If the entire human genome was digitally encoded to 1 byte then YES 1 byte would be enough.
jobby said on September 28, 2008 1:05 PM Ah but ID proponents have no answers, they at best have questions which originate from their poor understanding of science. … I am not an ID nor Darwinism proponent. I am a science proponent. well I have answered this: Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc? I answered that I thought the minimum about of info would be in the terabytes or petabyes. … but no answer from the Darwinists. So how can the first sentence here be true??
note that the above post hinges on the fact he keeps saying that their is only ~750Mb of "information" in the human genome.

jobby · 30 September 2008

Wayne Francis said:
jobby said: Once again, since you’re obviously stupid and illiterate as well as dishonest, YOU are the one who has been claiming the storage is insufficient FOR AN ENTIRE WEEK, without even attempting to provide the slightest speck of evidence in support of this idiotic assertion. ... you must be hallucintating. where did I claim the storage was insufficient? DO YOU FEEL THE STORAGE IS SUFFICIENT???? Y/N???
I'll answer the "DO YOU FEEL..." question first. Yes, I know that ~3 billion base pairs of DNA is sufficient to produce a human because we see the DNA produce proteins that build, control, facilitate cell division and development every day in the lab. Now to your "you must be hallucintating. where did I claim the storage was insufficient?" comment. Below are over a dozen times where you have made JUST that claim. As 'Rev Dr' Lenny Flank would say Jobby is a liar. A deliberate, bare, bald-faced, unashamed liar. With malice aforethought.
jobby said on September 22, 2008 7:43 PM : The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
jobby said on September 23, 2008 2:54 PM “Human DNA doesn’t contain enough information to make a human”. And then you have to try to explain where babies come from. DDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHHH!!!!!!!!!!1 There could be other information sources.
jobby said on September 23, 2008 4:15 PM Where did the information come from if not the DNA? The world of physics is much stranger than what our intuitive knowledge can comprehend. We have gone from atoms to electrons to quarks to strangeness to kaons etc. At each stage they were surprised that smaller and smaller particles. The DNA was a big shock. One gig is cannot store enough info to account for the mappings or all the body structures AND the the physiology. A computers OS cannot run on one gig how can an animals body. And that does not include the developmental instructions. I know you want to believe in your world view. But your faith is making you blind.
jobby said on September 23, 2008 6:31 PM ...removed way to much spam... Jeez say he is off by a factor of 1000 say it stores 750 gigs. still not enough.
jobby said on September 24, 2008 6:01 AM
Wayne Francis said : The genetic “blue print” is so robust that the builders (Cells) can cope with unexpected changes like while building the spinal cord and finding there is not far away it can merge the 2.
… and all of this is done in 750 megs of instructions! Truly miraculous!
jobby said on September 25, 2008 7:25 AM Seems to me that the amount of information to make a human might only require 1 byte of space TOTAL and thus our genome may well have 749.99999 MB of space left. … I just love this one. Wow all the instructions for the human body plan, the physiology and behavior insturctions in one little byte. Truly truly miraculous. And you think that feeding 50 people with a couple of fish and loaves is a miracle
Let it be known that hand jobby didn't even quote mine to get the first sentence. he jerked off is own stupid logic to arrive at that. It was said that the human genome could be encoded into 1 byte. NOT that if the human genome is encoded to 750Mb that there would be 749Mb 1023Kb 1023b of unnecessary information.
jobby said on September 25, 2008 12:50 PM Where is the proof that there is enough info in the DNA?
jobby said on September 25, 2008 4:38 PM Youre a dummy: How do we know the DNA has enough space, imbecile??
jobby said on September 25, 2008 7:47 PM well observers what do you think: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? My answer is a definite no. Why can’t any other poster state an educated guess on this?
jobby said on September 26, 2008 6:24 AM I’m quiet sure that the book would end up orders of magnitude smaller then the original. … there is limit to how far info can be compressed you never answered: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Why cant you just say yes or no? I said no. I am forthcoming and not a coward to make a claim. Obviously you are neither
jobby said on September 26, 2008 8:14 AM you never answered: Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior? Why cant you just say yes or no? I said no. I am forthcoming and not a coward to make a claim. Obviously you are neither
Note the 2 post above ARE different, posted about 1 hour and 45 min apart.
jobby said on September 26, 2008 3:26 PM So this sets an upper limit of about 750MB of raw information in human DNA. Is this enough to build a human? It seems to work millions of times every day, so surely the question for a scientist is to try to explain how, as there is no other source of larger amounts of information without resorting to particle physics (or homeopathy). .….wrong again: how do you know there is no other source?
jobby said on September 26, 2008 4:45 PM So there you go. 750 - 800 megabytes is plenty of information to make a picture of a human being. .….… DUH. were not making pictures here. We are constructing a very, very complicated machine.
jobby said on September 27, 2008 12:23 PM 800 megabytes can do all those functions? truly miraculous!! makes the loaves and fishes story in the bible look more and more believable. and Noah’s Ark even seem possible to hold all the animals! you have unending FAITH!
jobby said on September 28, 2008 9:34 AM Yes the FAITH in Darwinism here is very strong here. They have passively admitted that even if the DNA held only ONE BYTE of info that would be enough to construct the whole human body. How ONE BYTE could do all of that is truly, truly miraculous!
Now again this is Hand Jobby's own style of quote mining. If the entire human genome was digitally encoded to 1 byte then YES 1 byte would be enough.
jobby said on September 28, 2008 1:05 PM Ah but ID proponents have no answers, they at best have questions which originate from their poor understanding of science. … I am not an ID nor Darwinism proponent. I am a science proponent. well I have answered this: Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc? I answered that I thought the minimum about of info would be in the terabytes or petabyes. … but no answer from the Darwinists. So how can the first sentence here be true??
note that the above post hinges on the fact he keeps saying that their is only ~750Mb of "information" in the human genome.
WOW!! How much time did you spend on constructing that post? I certainly would not waste that much time on it. Doing a quip here and there is enough for me. I have a lot more important things to do. Quote mining me really is a slimy tactic. Anyhow again please try to understand this concept. I do feel that 750 MB is not enough but from an a priori position that is what I believe. But I have no proof. Never said I did. And I have repeated over and over that also the position that 750 is enough has never been proven. Good science admits when it has insufficient data not like the poster here whose FAITH in Darwinism is so strong that cannot be objective.

Dave Lovell · 30 September 2008

jobby said: WOW!! How much time did you spend on constructing that post? I certainly would not waste that much time on it. Doing a quip here and there is enough for me. I have a lot more important things to do. Quote mining me really is a slimy tactic. Anyhow again please try to understand this concept. I do feel that 750 MB is not enough but from an a priori position that is what I believe. But I have no proof. Never said I did. And I have repeated over and over that also the position that 750 is enough has never been proven. Good science admits when it has insufficient data not like the poster here whose FAITH in Darwinism is so strong that cannot be objective.
"WOW!!" Well that much I agree with. Mention in Dispatches Wayne. He was not quote mining you, he was quoting you. Do you understand the difference? Science may not fully understand how 750Mb is sufficient, but this is a spur to research. Any FAITH you think posters here have would disappear instantly if EVIDENCE to the contrary was presented. Your argument that more information is required is wasted on Biochemists, as any investigation of it is well outside their area of expertise. If petabytes are needed (i.e greater than 8x10^15 bits), that's hundreds of kilobits per atom in a sperm cell, even Physicists are completely out of their depth. Take your theories to the semiconductor industry. Moore's "Law" must run out of steam soon for conventional semiconductors. If you can patent how to store data at these densities, you'll make Bill Gates seem like a pauper.

jobby · 30 September 2008

Any FAITH you think posters here have would disappear instantly if EVIDENCE to the contrary was presented.

.... well at least you are admitting they accept their hypothesis without evidence. That is FAITH!

... and you really should look up what quote mining is. you do not seem to understand the term

eric · 30 September 2008

Wow. I mean...wow.
jobby said: ... adding another inch of leg is not that easy. it would require at least megs if not gigs. ... you do know the femur and and the tibia are not uniform in shape and width thru its length. and the nerve attachments are in different places and the plantaris adheres in a very odd way and the capella. it is far, far, far more complex than adding another layer of bricks to a wall. even the skin which is prob the most simplistic organ has myriads of variations and structure differentiations. have you studied any of this at all?
Jobby, I beg, plead with you to read Neil Shubin's "Your Inner Fish." Again, he explains quite clearly that all five fingers are the result of the same sets of commands repeated. Differences in structure are the result of when the commands are activated and what has already been built nearby. And yes, he gives experimental proof as to why this is so, so yes someone HAS done the experiment and the results DO support this. DNA does not specify every individual cubic inch of the body. There is no code for building a tibia. There is code for building bone, and depending on where and when its activated you get a tibia, femur, fingerbone, rib, etc...

jobby · 30 September 2008

There is no code for building a tibia.

.... Wrong!...If that were true then the bone would not know how to grow into that shape.

David Stanton · 30 September 2008

Well at least now we know what problem hand jobby has with whales. They are just so frickin huge that they couldn't possibly be coded for in the whale genome. Since the position of every brick, er I mean protein, must obviously be described in detail in the DNA, science must be completely wrong about everything. We've all been so blind. Now I'm sure we all see the light, thanks to hand jobby and it's amazing powers brought about by the bricks in it's head.

Hey, let's go for a new record on this thread. I say we can keep the boob spewing out nonsense for over 1000 posts. That should keep him off of other threads. Maybe it will eventually learn what quote mining is.

Dave Lovell · 30 September 2008

jobby said: .... well at least you are admitting they accept their hypothesis without evidence. That is FAITH!
No. FAITH is hanging on to your hypothesis in spite of the evidence against it.
jobby said: ... and you really should look up what quote mining is. you do not seem to understand the term
No, we obviously understand the term differently. I use the term to mean quoting somebody's words, in part and/or out of context, in such a way as to distort or even invert the author's intended meaning. How do you understand the term in a way that allows Wayne Francis's post to constitute quote mining?

fnxtr · 30 September 2008

tresmal said:
fnxtr said: Man I hope this guy gets laid soon.
That is by far the most misogynistic statement I have ever encountered on the web. You should be ashamed of yourself. :)
That took a second to process. There's someone for everyone, verybad. Somewhere out there is a distaff jobby (shudder).

Wayne Francis · 30 September 2008

jobby said:
Wayne Francis said: ... Removed to save space ...
WOW!! How much time did you spend on constructing that post? I certainly would not waste that much time on it. Doing a quip here and there is enough for me. I have a lot more important things to do. Quote mining me really is a slimy tactic. Anyhow again please try to understand this concept. I do feel that 750 MB is not enough but from an a priori position that is what I believe. But I have no proof. Never said I did. And I have repeated over and over that also the position that 750 is enough has never been proven. Good science admits when it has insufficient data not like the poster here whose FAITH in Darwinism is so strong that cannot be objective.
Took me about 10 minutes That isn't quote mining. That is providing references to statement that are counter to your most rescent statement of “you must be hallucintating. where did I claim the storage was insufficient?” I and other regular readers know you where lying. I just made it easy for the lurkers to see that you are a liar pure and simple. You have been provided references to scientific papers, articles to put the concept in layman terms and many explanations showing you the faults in your logic. All of which you ignore while rambling the same shit over and over. You are a troll. No proof will work on you because you ignore the evidence provided to you. Jobby, you are a liar. A deliberate, bare, bald-faced, unashamed liar. With malice aforethought. It is never a waste of time to show the lurkers what lying trolls like you are like.

Wayne Francis · 30 September 2008

jobby said: There is no code for building a tibia. .... Wrong!...If that were true then the bone would not know how to grow into that shape.
Note that Hand Jobby does NOT know how the tibia is formed. By his own admission he doesn't know where the "Information" comes from. Others that do have tried to explain it to Hand Jobby but he ignores them and makes a absolute statement like the one above. Its like a 2 year old that can't count to 10 yet yell at his/her older brother doing some geometry that the area of a circle can't be figured out from the formula of (Pi r^2)

Wayne Francis · 30 September 2008

definition of "quote mining"
Quote mining is the practice of compiling frequently misleading quotes from large volumes of literature or speech.
All my quotes where in context. I just bold faced the parts that show hand jobby to be a liar. Over and over he makes claims and uses terms he clearly has no clue to the meaning of. So not only is Hand Jobby a liar, but he is a willfully ignorant ass or a liar.

jobby · 30 September 2008

There is no code for building a tibia.

.... Wrong!...If that were true then the bone would not know how to grow into that shape.

jobby · 30 September 2008

Wayne Francis said: definition of "quote mining"
Quote mining is the practice of compiling frequently misleading quotes from large volumes of literature or speech.
All my quotes where in context. I just bold faced the parts that show hand jobby to be a liar. Over and over he makes claims and uses terms he clearly has no clue to the meaning of. So not only is Hand Jobby a liar, but he is a willfully ignorant ass or a liar.
YOU ARE A LIAR. You have quotemined. You probably don't even know what that is.

jobby · 30 September 2008

Since the position of every brick, er I mean protein, must obviously be described in detail in the DNA,

... now that was a really stupid statement!

Robin · 30 September 2008

Wayne Francis said: definition of "quote mining"
Quote mining is the practice of compiling frequently misleading quotes from large volumes of literature or speech.
All my quotes where in context. I just bold faced the parts that show hand jobby to be a liar.
Quite so and nicely done. I love that Bobjob denies his actions in the face of the evidence; he does such a wonderful job of defeating his own claims by demonstrating his level of delusion.
Over and over he makes claims and uses terms he clearly has no clue to the meaning of. So not only is Hand Jobby a liar, but he is a willfully ignorant ass or a liar.
Yep...both.

eric · 30 September 2008

jobby said: There is no code for building a tibia. .... Wrong!...If that were true then the bone would not know how to grow into that shape.
...and the result would be tibias of different length-diameter ratios. Which is what we see in humans. In fact even identical twins can be different heights, a result of same genetic instructions leading to different sized bones when the 'development experiment' is run twice.

PvM · 30 September 2008

And thus Bobby exposes his ignorance as to how an embryo forms. Unwilling to learn he manages to sound more and more foolish. Bobby, may I encourage you to acquire at least the minimal knowledge required to sound informed about these issues? Hint: There is no code to grow a snowflake and yet...
jobby said: There is no code for building a tibia. .... Wrong!...If that were true then the bone would not know how to grow into that shape.

PvM · 30 September 2008

Oh an Bobby, you still owe us an estimate of the information contained in the human body.

I assume you are still working on this so I will remind you regularly until you have done so.

After all, you claim to be interested in science and data...

jobby · 30 September 2008

…and the result would be tibias of different length-diameter ratios. Which is what we see in humans. In fact even identical twins can be different heights, a result of same genetic instructions leading to different sized bones when the ‘development experiment’ is run twice.

... DUH!!!! how does the bone know to grow into the shape of a tibia rather than the shape of a femur without instructions.

PvM · 30 September 2008

jobby said: …and the result would be tibias of different length-diameter ratios. Which is what we see in humans. In fact even identical twins can be different heights, a result of same genetic instructions leading to different sized bones when the ‘development experiment’ is run twice. ... DUH!!!! how does the bone know to grow into the shape of a tibia rather than the shape of a femur without instructions.
Now we are getting somewhere... It's called emergence based on the local gradients of chemicals combined with the neighboring cells which cause embryos to 'grow'. In that sense there are no more instructions than for forming a snowflake. I did encourage you to read up on these issues rather than be guided by ignorance and personal incredulity.

jobby · 30 September 2008

It’s called emergence based on the local gradients of chemicals combined with the neighboring cells which cause embryos to ‘grow’. In that sense there are no more instructions than for forming a snowflake.

... DUH! again how a tibia know what shape to assume?

jobby · 30 September 2008

Oh an Bobby, you still owe us an estimate of the information contained in the human body.

I assume you are still working on this so I will remind you regularly until you have done so.

After all, you claim to be interested in science and data

.... And you have never stated whether your thought 750 MB would be enough and not ONE study showing how complex animals can evolve by NS. You are such a liar.

PvM · 30 September 2008

I just gave you the answer but if you want a more indepth one then we can discuss them

Turing (1952) introduced the idea that interactions of reacting and diffusing chemicals (usually of two species) could form self-organizing instabilities that provide the basis for biological spatial patterning

These 'Reaction–diffusion continuum submodels" are partial differential equations which model the spatial and temporal distribution of chemicals. In some way not very different from snowflakes.
jobby said: It’s called emergence based on the local gradients of chemicals combined with the neighboring cells which cause embryos to ‘grow’. In that sense there are no more instructions than for forming a snowflake. ... DUH! again how a tibia know what shape to assume?

PvM · 30 September 2008

jobby said: Oh an Bobby, you still owe us an estimate of the information contained in the human body. I assume you are still working on this so I will remind you regularly until you have done so. After all, you claim to be interested in science and data .... And you have never stated whether your thought 750 MB would be enough and not ONE study showing how complex animals can evolve by NS. You are such a liar.
That's funny, instead of defending yourself, you accuse others. Does this mean that others have caused you be miss your deadlines to support your claims? I am talking about your claims here Bobby... Calling others liars is not making the facts go away, I understand. As to the questions you asked, I responded to them. Given your track record, you may have missed them but they were answered to the same extent we answered Dembski's position on the designer.

eric · 30 September 2008

PvM answered your question but it looks like you didn't understand the big words, so I'll try to use smaller ones.
jobby said: It’s called emergence based on the local gradients of chemicals combined with the neighboring cells which cause embryos to ‘grow’. In that sense there are no more instructions than for forming a snowflake. ... DUH! again how a tibia know what shape to assume?
The same way a loaf of bread "knows" to be rectangular: because there's physical impediments (a pan), raw material limitations (food for the yeast), and changes in conditions/processes that limit its growth (when you take it out of the oven, it stops rising). In case your SAT skills aren't up to snuff, the right analogies for bone growth are: (a) neighboring tissue, (b) availability of Calcium, (c) other ongoing biochemical processes (which can turn on and off bone growth).

PvM · 30 September 2008

As I said, the same way a snow crystal knows what shape to assume.
jobby said: Oh an Bobby, you still owe us an estimate of the information contained in the human body. I assume you are still working on this so I will remind you regularly until you have done so. After all, you claim to be interested in science and data .... And you have never stated whether your thought 750 MB would be enough and not ONE study showing how complex animals can evolve by NS. You are such a liar.
That's funny, instead of defending yourself, you accuse others. Does this mean that others have caused you be miss your deadlines to support your claims? I am talking about your claims here Bobby... Calling others liars is not making the facts go away, I understand. As to the questions you asked, I responded to them. Given your track record, you may have missed them but they were answered to the same extent we answered Dembski's position on the designer.
jobby said: It’s called emergence based on the local gradients of chemicals combined with the neighboring cells which cause embryos to ‘grow’. In that sense there are no more instructions than for forming a snowflake. ... DUH! again how a tibia know what shape to assume?

SWT · 30 September 2008

jobby said: There is no code for building a tibia. .... Wrong!...If that were true then the bone would not know how to grow into that shape.
Wow! What a bone-headed comment!

PvM · 30 September 2008

Yes, it will take Bobby some time to come to realize how 'simple' diffusion reaction equations, similar to the ones which 'create' snowflakes, play a role all through biology. In this paper Eshel shows some exquisite formations of bacterial colonies. Look at fig 2.. So how do these bacteria know to form such patterns...
SWT said:
jobby said: There is no code for building a tibia. .... Wrong!...If that were true then the bone would not know how to grow into that shape.
Wow! What a bone-headed comment!

Dan · 30 September 2008

jobby said: [There is] not ONE study showing how complex animals can evolve by NS.
Yes there is: The Origin of Species by Charles Darwin. Perhaps you've heard of it?

jobby · 30 September 2008

Dan said:
jobby said: [There is] not ONE study showing how complex animals can evolve by NS.
Yes there is: The Origin of Species by Charles Darwin. Perhaps you've heard of it?
.......That is a peer reviewed study?

jobby · 30 September 2008

The same way a loaf of bread “knows” to be rectangular: because there’s physical impediments (a pan), raw material limitations

.... so where is the mold for instance for the pelvis??

jobby · 30 September 2008

None of you here really understand this concepts do you?

jobby · 30 September 2008

Look at fig 2..

So how do these bacteria know to form such patterns…

.... there are no complicated interconnected parts there.

PvM · 30 September 2008

Missing the point. These complex patterns form from the simple interactions of local as well as global signalling, combined with diffusion/reaction partial differential equations, leading to the emergence of these intricate patterns. You wanted to know how a tibia 'knew' how to grow, the answer has been provided to you several times and yet you shown no progress in familiarizing yourself with the science involved.
jobby said: Look at fig 2.. So how do these bacteria know to form such patterns… .... there are no complicated interconnected parts there.

PvM · 30 September 2008

Don't project your ignorance onto others my dear confused friend. it just makes you look foolish.
jobby said: None of you here really understand this concepts do you?

PvM · 30 September 2008

moving the goalposts again? Your ignorance causes you to ignore much relevant data, doesn't it?
jobby said:
Dan said:
jobby said: [There is] not ONE study showing how complex animals can evolve by NS.
Yes there is: The Origin of Species by Charles Darwin. Perhaps you've heard of it?
.......That is a peer reviewed study?

PvM · 30 September 2008

Perhaps Bobby prefers the 'Cliff notes' version of perhaps 'Darwin for Dummies' although even the origin of species is quite accessible. Funny how Bobby has to deny all the data because they disagree with his faith based fears.
Dan said:
jobby said: [There is] not ONE study showing how complex animals can evolve by NS.
Yes there is: The Origin of Species by Charles Darwin. Perhaps you've heard of it?

jobby · 30 September 2008

Don’t project your ignorance onto others my dear confused friend. it just makes you look foolish.

... Oh stop it. You are just faking here. You cannot even come up with one study to show that NS evolves complex structures.

... And comparing a simple structure like a snowflake to a digestive system shows complete ignorance.

PvM · 30 September 2008

So Bobby remind us again of your progress:

How much information is contained in the human body.

Chirp Chirp...

jobby · 30 September 2008

These complex patterns form from the simple interactions of local as well as global signalling, combined with diffusion/reaction partial differential equations, leading to the emergence of these intricate patterns.

... oh stop the bull. Where is the pattern for the tibia stored? Where is the differential equation stored? You really are ignorant.

jobby · 30 September 2008

PvM said: So Bobby remind us again of your progress: How much information is contained in the human body. Chirp Chirp...
... chirp chirp:: where is the study on NS. there is none thats why you will not produce it.

PvM · 30 September 2008

Again you are missing the point AND moving the goalposts. Note that if you had read my original response to your request, I stated that once we have resolved your present ignorance about embryology, I am more than willing to discuss how NS can evolve complex structures. Until then, I am attempting to help you understand what guides the formation of let's say the 'tibia', which are in many aspects the same laws that guide the formation of snowflakes. Just calling the snowflake 'a simple structure' without any logic or reasoning is not going to help your argument here, other than admitting that the tibia is just 'a simple structure' as well. So remind us again, what is the information content of the human body?
jobby said: Don’t project your ignorance onto others my dear confused friend. it just makes you look foolish. ... Oh stop it. You are just faking here. You cannot even come up with one study to show that NS evolves complex structures. ... And comparing a simple structure like a snowflake to a digestive system shows complete ignorance.

jobby · 30 September 2008

Just calling the snowflake ‘a simple structure’ without any logic or reasoning is not going to help your argument here, other than admitting that the tibia is just ‘a simple structure’ as well.

... the tibia is a complex structure and snowflakes are not. Read up on it

PvM · 30 September 2008

My goodness, this is hilarious. These differential equations are not stored anywhere, they are what describe the physics at non equilibrium. This is just becoming ridiculous. The pattern of the tibia is not stored anywhere, just like the patterns for snowflakes. They emerge through the processes of physics and boundary conditions. Yes, a lot of 'complexity' appears to be stored in the laws of physics. You thus have two choices: 1. Admit that the complexity of the tibia can be explained by the interaction of local interactions, physical processes and feedback processes 2. Admit that the tibia, like the snowflake is 'simple' Either way, you lose. Anything else?
jobby said: These complex patterns form from the simple interactions of local as well as global signalling, combined with diffusion/reaction partial differential equations, leading to the emergence of these intricate patterns. ... oh stop the bull. Where is the pattern for the tibia stored? Where is the differential equation stored? You really are ignorant.

PvM · 30 September 2008

I have and I have provided you links to show the contrary. Making unsupported assertions is not the best way to support your claims. What books, papers do you recommend to read up on the structure of the tibia and snowflakes and which support your position? Specifics would help, you cannot hide behind your absence of knowledge argument.
jobby said: Just calling the snowflake ‘a simple structure’ without any logic or reasoning is not going to help your argument here, other than admitting that the tibia is just ‘a simple structure’ as well. ... the tibia is a complex structure and snowflakes are not. Read up on it

PvM · 30 September 2008

We have established two things here. 1. Bobby is unable to quantify the information in the human body, despite his claims. 2. Bobby is unable to correctly describe my position on providing evidence to support his question. Both show a level of scientific vacuity we have come to 'admire' so much in our friend
jobby said:
PvM said: So Bobby remind us again of your progress: How much information is contained in the human body. Chirp Chirp...
... chirp chirp:: where is the study on NS. there is none thats why you will not produce it.

jobby · 30 September 2008

The pattern of the tibia is not stored anywhere, just like the patterns for snowflakes. They emerge through the processes of physics and boundary conditions.

... so how does the human skull know not to grow into the shape of a chimpanzee skull? has nothing to do with the DNA??

minimalist · 30 September 2008

jobby said: ... oh stop the bull. Where is the pattern for the tibia stored? Where is the differential equation stored? You really are ignorant.
Where are the tiny, shape-changing elves who hide inside my TV and act out the nightly sitcoms for me? You are so ignorant.

jobby · 30 September 2008

Your belief that the instructions for a human embryo to develop a human skull and a chimpanzee to develop a chimpanzee skull are not in the DNA is ludicrous.

jobby · 30 September 2008

Where are the tiny, shape-changing elves who hide inside my TV and act out the nightly sitcoms for me? You are so ignorant.

... so you also believe the directions for forming the skull are not in the DNA? THAT seems ignorant to me!

PvM · 30 September 2008

Okay, I feel somewhat sorry for our friend so let's see if we can guide him towards a better understanding. Okay a combination of limb development and small selective processes

Writing in this week’s Proceedings of the National Academy of Sciences (PNAS), Hans Thewissen and his colleagues report that ancient whales--four-footed land animals not unlike large modern dogs--evolved into graceful, streamlined swimmers through a series of small genetic changes during the whales’ embryonic development.

For dolphins

Thewissen and his colleagues began by exploring the embryonic development of whales’ cousins, the dolphins. These creatures are intriguing because for a brief time during development they do sprout hind limbs, which quickly vanish again as the embryos reach the second month in a gestation period that lasts about 12 months. Why? In most mammals, explains Thewissen, "a series of genes is at work at different times, delicately interacting to form a limb with muscles, bones, and skin. The genes are similar to the runners in a complex relay race, where a new runner cannot start without receiving a sign from a previous runner." In dolphins, however, at least one of the genes drops out early in the race, disrupting the genes that were about to follow it. That causes the entire relay to collapse, ultimately leading to the regression of the animals’ hind limbs. By analyzing dolphin embryos, Thewissen showed that the dropout is a gene called "Sonic Hedgehog," which is important at several stages of limb formation. "That’s why dolphins lose their ’legs,’" he says.

for whales

In whales, however, the story is more complex. Between 41 million and 50 million years ago, whales’ hind limbs did shrink greatly as the former land animals began a return to the sea. But their legs showed no change in the basic arrangement and number of bones, which proved that Sonic Hedgehog was still functioning. Its loss must have come later. In short, "the dramatic loss of Sonic Hedgehog expression was not the genetic change that drove hind limb loss in whales," Lane said. Instead, Thewissen and his colleagues conclude, whales’ hind limbs regressed over millions of years via "Darwinian microevolution": a step-by-step process occurring through small changes in a number of genes relatively late in development.

jobby · 30 September 2008

Instead, Thewissen and his colleagues conclude, whales’ hind limbs regressed over millions of years via “Darwinian microevolution”: a step-by-step process occurring through small changes in a number of genes relatively late in development.

... nice hypothesis. Any experimentation to back it up?

PvM · 30 September 2008

jobby said: The pattern of the tibia is not stored anywhere, just like the patterns for snowflakes. They emerge through the processes of physics and boundary conditions. ... so how does the human skull know not to grow into the shape of a chimpanzee skull? has nothing to do with the DNA??
Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. However, much of the information to form the limb emerges from the 'simple' processes of physics combined with local conditions, neighboring (boundary) conditions, feedback loops and more. The importance of DNA is to express when to start and stop, and to determine the relevant axis of the organism, which combined with the laws of physics lead to emergence of relatively complex patterns and yet the DNA does not guide the formation of every single cell, which is a somewhat naive view of genetics.

jobby · 30 September 2008

Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. However, much of the information to form the limb emerges from the ‘simple’ processes of physics combined with local conditions, neighboring (boundary) conditions, feedback loops and more. The importance of DNA is to express when to start and stop, and to determine the relevant axis of the organism, which combined with the laws of physics lead to emergence of relatively complex patterns and yet the DNA does not guide the formation of every single cell, which is a somewhat naive view of genetics

.... so the form of the human skull is not stored in DNA and the form of the chimpanzee is not stored in its DNA??

PvM · 30 September 2008

I'd suggest you read the paper and determine this for yourself. Surely an inquisitive 'scientist' like yourself would have found the relevant paper by now and determined its relevance? Let me know if you have any questions in understanding the paper, it's quite straightforward
jobby said: Instead, Thewissen and his colleagues conclude, whales’ hind limbs regressed over millions of years via “Darwinian microevolution”: a step-by-step process occurring through small changes in a number of genes relatively late in development. ... nice hypothesis. Any experimentation to back it up?

PvM · 30 September 2008

What part of Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. confuses you? geez Bobby, now even your reading ability seems to be starting to fail you.
jobby said: Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. However, much of the information to form the limb emerges from the ‘simple’ processes of physics combined with local conditions, neighboring (boundary) conditions, feedback loops and more. The importance of DNA is to express when to start and stop, and to determine the relevant axis of the organism, which combined with the laws of physics lead to emergence of relatively complex patterns and yet the DNA does not guide the formation of every single cell, which is a somewhat naive view of genetics .... so the form of the human skull is not stored in DNA and the form of the chimpanzee is not stored in its DNA??

PvM · 30 September 2008

No what is ignorant is how you interpret the statements made.
jobby said: Where are the tiny, shape-changing elves who hide inside my TV and act out the nightly sitcoms for me? You are so ignorant. ... so you also believe the directions for forming the skull are not in the DNA? THAT seems ignorant to me!

PvM · 30 September 2008

And then there is cell death... Yes, cell death is another important contributor to the formation of the embryo

In the course of the lineage, one in six of all cells produced subsequently dies; their identity and the approximate times of their deaths are predictable. The mode of death is similar to that seen previously in the postembryonic lineages (Sulston and Horvitz, 1977; Robertson and Thomson, 1982). In some cases death occurs several hours after birth, so that it is possible for the cells to function in some manner before being discarded. A good example is the pair of tail spike cells, which fuse together, form a slender bundle of filaments in the tip of the tail, and then die. At the other extreme are the majority of programmed deaths, which occur 20 to 30 min after birth; these cells are born with very little cytoplasm, and die without differentiating in any obvious way. The limited sexual dimorphism seen in the embryo is a consequence of differential cell death (see Nervous System).

This is a repeatable event. Fascinating indeed.

PvM · 30 September 2008

Or

This article addresses the role of programmed cell death (apoptosis) during embryonic head development ofDrosophila.Previous studies showed thatreaper(rpr) is expressed in and required by cells undergoing apoptosis. We have analyzed the correlation between the pattern of expression ofrprand morphogenetic movements affecting head development. Furthermore, we have investigated the defects in head development resulting from the absence of apoptosis in embryos deficient forrpr.Our results show that, in the head, domains of high incidence of cell death as marked by expression ofrprcorrelate with regions where most morphogenetic movements occur; these regions are involved in formation of mouth structures, the internalization of neural progenitors, and head involution. Cellular events driving these movements are delamination, invagination, and intercalation as well as disruption and reformation of contacts among epithelial cells. The analysis ofrpr-deficient embryos demonstrates that, despite of the widespread occurrence of apoptosis during normal head morphogenesis, many aspects of this process proceed in an apparently unperturbed manner even when cell death is blocked. In particular, movements that happen early during embryonic development and that are evolutionarily more ancient (e.g., formation of the dorsal ridge and the pharynx) take place almost normally inrpr-deficient embryos. Later events which are mostly associated with head involution (e.g., retraction of the clypeolabrum, formation of the dorsal pouch, fusion of lateral gnathal lobes) are evolutionarily more recent and fail to occur normally inrpr-deficient embryos.

Now that's just fascinating, especially how the cell death does not affect evolutionary more ancient processes but do affect those more recent ones.

jobby · 30 September 2008

What part of Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. confuses you?

... and where are the instructions when to turn off and on these various feedback loops and protein expressions stored??

PvM · 30 September 2008

In the regulatory elements which together with the genes form genetic networks. Where else? Look Bobby, nobody is arguing that DNA is not responsible for the formation of the embryo, but unlike you, science has come to realize that there are many other processes which cause structures to emerge under simple rules of physics at non equilibrium. The 'partial differential equations' which form the mathematical basis for these laws of physics show how emergence and patterning can lead to complex shapes, just like those found in snowflakes. So either snowflakes are simple, and the human body is much simpler than you may think or snowflakes are more complex due to their complex physics and emergence and we come to understand how natural laws can increase the complexity. As I said, either way you lose.
jobby said: What part of Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. confuses you? ... and where are the instructions when to turn off and on these various feedback loops and protein expressions stored??

jobby · 30 September 2008

PvM said: In the regulatory elements which together with the genes form genetic networks. Where else? Look Bobby, nobody is arguing that DNA is not responsible for the formation of the embryo, but unlike you, science has come to realize that there are many other processes which cause structures to emerge under simple rules of physics at non equilibrium. The 'partial differential equations' which form the mathematical basis for these laws of physics show how emergence and patterning can lead to complex shapes, just like those found in snowflakes. So either snowflakes are simple, and the human body is much simpler than you may think or snowflakes are more complex due to their complex physics and emergence and we come to understand how natural laws can increase the complexity. As I said, either way you lose.
jobby said: What part of Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. confuses you? ... and where are the instructions when to turn off and on these various feedback loops and protein expressions stored??
... And you feel that all these feedback mechanisms, all the instructions to 'make protein A for 100 units then make protein B for 150 units, now make bone, and all the shapes that are necessary and the differentions between a dog skull, cat skull, human skull, human pelvis, dog pelvis, dog heart, human heart, dog ankle, human ankle, etc, etc, etc ,etc ,etc ,etc, etc ,etc ,etc ,etc ,etc are all neatly packed into 750 MB??? to me that is ridiculous.

jobby · 30 September 2008

‘partial differential equations’

... have you ever worked with those. DUH!!! the variables need hard values! you seem like you are BSing your head off.

PvM · 30 September 2008

I am not sure what you are saying here but yes, I have worked with pde's. If I am bs'ing my head off, you should be able to show so. Just because you do not understand something does not mean it must be BS.
jobby said: ‘partial differential equations’ ... have you ever worked with those. DUH!!! the variables need hard values! you seem like you are BSing your head off.

PvM · 30 September 2008

to me that is ridiculous.

— Jobby
The perfect example of an argument from personal ignorance.

jobby · 30 September 2008

PvM said:

to me that is ridiculous.

— Jobby
The perfect example of an argument from personal ignorance.
.. And you can show that 750 MB is enough for these thousand if not millions of instructions: That is in an example of blind faith from ignnorance.

PvM · 30 September 2008

If you had read my response, you would have known my position on this. Are we now going around in circles while holding are hands to our ears shouting 'I cannot hear you'?
jobby said:
PvM said:

to me that is ridiculous.

— Jobby
The perfect example of an argument from personal ignorance.
.. And you can show that 750 MB is enough for these thousand if not millions of instructions: That is in an example of blind faith from ignnorance.

jobby · 30 September 2008

OK How in a developing human is femur instructed to stop growing lengthwise and in diameter?

David Stanton · 30 September 2008

Perhaps PVM and hand jobby could both post a short description of exactly what it is that they hope to accomplish here. Then the rest of us, (if any one still cares), can let each of them know what their chances are of success.

(Hint to PvM: please remember the original topic of this thread - immune to evidence.)

Other that that, the only interest in this thread is whether the moderator wil allow it to get to 1000 posts or not. I am hoping it will get to 1000, but then again I will probably only read number 1000.

PvM · 30 September 2008

jobby said: OK How in a developing human is femur instructed to stop growing lengthwise and in diameter?
Good question

Researchers concluded that FGFs act as instructive molecules by examining the expression of a gene called Meis1 found at the proximal portion of the developing limb bud. The new model presented in the study proposes that proximal and distal domains are specified by two opposing signals: a proximal signal from the flank and a distal signal from the AER, and that a middle domain forms as an interaction between the two domains or two signals. The model proposed by the study is provocative because it is similar to a model proposed for limb regeneration in amphibians, Mariani says. The findings could have a significant impact on future study in this area. "This exciting study proposes a new model to explain how signals between cells in the embryo control the growth and formation of the mammalian limb," says Martin Pera, Ph.D., director of the Eli and Edythe Broad Center for Regenerative Medicine and Stem Cell Research at USC. "Tissue repair processes in the adult often use the same cellular programs in building the embryo, so these new findings may provide important clues to guide future treatment of injuries using cell-based therapies."

Henry J · 30 September 2008

exactly what it is that they hope to accomplish here.

They want to find out if the blog software can handle 33+ pages on a thread. ;)

jobby · 30 September 2008

Researchers concluded that FGFs act as instructive molecules by examining the expression of a gene called Meis1 found at the proximal portion of the developing limb bud.

... how were these created and where was the info stored that created them?

PvM · 30 September 2008

Good question: genes
jobby said: Researchers concluded that FGFs act as instructive molecules by examining the expression of a gene called Meis1 found at the proximal portion of the developing limb bud. ... how were these created and where was the info stored that created them?

fnxtr · 30 September 2008

Is it just me or is Yobbo now asking how the sea knows to be salty?

PvM · 30 September 2008

Partially, Jobby is asking how science explains what Bobby sees as a discrepancy between the genetic information contained in the genome and the phylogenetic information as contained in the organism. I am helping him understand that there are more processes than just genes that play a role in development.
fnxtr said: Is it just me or is Yobbo now asking how the sea knows to be salty?

David Stanton · 30 September 2008

I once made a picture of a flower with a spirograph. It was really cool. Was the information for the structure of the flower in the genome of the spirograph?

Wayne Francis · 30 September 2008

jobby said:
Wayne Francis said: definition of "quote mining"
Quote mining is the practice of compiling frequently misleading quotes from large volumes of literature or speech.
All my quotes where in context. I just bold faced the parts that show hand jobby to be a liar. Over and over he makes claims and uses terms he clearly has no clue to the meaning of. So not only is Hand Jobby a liar, but he is a willfully ignorant ass or a liar.
YOU ARE A LIAR. You have quotemined. You probably don't even know what that is.
This makes me laugh. Hand Jobby is like a 2 year old yelling at his mother because he was punished for jumping on the bed all the while yelling "I wasn't jumping on the bed! I was hopping!" I do know what quote mined means...hence the definition within the post that YOU replied to. What I did was fully quoted your posted. Quote mining would have been taking tidbits from your posts, like you quote scientists, to make it look like they say one thing when they really mean another. Hand Jobby, you repeatedly show yourself as a immature ignorant and deceitful liar and I'll be happy to point this out to the lurkers over and over.

PvM · 30 September 2008

Well said.
Wayne Francis said: I do know what quote mined means...hence the definition within the post that YOU replied to. What I did was fully quoted your posted. Quote mining would have been taking tidbits from your posts, like you quote scientists, to make it look like they say one thing when they really mean another.

tresmal · 30 September 2008

Ban jobby? No, instead restrict him to this one thread, henceforth known as the jobby thread. (somehow that sounds dirty) People who feel the need to beat their heads against a wall (such as myself apparently) can come here and contend against jobby's invincible obtuseness to their hearts' content. Since this is very clearly important to jobby, and it does keep him off the street and away from potential mates and since he is not actually evil, this one thread does seem to be too much of sacrifice. I have found that grappling with the impenetrable murk of jobby's thinking has helped me to clarify my own.

Wayne Francis · 30 September 2008

jobby said: The same way a loaf of bread “knows” to be rectangular: because there’s physical impediments (a pan), raw material limitations .... so where is the mold for instance for the pelvis??
The "mold" is the surrounding environment for lurkers, as Hand Jobby will not read or understand the following abstract as he has proven many times before.
Key Interaction Elucidated in Fetal Bone Development As a human embryo forms, most of its bones begin as cartilage and are converted into bone. This developmental transition is orchestrated by a complex network of proteins known as transcription factors, which activate the appropriate genes at the appropriate time and duration to carry out the ossification process. One of the most-studied of these transcription factors is called Runx2. Without its transcriptional oversight in the ossification process, cartilage-producing chondrocytes will not fully mature, nor will bone-producing osteoblasts differentiate. What has intrigued scientists is Runx2 is expressed in fetal progenitor cells as early as embryonic day 10, or well before its curtain call to orchestrate chondrocyte and osteoblast differentiation. This has led some to wonder if during early skeletal development other transcription factors inhibit the activity of Runx2 and hold it in check until needed. In the December 12 issue of the Proceedings of the National Academy of Sciences, NIDCR grantees and their colleagues identify this inhibitory transcription factor as Sox9. They show in laboratory and animal studies that Sox9 directly interacts with Runx2 and dominantly represses its activity. The scientists also show that this repression likely takes place early on as precursor cells commit to cartilage-producing lineages and later during the development of cartilage. Further delineating the Sox9/Runx2 interaction will help to explain the biochemical underpinnings of several human skeletal malformations and will be useful in learning to engineer replacement bone.
Going over Hand Jobby's comments you have to come to the conclusion that he thinks that to build anything you would need a plan bigger then what is being built. He expect simple and easy to understand instructions which DNA is not. DNA has the advantage that one set of of genes and pathways can be used to develop things, like a tibia, across multiple species. The same genes that effect the development of your fingers is the same genes that effect the development of a birds wings as they do a fishes fins. Going back to conjoined twins Hand Jobby's statements would say that the "Plan" was for the twins to be conjoined from the start. This is not at all what happens. What happens is the area where the twins are attached the signals guiding normal development are influenced by the adjoining twins development and the cells go down a pathway that merges the 2 twins. In basic terms you might say Stem Cell A would normally form into Cell B given the normal development because of the cells around it. Introduce the twin's development into the picture and Stem Cell A gets different signals then it would if the twin was not there. This may cause the stem cells to develop into different cells then they normally would based on their position. In theory, I have never heard of this happening but it is possible, identical triplets could be born with 2 of them conjoined and one not. All have the exact same DNA. The conjoined pair just had a situation where they where not properly separated enough during the early developmental stages. Hand Jobby would have you believe there where 2 separate plans for the 3 identical triplets because 2 of them where born conjoined. Hand Jobby, where did the "Plan" for this skeleton come from? http://www.mae.nw.ru/images/floor/2_XIII_01b.jpg Look at the rib cage and pelvis. The twins development would have tried to proceed as normal but when a cell developed and was close to cells of the conjoined twin they adapted based on the signals around them.

Wayne Francis · 30 September 2008

jobby said: Instead, Thewissen and his colleagues conclude, whales’ hind limbs regressed over millions of years via “Darwinian microevolution”: a step-by-step process occurring through small changes in a number of genes relatively late in development. ... nice hypothesis. Any experimentation to back it up?
Did you not read? This came from experiments on dolphin and whale embryos.

tresmal · 30 September 2008

So has anyone (besides jobby) not notice the irony of the subtitle to this thread: "immune to evidence"?

Wayne Francis · 30 September 2008

tresmal said: Ban jobby? No, instead restrict him to this one thread, henceforth known as the jobby thread. (somehow that sounds dirty) People who feel the need to beat their heads against a wall (such as myself apparently) can come here and contend against jobby's invincible obtuseness to their hearts' content. Since this is very clearly important to jobby, and it does keep him off the street and away from potential mates and since he is not actually evil, this one thread does seem to be too much of sacrifice. I have found that grappling with the impenetrable murk of jobby's thinking has helped me to clarify my own.
I laughed so hard tears came to my eyes...but it is true. If nothing else Hand Jobby has me think of many analogies to developmental processes that I can use with my friends and my son, who at 12 years of age has a much stronger grasp of biology then Hand Jobby. Who am I kidding, Joshua had a stronger grasp of everything at the age of 6 had a stronger grasp of everything then Hand Jobby.

Henry J · 30 September 2008

He expect simple and easy to understand instructions which DNA is not.

Oh, I dunno. If I'm following this, what the DNA does is tell cells of a certain type to start growing when the chemical gradients match one set of criteria, and stop growing when it matches another. That would be with the gradients acting as a sort of coordinate system, with some for position along the length, some side to side, some front to back, and some for relative position within regions. Of course, it presumably does this separately for each type of cell, and maybe differently for different regions in the body. Henry

Stanton · 30 September 2008

tresmal said: So has anyone (besides jobby) not notice the irony of the subtitle to this thread: "immune to evidence"?
Ironic enough to knock the wrinkles out of my slacks in the other room. You also notice that jobby/bobby/jacob/hamstrung/balanced has never ever presented any explanation of why (he thinks) the genome has insufficient information to build a human?

PvM · 30 September 2008

I ran across an fascinating post by PZ Zygotic genes which shows how patterning happens as well as reminds us of the relevance of 'maternal genes'. So in fact, this is one example of where not all information is stored in the DNA of the zygote, but rather comes from the mother.

Wayne Francis · 30 September 2008

PvM said: I ran across an fascinating post by PZ Zygotic genes which shows how patterning happens as well as reminds us of the relevance of 'maternal genes'. So in fact, this is one example of where not all information is stored in the DNA of the zygote, but rather comes from the mother.
PvM this would be an epigenetic feature?

PvM · 30 September 2008

An example of

Each of the roughly 800 ommatidia in the compound eyes of fruit flies has a basically fixed number of cells that are programmed, or patterned, by a reaction-diffusion-like activation-inhibition system. Each has about 20 cells of seven different types,including eight photoreceptor cells,seven of which are arranged hexagon-like around the other(known as R8); six surrounding accessory cells; and four lens-generating cone cells.The eye develops from an imaginal disk of about 20,000 cells. The cells in the eye imaginal disk are apparently equivalent and equipotent (e.g., all expressing the Eyeless/Pax6 TF).These cells are induced to form ommatidia by a sweep of activation-inhibition activity induced by an indentation called the morphogenetic furrow that moves wavelike from posterior to anterior across the disk.

Weiss, Genetics and the Logic of Evolution p 234 See also the role of calcium in Calcium at Fertilization and in Early Development and Organization of early development by calcium patterns

Stanton · 30 September 2008

Maternal genes as well as regulatory proteins, manufactured by the mother, that guide development are important epigenetic factors. I was told, in my Embryology Class, about how snails have genes determining whether or not their shells develop sinistrally (the mouth of the shell opens to the left), or dextrally (the mouth of the shell opens to the right), but, the genes do not affect their owners, but all of the offspring they produce. In other words, a snail with genes for sinistrally-spiralling shells will produce offspring that are sinistrally-coiling, but, if this snail's mother had genes for dextrally-spiralling shells, the snail, itself, would be dextrally-coiled.
Wayne Francis said:
PvM said: I ran across an fascinating post by PZ Zygotic genes which shows how patterning happens as well as reminds us of the relevance of 'maternal genes'. So in fact, this is one example of where not all information is stored in the DNA of the zygote, but rather comes from the mother.
PvM this would be an epigenetic feature?

tresmal · 1 October 2008

I noticed that jobby likes to position this by saying that it is either proven or it's "FAITH". This is, of course, a false dichotomy. In between these two extremes is a wide range in degrees of certainty. A large part of what science does is to establish what levels of confidence we can have for various scientific explanations. With regard to "is 750MB enough etc. etc.":
1) Nobody has found a protein with no gene in the DNA.
2) Everything that is known about embryology (which is far from everything)is explained by the interplay of DNA, regulators, cellular biochemistry and the embryo's environment.
3) There are no candidates for this extra information. No organelles of unknown function, no large quantities of complex chemicals sitting around with apparently nothing to do. Remember jobby's guess is that the information required is at terabyte levels or greater. That's a minimum of a thousand times the amount in DNA. Where is it?
4) This "dark information" is not making its presence detectable in any way. There are no known secondary effects, no metabolites, no indirect evidence, nothing.
A job is undeniably being performed. Only one thing is observed performing that job. There are no hints of anything else performing that job. Best fit with the evidence? That one thing is enough to do the job. Does this prove it? No. Is it "FAITH" then? Absolutely not. It is much closer to the proven end of the spectrum than the "FAITH" end.

Dan · 1 October 2008

jobby said:
Dan said:
jobby said: [There is] not ONE study showing how complex animals can evolve by NS.
Yes there is: The Origin of Species by Charles Darwin. Perhaps you've heard of it?
.......That is a peer reviewed study?
I don't know why jobby's second question is relevant, but, yes, The Origin of Species was extensively reviewed by Darwin's peers. Also by Darwin's non-peers, such as Wilberforce. See http://darwin-online.org.uk/reviews.html

Wayne Francis · 1 October 2008

Dan said:
jobby said:
Dan said:
jobby said: [There is] not ONE study showing how complex animals can evolve by NS.
Yes there is: The Origin of Species by Charles Darwin. Perhaps you've heard of it?
.......That is a peer reviewed study?
I don't know why jobby's second question is relevant, but, yes, The Origin of Species was extensively reviewed by Darwin's peers. Also by Darwin's non-peers, such as Wilberforce. See http://darwin-online.org.uk/reviews.html
Great stuff Dan. I know when I read Hand Jobby's comments I thought to myself "Yes I'm pretty sure On The Origin of Species" was reviewed by his peers and if it wasn't the papers it was based off of where.

jobby · 1 October 2008

2) Everything that is known about embryology (which is far from everything)is explained by the interplay of DNA, regulators, cellular biochemistry and the embryo’s environment.

... circular logic! that is exactly what I am saying: we do not know where much of the instructions are coming from. you just said that in your above statement

jobby · 1 October 2008

I don’t know why jobby’s second question is relevant, but, yes, The Origin of Species was extensively reviewed by Darwin’s peers. Also by Darwin’s non-peers, such as Wilberforce.

... And I am sure that Behe, etc were reviewed by his peers and non peers as a 'book' You know I am talking about experimental proof in journals. Not a discussion of a hypothesis.

jobby · 1 October 2008

A large part of what science does is to establish what levels of confidence we can have for various scientific explanations.

... and show me the p values for these experiments test Darwinism please. NO a priori!

jobby · 1 October 2008

Did you not read? This came from experiments on dolphin and whale embryos.

... I am asking for experiments to specifically prove that NS causes complex body parts.

CAN YOU READ??

jobby · 1 October 2008

ach of the roughly 800 ommatidia in the compound eyes of fruit flies has a basically fixed number of cells that are programmed, or patterned,

....OK how many bytes of info are needed just to create this eyes? Let start quantifying and quit BSing.

jobby · 1 October 2008

Going over Hand Jobby’s comments you have to come to the conclusion that he thinks that to build anything you would need a plan bigger then what is being built.

.... of course I do not think that! I can have a blueprint for a brick and build a million of them from that. And I can have a blue print for a protein and build a million.

But how those pieces are assemble cannot be instructed with ONE BYTE as is the consensus here.

.... QUANTIFY!! How many minimum bytes to construct the human eye?????????????? 1 BYTE. you dont see how ridiculous that claim is.

jobby · 1 October 2008

... Lets take just the SHAPE of a bone. assuming it is homogeneous. no blood vessles nerves marrow etc.

and assuming it is cylindrical: it would take at least 2 bytes: one for the diameter and one for the length

jobby · 1 October 2008

Going back to conjoined twins Hand Jobby’s statements would say that the “Plan” was for the twins to be conjoined from the start.

... no I never said anything like that. In that case the plan was followed and an error occured in the exectution of the instructions.

jobby · 1 October 2008

Absolutely not. It is much closer to the proven end of the spectrum than the “FAITH” end.

... QUANTITIZE!! complete faith being zero and undisputable fact beint 10 give a number to your belief that all the necessary info is in 750 MB of DNA

jobby · 1 October 2008

What has intrigued scientists is Runx2 is expressed in fetal progenitor cells as early as embryonic day 10, or well before its curtain call to orchestrate chondrocyte and osteoblast differentiation.

... and where did the info come from to create Runx2. QUANTITIZE! how many bytes to create Runx2??????????

jobby · 1 October 2008

1. Bobby is unable to quantify the information in the human body, despite his claims.

.... # of cells = ~ 10^14

ok now YOU quantitize! how many bytes to instruct the development of the thumbnail???? can you even do that???

wad of id · 1 October 2008

Bytes do not create anything.

wad of id · 1 October 2008

Bytes do not instruct.

wad of id · 1 October 2008

Bytes mean nothing without its context. Your hard drive comes rated for billions of bytes. Take the hard drive by itself. It's worthless.

wad of id · 1 October 2008

So the requests to calculate bytes is an exercise in wasting time.

wad of id · 1 October 2008

jobby comes with the premise that not calculating bytes in a genome is a fault of current science. It's not an accepted premise. It is an IDiotic premise. We do not play his juvenile game because science proceeds without it.

wad of id · 1 October 2008

Here's an example: how many bytes are there in the physical processes required to generate Hurricane Katrina?

Now, are those bytes sufficient to instruct or create Katrina?

See how stupid these requests are?

jobby · 1 October 2008

I think the argument here is like this. We can make a plan to build a wall with bricks. It can be very simple like this:

first tier: half-brick, 20 full bricks, half-brick
next tier: 21 full brick
next tier :half-brick, 20 full bricks, half-brick
continue on for 50000 tiers

no of course we do not have to have in the blueprint and instruction for each individual brick but we need SOME kind of instructions

i could give the above to a bricklayer: 4 lines of instruction and do not have to give 50000 lines of instruction. this is the fallacy that the opposition here keeps hyperbolizing on

but the reverse cannot be inferred that we only need one line of instruction

hope the observers see this point ( and why do you call them 'lurkers'?? that is so negative!)

wad of id · 1 October 2008

Or here's another example: how many bytes are there is the water molecules required to generate a snowflake?

Now are those bytes sufficient to instruct or create a snowflake?

See how stupid these requests are?

jobby · 1 October 2008

Bytes do not instruct.

... bytes are a measure of info. the info of a size of 'one byte' DOES instruct.

... so you are saying there is no info in the DNA??

wad of id · 1 October 2008

Your example is fallacious because it does not measure the amount of pre-stored instructions in the workers you asked to build the wall.

Plus we're dealing with natural processes where no other source of information extrinsic to the genome has been detected.

Apples and oranges, jobby
Apples and oranges.

wad of id · 1 October 2008

No, I'm not saying there is no "info" in DNA.

Read: Bytes do not instruct.

Can you understand those 4 words?

jobby · 1 October 2008

Or here’s another example: how many bytes are there is the water molecules required to generate a snowflake?

... of course they are things in nature that self-organize. but the human body is not one of those.

... are you really saying that occasionaly human bodies appear without millions of years of evolution??

wad of id · 1 October 2008

Here, jobby. What does your hard drive with its 750 GB instruct you to do?

LOL

wad of id · 1 October 2008

Self organization doesn't require bytes? REALLY?

Are you that dense. Everything has bytes. A snowflake has bytes.

Take a JPG of the snowflake. It has bytes.

You can describe its fractal shape ... using bytes.

jobby · 1 October 2008

Read: Bytes do not instruct.

Can you understand those 4 words?

DDDDDDDDDDDUUUUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHH!!!!!!!!!

if I say it takes a gallon of gasoline to go 20 miles I am not saying the 'gallon' enables the car to go 20 miles. gallon is a unit of measure just as byte is.

.... that was just a plain stupid comment

wad of id · 1 October 2008

Human bodies do not "occasaionally" appear in "millions of years". Just like Hurricane Katrinas do not "occasionally" appear every second.

jobby · 1 October 2008

Self organization doesn’t require bytes? REALLY?

... no outside instructions. of course the result can be expressing bytes.

... you are just trolling now and making stupid comments

wad of id · 1 October 2008

No the person who is stupid is you. You just admitted the impotency of the byte.

The byte is not a fuel like gasoline. It does not generate heat. It does not create energy. It is just a mathematical construct.

jobby · 1 October 2008

Plus we’re dealing with natural processes where no other source of information extrinsic to the genome has been detected.

....DDDDDDDDDDUUUUUUUUUUUHHHHHHHHH!!!

... so we would need even more info!!

wad of id · 1 October 2008

You are just being stupid. You make an arbitrary distinction between a "self-organizing" system and one which evolves.

In the evolutionary world, both are critical mechanisms at play. Your hard drive has a measure of "self-organizing behavior" Those disk platters don't just magically form. Self-organization. It is what allows bytes to be measured.

wad of id · 1 October 2008

Exactly. It could be possible that the whole information content of the Universe since the start of the time went into generating the genome as it is today.

wad of id · 1 October 2008

What you don't get is that bytes have no causal role.

Are you still stupid, or do you get this point by now?

wad of id · 1 October 2008

jobby, hello are you there?

wad of id · 1 October 2008

is this getting to you yet?

jobby · 1 October 2008

Here’s an example: how many bytes are there in the physical processes required to generate Hurricane Katrina?

.... who knows. certain things in nature happen spontaneously.

.... do you really believe human body happen spontaneously or do they need a long process to evolve them??

wad of id · 1 October 2008

I like the byte just as much as the liter. How many liters is the genome???

Did you know that there are more liters in the human body than in the genome???

Where do all those liters come from???

Maybe it comes from the liters out of the Universe!! LOL

jobby · 1 October 2008

You make an arbitrary distinction between a “self-organizing” system and one which evolves.

... we can observe some things self-organizing. how you seen a human body self-organize lately???

wad of id · 1 October 2008

Have you ever seen an electron jobby?

How do you know that an electron exists.

wad of id · 1 October 2008

Have you ever seen a phasor, jobby?

Do you know that they exist?

wad of id · 1 October 2008

You didn't answer my question, jobby.

How many bytes are in the physical processes which instructed the creation of the Hurricane Katrina.

Do you really concede that "certain things in nature happen spontaneously"???

LOL. You are a believer in magic.

jobby · 1 October 2008

wad of id said: Have you ever seen a phasor, jobby? Do you know that they exist?
YOU ARE A NUT JOB!

wad of id · 1 October 2008

BTW, do you believe in the spontaneous generation of life too?

Pasteur disproved that theory a long long time ago.

Maybe you haven't heard of Pasteur.

wad of id · 1 October 2008

I love you jobby. I would love to fuck you jobby. You turn me on.

wad of id · 1 October 2008

jobby, are you going to have a discussion with me or not?

jobby · 1 October 2008

Do you really concede that “certain things in nature happen spontaneously”???

... you are the one that says the human body magically self-constructs without instructions. I am the one that says it need instructions.

You are just playing here and an observer could see that. BYE!

wad of id · 1 October 2008

hello are you there?

there are a number of substantive counterarguments to your ramblings that you haven't even touched.

wad of id · 1 October 2008

I am not playing... You cannot even show me where I said "the human body magically self-constructs without instructions"

But you did admit that you believed in magic. Why do you subscribe to magic, jobby? Isn't that a bit immature?

I want to continue having this deep philosophical discussion with you.

Don't leave me. You make my life meaningful.

wad of id · 1 October 2008

Jobby, why do you think the Hurricane Katrina was created?

Who made all those bytes to instruct the construction of the Hurricane Katrina?

wad of id · 1 October 2008

What deep magic went into the Hurricane Katrina?

Did it come from the White Witch of Narnia?

wad of id · 1 October 2008

jobby, where are you?

wad of id · 1 October 2008

Jobby, are we still going out tonight? I've got a special room booked just for the two of us. It's going to be a Magical night.

wad of id · 1 October 2008

Let's talk about phasors: http://en.wikipedia.org/wiki/Phasor

It is a widely used engineering concept. It describes how common RLC circuits can affect the phase of a sinusoidal input voltage.

Why don't you know about phasors Jobby?

Are you just a one-trick pony, talking about information information information?

You should broaden your mind.

wad of id · 1 October 2008

Jobby, we can have snowflakes tonight. I can draw all sorts of snowflakes on your spontaneously constructed body.

wad of id · 1 October 2008

Like you, the snowflakes will be exquisitely designed.

wad of id · 1 October 2008

You are just playing here and an observer could see that. BYE!

LOL

wad of id · 1 October 2008

Well guys, if you don't mind, I'd like to be the only person to have a discussion with jobby. I am sure jobby doesn't care. You all can get on with the rest of your lives and do something more useful than bashing a White Witch follower.

wad of id · 1 October 2008

j ... o ... b ... b ... y

I know you're reading this. Your IP address shows up on the monitor.

Why are you avoiding me?

We had such a fulfilling meaningful deep discussion about the mysteries of life.

Where are you hiding from me?

Wayne Francis · 1 October 2008

jobby said: 2) Everything that is known about embryology (which is far from everything)is explained by the interplay of DNA, regulators, cellular biochemistry and the embryo’s environment. ... circular logic! that is exactly what I am saying: we do not know where much of the instructions are coming from. you just said that in your above statement
Once agian Hand Jobby doesn't understand what he's read and what he says makes no sense. This isn't circular logic. The proteins come from the DNA. Environmental factors can effect the function of the protiens but it is not like information contained in the DNA/Proteins. The only thing circular is that the information in one cells DNA comes from the DNA of that cells parent. Follow that back far enough and you come to 1 sperm cell and 1 egg cell, in the case of humans, both which normally hold 1/2 of the DNA of the parent supplying the sperm and egg. You want us to inject some misterious instructions from an unknown source that has an unknown function into the developmental process.

wad of id · 1 October 2008

The more important point is that when scientists say something is unknown it doesn't automatically default to some other Magical answer. We don't know. Jobby certainly doesn't know.

So what? We don't where Jobby crawled out of his Mommy's pussy. But it doesn't mean he was divinely created.

Wayne Francis · 1 October 2008

jobby said: ach of the roughly 800 ommatidia in the compound eyes of fruit flies has a basically fixed number of cells that are programmed, or patterned, ....OK how many bytes of info are needed just to create this eyes? Let start quantifying and quit BSing.
seeing bytes of info can't produce an eye the question is meaningless. Asking what genes are required is a better question but note that if you get an answer it doesn't mean that those genes can only be used in the development of eyes. If at that that time you want to add up the number of base pairs in those genes, and divide by 8 to come up with a number of bytes that it would take to encode the original DNA you will still not have an accurate representation of the process even though all the information flows from that DNA.

wad of id · 1 October 2008

Exactly instruction is nothing more than a mechanism. It's a natural, material concept.

"F = ma" is an instruction

It instructs the mass to generate a force proportional to its acceleration.

The word "instruction" is devoid of meaning aside from its rhetorical effect.

jobby · 1 October 2008

If at that that time you want to add up the number of base pairs in those genes, and divide by 8 to come up with a number of bytes that it would take to encode the original DNA you will still not have an accurate representation of the process even though all the information flows from that DNA.

.... so the hypothesis is not falsifiable. glad you agree. that was my point.

jobby · 1 October 2008

wad of id said: Exactly instruction is nothing more than a mechanism. It's a natural, material concept. "F = ma" is an instruction It instructs the mass to generate a force proportional to its acceleration. The word "instruction" is devoid of meaning aside from its rhetorical effect.
YOU ARE MENTAL!!

wad of id · 1 October 2008

Where does the instruction for "F = m a" come from?

Nobody knows. Must be magic.

wad of id · 1 October 2008

There you are jobby. I have missed you. I knew you were peeping from afar.

Do you know where "instruction" F = ma comes from?

jobby · 1 October 2008

wad of id said: j ... o ... b ... b ... y I know you're reading this. Your IP address shows up on the monitor. Why are you avoiding me? We had such a fulfilling meaningful deep discussion about the mysteries of life. Where are you hiding from me?
I dont like to converse with the mentally ill.

wad of id · 1 October 2008

Here's another instruction for you: V = IR

wad of id · 1 October 2008

But you are more ill than I, jobby. I am here to cure you of your illness. It's an illness called stupidity.

wad of id · 1 October 2008

Here's another instruction for you: circumference = diameter * pi

wad of id · 1 October 2008

Now there's an interesting instruction. How many bits of information are there in pi?

I think it's infinite. Do you know what is the shortest encoding of pi which will generate all of its digits instantaneously?

So does that mean everytime I take a compass and draw a circle, I am imparting infinite information on the piece of paper???

Magic.

wad of id · 1 October 2008

Here's another instruction with infinite bits: area of circle = pi * radius squared

Mind boggling

wad of id · 1 October 2008

Or how about the trigonometric functions?

Take sine. It is represented by (*gasp*) an infinite polynomial.

Did you know, jobby, that the instruction for a simple pendulum has a sine function in it???

How can a pendulum operate with infinite bits of information???

wad of id · 1 October 2008

I don't know about you, jobby my dear. But it looks like there's more to this "information" business than you know.

Your silence is deafening.

wad of id · 1 October 2008

Ooh, here's a lovely instruction: exp(pi*i) = -1

Here an infinitely informative function acts on an infinitely informative constant through an imaginary number to tell it to reduce the integer -1. Always.

How do you like them apples?

wad of id · 1 October 2008

j . . . o . . . b . . . b . . . y

Where are you?

You've run off again, just when the schooling started.

Where are you afraid of learning?

David Stanton · 1 October 2008

So, hand jobby runs away when it thinks that someone is just playing with it, but it wonders why on one will answer it's questions when it plays silly games like taking both sides of an argument or quote mining and then lying about it.

As for falsifiability, hand jobby has had over a week to come up with an example of one protein needed for human development that is not coded for in the human genome. He has failed, therefore his "hypothesis" is falsified.

Oh well, what can you expect from someone who thinks that proteins are "merely bricks". Here is a clue for you hand jobby: proteins are bricks and brick makers, brick layers and foreman supervising the brick laying. Go figure.

Well, I was hoping that this thread would get to 1000 posts. Still, WAD is so prolific that he might just make it on his own.

Wayne Francis · 1 October 2008

jobby said: Going over Hand Jobby’s comments you have to come to the conclusion that he thinks that to build anything you would need a plan bigger then what is being built. .... of course I do not think that! I can have a blueprint for a brick and build a million of them from that. And I can have a blue print for a protein and build a million. But how those pieces are assemble cannot be instructed with ONE BYTE as is the consensus here. .... QUANTIFY!! How many minimum bytes to construct the human eye?????????????? 1 BYTE. you dont see how ridiculous that claim is.
Get off this # of Bytes thing. ~750Mb is an encoding scheme. I can encode the human genome in 1 bit to respresent a given sequenced genome. ~750mb just representing the base pairs, ACGT, of most of the DNA. I could use about 25gb to represent the actual atoms in the genome but loosing detailed positional information. I could use much more space and hold not only the base pair information but folding information of the proteins.
From the Human Genome Project FAQ As time goes on, more annotations will be entered as a result of laboratory findings, literature searches, data analyses, personal communications, automated data-analysis programs, and auto annotators. These annotations associated with the sequence data will likely dwarf the amount of storage space actually taken up by the initial 3 billion nucleotide sequence. Of course, that's not much of a surprise because the sequence is merely one starting point for much deeper biological understanding!
so you don't misunderstand the quote above they are saying as studies are done not only will we have information about the DNA sequence but information like the protein folding, reactions with other proteins, pathways, feedback loops, etc. They aren't expecting to find some other DNA like source of information.

wad of id · 1 October 2008

I don't get why people are obsessed with the bit. What happened to the liter? It's got a richer history. And it's just as informative.

wad of id · 1 October 2008

So, hand jobby runs away when it thinks that someone is just playing with it, but it wonders why on one will answer it’s questions when it plays silly games like taking both sides of an argument or quote mining and then lying about it.

I know! Isn't that rich? LOL I do love hand Jobs.

Wayne Francis · 1 October 2008

jobby said: Going back to conjoined twins Hand Jobby’s statements would say that the “Plan” was for the twins to be conjoined from the start. ... no I never said anything like that. In that case the plan was followed and an error occured in the exectution of the instructions.
The error there could only be construded as the original Zygote not fully splitting into 2 seperate Zygotes. From that point forward the cells that where at the end that didn't fully split acted as if the split didn't happen. The cells at the other end acted as if the split did happen and those in the middle coped with signals that they might not recieve in normal development. The fact is after that first error the evidence is clear. There isn't a hard and fast "Plan" to development that says "This bone is this shape and in this location"

Wayne Francis · 1 October 2008

jobby said: 1. Bobby is unable to quantify the information in the human body, despite his claims. .... # of cells = ~ 10^14 ok now YOU quantitize! how many bytes to instruct the development of the thumbnail???? can you even do that???
See this is your problem. # of cells is just one form of "information" Knowing the number of cells in an average adult human != all the information in that human. What about all the information in each one of those cells. What about all the location information of all those cells. A skin cell has about 10^14 number of atoms in it. You have about 20^15 microbes in you. I dispute your stupid 10^14 number because it leaves out to much "information"

Wayne Francis · 1 October 2008

jobby said: Do you really concede that “certain things in nature happen spontaneously”??? ... you are the one that says the human body magically self-constructs without instructions. I am the one that says it need instructions. You are just playing here and an observer could see that. BYE!
No, we say the body self constructs from the a cascade of events controlled ultimately by DNA present in the fertilized egg. We say the fixed instructions are ultimately in the DNA. You're the one that says there is this magical 2nd source of instructions that no one has ever seen any evidence of.

Wayne Francis · 1 October 2008

jobby said: If at that that time you want to add up the number of base pairs in those genes, and divide by 8 to come up with a number of bytes that it would take to encode the original DNA you will still not have an accurate representation of the process even though all the information flows from that DNA. .... so the hypothesis is not falsifiable. glad you agree. that was my point.
You keep putting words into peoples mouths. I'm saying your request makes no sense. The size in bytes not an accurate representation of what the it can do especially when you compare that binary value to the size of compiled computer code.

jobby · 1 October 2008

I think here is the basic problem:

The posters here believe that the DNA has sufficient storage capacity to construct a human body.

Then I ask: how do you know that?

A: Because there are no other sources for info.

Q: How do you know there are no other sources?

A: Because we have not found any

Q: Just because you have not found any does that mean they do not exist?????????????

wad of id · 1 October 2008

jobby, jobby, jobby. Your perception of the "problem" is way off.

It's not that we "believe" DNA has "storage capacity" to construct a human. It is that we don't think you know what is actually stored in there. The DNA genome is not sufficient for life. There's a whole proteome. Then there are mechanical laws that all of these chemicals follow.

Get it?

jobby · 1 October 2008

There is only a 1.5% difference in monkey and human DNA.

That is only about 14 MB of info that makes us so superior to monkeys. Truly miraculous!

jobby · 1 October 2008

Show me how to falsify this hypothesis:

The 750 MB of info in the human DNA is enough to construct a human.

jobby · 1 October 2008

wad of id said: jobby, jobby, jobby. Your perception of the "problem" is way off. It's not that we "believe" DNA has "storage capacity" to construct a human. It is that we don't think you know what is actually stored in there. The DNA genome is not sufficient for life. There's a whole proteome. Then there are mechanical laws that all of these chemicals follow. Get it?
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.

Robin · 1 October 2008

PvM said: I just gave you the answer but if you want a more indepth one then we can discuss them

Turing (1952) introduced the idea that interactions of reacting and diffusing chemicals (usually of two species) could form self-organizing instabilities that provide the basis for biological spatial patterning

These 'Reaction–diffusion continuum submodels" are partial differential equations which model the spatial and temporal distribution of chemicals. In some way not very different from snowflakes.
...and stalagmites, stalagtites, buttes, towers, trees, sand dunes, caves, sea walls, canyons, and a variety of other shaped objects. Shape is the product of the chemical composition of an object within and acted upon by given environmental factors. No code is necessary for the tibia (or any other structure's shape) in an organism; structures merely take on a shape imparted by the constraints and parameters of their own components and those of the structures and enviroment around them.

fnxtr · 1 October 2008

First you have to tell us what the information actually is, Yobbo. You really don't get that, do you. That's what the guys and gals who actually do the work -- you know, not Aristotlean mind-wankers like you -- are finding out. And what they have been trying to tell you.

David Stanton · 1 October 2008

I think here is the basic problem:

The posters here believe that the DNA has sufficient storage capacity to construct a human body.

Then I ask: how do you know that?

A: Because of the last two hundred years of research

Q: Let's just ignore all of that because I don't know anything about it. How do you know there are no other sources?

A: Because we have not found any in two hundred years of research

Q: Just because you have not found any does that mean they do not exist?????????????

A: Just because you think they might exist doesn't mean they do.

As has been pointed out repeatedly, the burden of proof is on you. You have not even attempted to meet that burden, therefore evreryone has given up on you long ago an is now just making fun of you because you have demonstrated that you should not be take seriously.

Wayne Francis · 1 October 2008

jobby said: There is only a 1.5% difference in monkey and human DNA. That is only about 14 MB of info that makes us so superior to monkeys. Truly miraculous!
Oh Hand Jobby, you can't even get basic species right. Monkey's don't share 98% of our DNA. Chimps and Bonobos do. But you don't even know the difference between monkeys and great apes, which humans are a member of. I'll ask you what organ do you have that they don't? Do you have less hair then a chimp? More Bones? I'll give you a clue to the answer of those 3 questions. The answer is not YES. Their body plan is pretty much the same as ours. If you want your same number of hairs to be as thick as the other great apes then all you need to do is get the CGH gene to express at the right times. Perhaps you could enlighten us on what structure you have in your body that isn't in the other great apes? We've been telling you all along that it doesn't take that much of a change to produce a large amount of variation.
From Katherine Pollard, assistant professor at the UC Davis Genome Center "The differences between chimps and humans are not in our proteins, but in how we use them." Pollard and colleagues at UC Santa Cruz led by David Haussler looked for stretches of DNA that were highly conserved between chimpanzees, mice and rats. Then they compared those sequences to the human genome sequence, to find pieces of DNA that had undergone the most rapid change since the ancestors of chimps and humans diverged about five million years ago. They found 202 "highly accelerated regions" or HARs, which showed a high rate of evolution between humans and chimps. Only three of those regions contain genes that are likely to encode proteins. The most dramatically accelerated region, HAR1, appears to make a piece of RNA that may have a function in brain development. DNA, deoxyribonucleic acid, carries the genetic instructions for making a chimp, a human, a tulip or an amoeba. RNA (ribonucleic acid) is an intermediate molecule that transcribes those instructions to make proteins. The other highly accelerated regions do not appear to code for genes at all, but many are located close to genes involved in controlling when other genes get made, or in growth and development.
Actual scientific studies. Seems the differences is largely the amount different genes are expressed. Bit more here, little less there.

wad of id · 1 October 2008

The 750 MB of info in the human DNA is enough to construct a human.

As far as I can see it is your hypothesis. There are infinite hypotheses out there. Why the fuck should I care about yours?

Robin · 1 October 2008

jobby said: Here’s an example: how many bytes are there in the physical processes required to generate Hurricane Katrina? .... who knows. certain things in nature happen spontaneously. .... do you really believe human body happen spontaneously or do they need a long process to evolve them??
OMG!! Bobjob cannot possibly be this dense! Hurricanes do not spontaneously occur. They develop very similar to living organisms - they have an egg stage, an embryonic stage (at which point quite a number "die"), an adolescent growth stage (where a number die as well), an adult stage. They "eat" and grow. They rely on resources. There are unique features and anomalies in hurricane growth that can be used to tell hurricanes apart. And they have even evolved over time in terms of how they manifest at this point. I have no idea what Bobjob thinks hurricanes (or humans for that matter) are, but he clearly doesn't know anything about them.

Wayne Francis · 1 October 2008

jobby said:
wad of id said: jobby, jobby, jobby. Your perception of the "problem" is way off. It's not that we "believe" DNA has "storage capacity" to construct a human. It is that we don't think you know what is actually stored in there. The DNA genome is not sufficient for life. There's a whole proteome. Then there are mechanical laws that all of these chemicals follow. Get it?
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.
Once again IDIOT your "750 MB" is useless. You compair it to computer code. Useless. We can show you how ~3,000,000,000 base pairs in a cell can construct a human in rough terms. If we knew how it all worked you would not see any research being done in the area now would you. We can tell you that we have not found any other "information" like you are asking for to do any process within the cells. Show use just ONE thing that happens in cell development that gets this massive amount of missing information from some unknown source.

Wayne Francis · 1 October 2008

Robin said:
jobby said: Here’s an example: how many bytes are there in the physical processes required to generate Hurricane Katrina? .... who knows. certain things in nature happen spontaneously. .... do you really believe human body happen spontaneously or do they need a long process to evolve them??
OMG!! Bobjob cannot possibly be this dense! Hurricanes do not spontaneously occur. They develop very similar to living organisms - they have an egg stage, an embryonic stage (at which point quite a number "die"), an adolescent growth stage (where a number die as well), an adult stage. They "eat" and grow. They rely on resources. There are unique features and anomalies in hurricane growth that can be used to tell hurricanes apart. And they have even evolved over time in terms of how they manifest at this point. I have no idea what Bobjob thinks hurricanes (or humans for that matter) are, but he clearly doesn't know anything about them.
The only things I know that happen "spontaneously" in nature are quantum effects and virtual particles. Can anyone think of anything else?

jobby · 1 October 2008

Robin said:
PvM said: I just gave you the answer but if you want a more indepth one then we can discuss them

Turing (1952) introduced the idea that interactions of reacting and diffusing chemicals (usually of two species) could form self-organizing instabilities that provide the basis for biological spatial patterning

These 'Reaction–diffusion continuum submodels" are partial differential equations which model the spatial and temporal distribution of chemicals. In some way not very different from snowflakes.
...and stalagmites, stalagtites, buttes, towers, trees, sand dunes, caves, sea walls, canyons, and a variety of other shaped objects. Shape is the product of the chemical composition of an object within and acted upon by given environmental factors. No code is necessary for the tibia (or any other structure's shape) in an organism; structures merely take on a shape imparted by the constraints and parameters of their own components and those of the structures and enviroment around them.
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.

jobby · 1 October 2008

Wayne Francis said:
Robin said:
jobby said: Here’s an example: how many bytes are there in the physical processes required to generate Hurricane Katrina? .... who knows. certain things in nature happen spontaneously. .... do you really believe human body happen spontaneously or do they need a long process to evolve them??
OMG!! Bobjob cannot possibly be this dense! Hurricanes do not spontaneously occur. They develop very similar to living organisms - they have an egg stage, an embryonic stage (at which point quite a number "die"), an adolescent growth stage (where a number die as well), an adult stage. They "eat" and grow. They rely on resources. There are unique features and anomalies in hurricane growth that can be used to tell hurricanes apart. And they have even evolved over time in terms of how they manifest at this point. I have no idea what Bobjob thinks hurricanes (or humans for that matter) are, but he clearly doesn't know anything about them.
The only things I know that happen "spontaneously" in nature are quantum effects and virtual particles. Can anyone think of anything else?
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.

jobby · 1 October 2008

Wayne Francis said:
jobby said:
wad of id said: jobby, jobby, jobby. Your perception of the "problem" is way off. It's not that we "believe" DNA has "storage capacity" to construct a human. It is that we don't think you know what is actually stored in there. The DNA genome is not sufficient for life. There's a whole proteome. Then there are mechanical laws that all of these chemicals follow. Get it?
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.
Once again IDIOT your "750 MB" is useless. You compair it to computer code. Useless. We can show you how ~3,000,000,000 base pairs in a cell can construct a human in rough terms. If we knew how it all worked you would not see any research being done in the area now would you. We can tell you that we have not found any other "information" like you are asking for to do any process within the cells. Show use just ONE thing that happens in cell development that gets this massive amount of missing information from some unknown source.
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human. If you cannot falsify IT IS NOT A SCIENTIFIC HYPOTHESIS

Robin · 1 October 2008

Wayne Francis said:
Robin said: I have no idea what Bobjob thinks hurricanes (or humans for that matter) are, but he clearly doesn't know anything about them.
The only things I know that happen "spontaneously" in nature are quantum effects and virtual particles. Can anyone think of anything else?
I got a feeling that Bobjob could name a bunch...(rolls eyes)

Robin · 1 October 2008

jobby said: Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human. If you cannot falsify IT IS NOT A SCIENTIFIC HYPOTHESIS
There's your answer - it's not a scientific hypothesis, numbnuts. And no one in science has EVER put forth such a hypothesis. And why? Because 750 MB of information in the human genome is meaningless in and of itself.

wad of id · 1 October 2008

It's about as scientific as saying that the volume of the genome is "enough to construct a human".

eric · 1 October 2008

I think what he's asking is for a complete, millisecond by millisecond description of how the DNA in a single fertilized cell produces an adult human. Evidently no less comprehensive study is convincing, because every time PvM provides one, he asks, "x may explain y, but where did x originate?" eric
fnxtr said: Is it just me or is Yobbo now asking how the sea knows to be salty?

David Stanton · 1 October 2008

So, hand jobby finally gets it. His feeble attempt at converting bases into megabytes is NOT A SCIENTIFIC HYPOTHESIS. Finally, some progress.

jobby · 1 October 2008

David Stanton said: So, hand jobby finally gets it. His feeble attempt at converting bases into megabytes is NOT A SCIENTIFIC HYPOTHESIS. Finally, some progress.
So you feel that the scientists that state the following are in error?? Comparative Sequence Sizes (Bases) (yeast chromosome 3) 350 Thousand Escherichia coli (bacterium) genome 4.6 Million Largest yeast chromosome now mapped 5.8 Million Entire yeast genome 15 Million Smallest human chromosome (Y) 50 Million Largest human chromosome (1) 250 Million Entire human genome 3 Billion

jobby · 1 October 2008

I think what he’s asking is for a complete, millisecond by millisecond description of how the DNA in a single fertilized cell produces an adult human. Evidently no less comprehensive study is convincing, because every time PvM provides one, he asks, “x may explain y, but where did x originate?”

... no I am not! Such hyperbole! Is that all you got??

jobby · 1 October 2008

Hurricanes do not spontaneously occur.

... are they programmed?? as life is??

PvM · 1 October 2008

Sigh... You really refuse to learn, despite you lousy track record showing a vast amount of ignorance. That's too bad.
jobby said: Hurricanes do not spontaneously occur. ... are they programmed?? as life is??

PvM · 1 October 2008

As usual Bobby is somewhat creative with his 'memory'.
jobby said: I think here is the basic problem: The posters here believe that the DNA has sufficient storage capacity to construct a human body. Then I ask: how do you know that? A: Because there are no other sources for info. Q: How do you know there are no other sources? A: Because we have not found any Q: Just because you have not found any does that mean they do not exist?????????????

PvM · 1 October 2008

Show us the information content of a human body.
jobby said: Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.

PvM · 1 October 2008

No, you ask us to accept by faith your claim that it is not enough even though you have presented no evidence and despite us having presented much evidence to place doubt on your position. Such ignorance, under the guise of 'skepticism' combined with an unwillingness to learn ID at its best
jobby said: I think what he’s asking is for a complete, millisecond by millisecond description of how the DNA in a single fertilized cell produces an adult human. Evidently no less comprehensive study is convincing, because every time PvM provides one, he asks, “x may explain y, but where did x originate?” ... no I am not! Such hyperbole! Is that all you got??

David Stanton · 1 October 2008

Hand jobby has just proven my point for me. The authors describe the genomes in base pairs not megabytes. DNA is not an ASCII code. Why can't this entity ever get around the bricks in it's head?

Of course, every in vitro fertilization ever done disproves the hypothesis that 3 billion base pairs is not sufficient to specify the development of a human being.

phantomreader42 · 1 October 2008

And if he actually got this, he'd immediately lie about reading it, claim it wasn't enough, then pretend he never asked for it.
eric said: I think what he's asking is for a complete, millisecond by millisecond description of how the DNA in a single fertilized cell produces an adult human. Evidently no less comprehensive study is convincing, because every time PvM provides one, he asks, "x may explain y, but where did x originate?" eric
fnxtr said: Is it just me or is Yobbo now asking how the sea knows to be salty?

PvM · 1 October 2008

Yes, his argument that the difference between a human and a chimp is 14Mbytes and finds this incredible suggests that Jobby's common 'scientific argument' is one of personal incredulity due to ignorance of science.

Fascinating but in the end, doomed to remain as vacuous as its foundation, Intelligent Design.

For that we should thank Bobby as he continues to underline that ID is not a scientifically relevant position and in fact relies on ignorance of science to make 'claims' that 'well heck I could not possibly understand how this could be the case'. When people attempt to clarify the ignorance, the subject refuses any attempt to educate.

In order to present a scientific argument Bobby has to show that the information content in the genome (which he guestimates to be 750mb), is at odds with the information content of the human body (which he claims is complex but refuses to estimate).

So far there has been no evidence of a conflict and much evidence of the contrary and yet, Bobby's argument? Are you sure...

Science is never 100% sure, but its explanations surely beat the ignorance approach chosen by Bobby. And for what reason?

jobby · 1 October 2008

PvM said: Yes, his argument that the difference between a human and a chimp is 14Mbytes and finds this incredible suggests that Jobby's common 'scientific argument' is one of personal incredulity due to ignorance of science. Fascinating but in the end, doomed to remain as vacuous as its foundation, Intelligent Design. For that we should thank Bobby as he continues to underline that ID is not a scientifically relevant position and in fact relies on ignorance of science to make 'claims' that 'well heck I could not possibly understand how this could be the case'. When people attempt to clarify the ignorance, the subject refuses any attempt to educate. In order to present a scientific argument Bobby has to show that the information content in the genome (which he guestimates to be 750mb), is at odds with the information content of the human body (which he claims is complex but refuses to estimate). So far there has been no evidence of a conflict and much evidence of the contrary and yet, Bobby's argument? Are you sure... Science is never 100% sure, but its explanations surely beat the ignorance approach chosen by Bobby. And for what reason?
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.

jobby · 1 October 2008

DNA is not an ASCII code.

... dummy: you can have bits and bytes without an ascii code.

Robin · 1 October 2008

jobby said:
David Stanton said: So, hand jobby finally gets it. His feeble attempt at converting bases into megabytes is NOT A SCIENTIFIC HYPOTHESIS. Finally, some progress.
So you feel that the scientists that state the following are in error?? Comparative Sequence Sizes (Bases) (yeast chromosome 3) 350 Thousand Escherichia coli (bacterium) genome 4.6 Million Largest yeast chromosome now mapped 5.8 Million Entire yeast genome 15 Million Smallest human chromosome (Y) 50 Million Largest human chromosome (1) 250 Million Entire human genome 3 Billion
Clearly Bobjob is out to lunch at this point since Stanton's point about scientific hypotheses has nothing to do with the metrics Bobjob posted. (rolls eyes)

Robin · 1 October 2008

jobby said: DNA is not an ASCII code. ... dummy: you can have bits and bytes without an ascii code.
Not outside of a computer environment, beandip.

Robin · 1 October 2008

jobby said: Hurricanes do not spontaneously occur. ... are they programmed?? as life is??
Life isn't programmed, beandip.

Robin · 1 October 2008

jobby said:
PvM said: Yes, his argument that the difference between a human and a chimp is 14Mbytes and finds this incredible suggests that Jobby's common 'scientific argument' is one of personal incredulity due to ignorance of science. Fascinating but in the end, doomed to remain as vacuous as its foundation, Intelligent Design. For that we should thank Bobby as he continues to underline that ID is not a scientifically relevant position and in fact relies on ignorance of science to make 'claims' that 'well heck I could not possibly understand how this could be the case'. When people attempt to clarify the ignorance, the subject refuses any attempt to educate. In order to present a scientific argument Bobby has to show that the information content in the genome (which he guestimates to be 750mb), is at odds with the information content of the human body (which he claims is complex but refuses to estimate). So far there has been no evidence of a conflict and much evidence of the contrary and yet, Bobby's argument? Are you sure... Science is never 100% sure, but its explanations surely beat the ignorance approach chosen by Bobby. And for what reason?
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.
It's not a scientific hypothesis, beandip.

jobby · 1 October 2008

It’s not a scientific hypothesis, beandip.

... dummie: why not??

PvM · 1 October 2008

Show that the information content in the human cannot be accounted for by the DNA content of the human. Show that in the formation of an embryo, additional sources of information are used. If your argument is that 3 billion base pairs with 1.5% of them expressing proteins and an unknown quantity involved as regulatory elements or expressed as RNA is insufficient then you need to show that the detailed embryological experiments which have, in case of C Elegans, tracked the fate of every single cell, and is showing how the genetic networks affect said fate, repeatably amongst embryos is insufficient. I understand your reluctance to look at the actual evidence which shows that it is the combination of proteins, and their local gradients, as well as the boundary conditions and laws of physics (and chemistry) which all interact. Let me attempt to show you a fascinating example about hox genes In Drosophila, "Christiane Nüsslein-Volhard and Eric F. Wieschaus identified and classified 15 genes of key importance in determining the body plan and the formation of body segments of the fruit fly Drosophila melanogaster. Edward B. Lewis studied the next step - homeotic genes that govern the development of a larval segment into a specific body segment. " This information can be easily accessed from Wikipedia. Only 15 genes, determine the body plan and body segmentation of the fruit fly. How could this possibly be? Let's look at the details It all starts with maternal genes which express bicoid and nanos Bicoid is the interesting gene as it forms a gradient along the embryo, determining the lengthwise axis of the body. Hunchback is a zygotic gene, expressed by the embryo, not the mother, and is regulated by Bicoid, and thus matches the gradient established by bicoid. But what about the gap genes, such as Kruepel, Giant and Knirps, how do they know how to from stripes across the embryo? Simple, their expression is tightly coupled to a particular range in the value of hunchback. For Kruepel see this graph which shows how the gene is expressed only when the range of Hunchback is within a small window. Of course, all these genes are not only regulated by Hunchback but also by eachother, turning on or off, amplifying or supressing, causing an interesting pattern to emerge. The gap genes in turn regulate pair genes which form the beautiful striped pattern. So now we have gone from bicoid, a maternal gene product, to a striped pattern which describes the various body segments that will develop. Let's have a look at a gene network diagram As PZ explain, "The pair rule genes are numerous, and also interact with one another, and will in turn regulate yet another level of the hierarchy, the segment polarity genes. The segment polarity genes are turned in in every segment, within specific subregions of the segment. Years of tracing these interactions now allows us to assemble diagrams of the regulatory cascade involved that look like this, where arrows indicate that a gene activates another, and bars indicate that it inhibits it" Read it all at Zygotic genes For C elegans and Drosophila, these networks are best described due to their history. From there we can learn and expand. I showed you a reference of the vulva formation in C elegans, have you looked at the reference yet? The fascinating facts are that these hox genes are 'well conserved' across life, showing expansion, and they are all expressed in similar fashion across life. Still with me?
jobby said:
PvM said: Yes, his argument that the difference between a human and a chimp is 14Mbytes and finds this incredible suggests that Jobby's common 'scientific argument' is one of personal incredulity due to ignorance of science. Fascinating but in the end, doomed to remain as vacuous as its foundation, Intelligent Design. For that we should thank Bobby as he continues to underline that ID is not a scientifically relevant position and in fact relies on ignorance of science to make 'claims' that 'well heck I could not possibly understand how this could be the case'. When people attempt to clarify the ignorance, the subject refuses any attempt to educate. In order to present a scientific argument Bobby has to show that the information content in the genome (which he guestimates to be 750mb), is at odds with the information content of the human body (which he claims is complex but refuses to estimate). So far there has been no evidence of a conflict and much evidence of the contrary and yet, Bobby's argument? Are you sure... Science is never 100% sure, but its explanations surely beat the ignorance approach chosen by Bobby. And for what reason?
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.

jobby · 1 October 2008

Life isn’t programmed, beandip.

.... dummie: Then what is the purpose of the DNA??

jobby · 1 October 2008

In Drosophila, “Christiane Nüsslein-Volhard and Eric F. Wieschaus identified and classified 15 genes of key importance in determining the body plan and the formation of body segments of the fruit fly Drosophila melanogaster. Edward B. Lewis studied the next step - homeotic genes that govern the development of a larval segment into a specific body segment. “

This information can be easily accessed from Wikipedia. Only 15 genes, determine the body plan and body segmentation of the fruit fly. How could this possibly be?

.... read more carefully 15 genes determine the body segments. not the actually details of those segments

PvM · 1 October 2008

Sure, much more detail is needed to work out the fate of the individual segments, what I am showing is how a cascade of hierarchical activation of gene networks sets in motion a process which appears to be in no need of additional 'mythical' information. And for good reasons, after all many embryos are quite well protected from their environments. But let's explore further I mentioned bicoid and the gap genes "Acting as a transcription factor, Bicoid can activate a number of downstream gap genes, including hunchback, knirps, giant, and Krüppel, whose products cross-react in a complex and mainly repressive interaction network to modulate each other's expression (reviewed in [37]; modelled in [45,46])." 37 Rivera-Pomar R, Jäckle H. From gradients to stripes in Drosophila embryogenesis: filling in the gaps. Trends Genet. 1996 Nov;12(11):478-83.

Pattern formation along the anterior-posterior axis of the Drosophila embryo is organized by asymmetrically distributed maternal transcription factors. They initiate a cascade of spatially restricted and interacting zygotic gene activities that provide a molecular blueprint of the larval body at blastoderm stage. The key players in the pattern forming process have been identified. Recent progress has begun to reveal the mechanisms by which coherent positional information of maternal origin becomes transferred into serially repeated zygotic gene expression domains reflecting the metameric body plan of the larva.

45 Jaeger J, Blagov M, Kosman D, Kozlov KN, Manu , Myasnikova E, Surkova S, Vanario-Alonso CE, Samsonova M, Sharp DH, Reinitz J., " Dynamical analysis of regulatory interactions in the gap gene system of Drosophila melanogaster." Genetics. 2004 Aug;167(4):1721-37.

Genetic studies have revealed that segment determination in Drosophila melanogaster is based on hierarchical regulatory interactions among maternal coordinate and zygotic segmentation genes. The gap gene system constitutes the most upstream zygotic layer of this regulatory hierarchy, responsible for the initial interpretation of positional information encoded by maternal gradients. We present a detailed analysis of regulatory interactions involved in gap gene regulation based on gap gene circuits, which are mathematical gene network models used to infer regulatory interactions from quantitative gene expression data. Our models reproduce gap gene expression at high accuracy and temporal resolution. Regulatory interactions found in gap gene circuits provide consistent and sufficient mechanisms for gap gene expression, which largely agree with mechanisms previously inferred from qualitative studies of mutant gene expression patterns. Our models predict activation of Kr by Cad and clarify several other regulatory interactions. Our analysis suggests a central role for repressive feedback loops between complementary gap genes. We observe that repressive interactions among overlapping gap genes show anteroposterior asymmetry with posterior dominance. Finally, our models suggest a correlation between timing of gap domain boundary formation and regulatory contributions from the terminal maternal system

46 Sánchez L, Thieffry D. " A logical analysis of the Drosophila gap-gene system." J Theor Biol. 2001 Jul 21;211(2):115-41. See also erratum in: J Theor Biol 2001 Sep 7;212(1):127.

This manuscript focuses on the formal analysis of the gap-gene network involved in Drosophila segmentation. The gap genes are expressed in defined domains along the anterior-posterior axis of the embryo, as a response to asymmetric maternal information in the oocyte. Though many of the individual interactions among maternal and gap genes are reasonably well understood, we still lack a thorough understanding of the dynamic behavior of the system as a whole. Based on a generalized logical formalization, the present analysis leads to the delineation of: (1) the minimal number of distinct, qualitative, functional levels associated with each of the key regulatory factors (the three maternal Bcd, Hb and Cad products, and the four gap Gt, Hb, Kr and Kni products); (2) the most crucial interactions and regulatory circuits of the earliest stages of the segmentation process; (3) the ordering of different regulatory interactions governed by each of these products according to corresponding concentration scales; and (4) the role of gap-gene cross-interactions in the transformation of graded maternal information into discrete gap-gene expression domains. The proposed model allows not only the qualitative reproduction of the patterns of gene expression characterized experimentally, but also the simulation and prediction of single and multiple mutant phenotypes.

jobby said: In Drosophila, “Christiane Nüsslein-Volhard and Eric F. Wieschaus identified and classified 15 genes of key importance in determining the body plan and the formation of body segments of the fruit fly Drosophila melanogaster. Edward B. Lewis studied the next step - homeotic genes that govern the development of a larval segment into a specific body segment. “ This information can be easily accessed from Wikipedia. Only 15 genes, determine the body plan and body segmentation of the fruit fly. How could this possibly be? .... read more carefully 15 genes determine the body segments. not the actually details of those segments
Where in these processes do you see a lack of genetic information? If there were such gaps, how would you intend to explain this? 1) external inflow of information across fetal boundaries? 2) internal information redistributed 3) unknown processes yet to be determine? Share with us your thoughts as we work our way through how embryos develop. Perhaps you can provide us with an estimate of the amount of information the was used to reach this state and the amount of information actually needed to get to this stage? After all, you seem to suggest there exists a problem, it's time to identify said problem. It's easy to make negative claims, especially when based on ignorance, now let's take a scientific approach. After all, given your stated interest in such a route, I assume you are able and willing to take the challenge to its next level? Advise me also when you have your estimates of information content of the human body available. We are still waiting patiently

PvM · 1 October 2008

The following website at the Max Planck Institute for developmental biology outlines the relevance. The basic model of patterning was predicted before the biochemical details were available and the data ended up largely supporting the original model, however the model itself generates additional requirements and predictions about how polarity is transmitted and more.

Actually, somewhat ironically, the patterning of stripes is in this case not a Turing pattern. You remember Turing who pointed out that reaction diffusion models away from equilibrium can form patterns? The wave like patterns were indeed suggestive of such a model, which science found, in this case to be flawed. The site provides links to three pdf papers which outline the basics.

Still with us?

jobby · 1 October 2008

dvise me also when you have your estimates of information content of the human body available. We are still waiting patiently

... YOU are making the claim. I am saying it seems unreasonable. Then you say that you feel it IS reasonable. This again is all, all a priori. We can debate about it forever.

UNTIL

You show me how you can falsify your assertion that the DNA contains enough info to construct a human body. Ptolemy came up with tons of explanations which his geocentrism was true. But an experiment proved him false.

Where is your experiment??

jobby · 1 October 2008

PvM said: The following website at the Max Planck Institute for developmental biology outlines the relevance. The basic model of patterning was predicted before the biochemical details were available and the data ended up largely supporting the original model, however the model itself generates additional requirements and predictions about how polarity is transmitted and more. Actually, somewhat ironically, the patterning of stripes is in this case not a Turing pattern. You remember Turing who pointed out that reaction diffusion models away from equilibrium can form patterns? The wave like patterns were indeed suggestive of such a model, which science found, in this case to be flawed. The site provides links to three pdf papers which outline the basics. Still with us?
.......... Well of course genes have clever ways of doing their jobs but is still does not show that the DNA has enough room.

jobby · 1 October 2008

PvM said: The following website at the Max Planck Institute for developmental biology outlines the relevance. The basic model of patterning was predicted before the biochemical details were available and the data ended up largely supporting the original model, however the model itself generates additional requirements and predictions about how polarity is transmitted and more. Actually, somewhat ironically, the patterning of stripes is in this case not a Turing pattern. You remember Turing who pointed out that reaction diffusion models away from equilibrium can form patterns? The wave like patterns were indeed suggestive of such a model, which science found, in this case to be flawed. The site provides links to three pdf papers which outline the basics. Still with us?
Would one megabyte of DNA be enough info to construct the human body???

PvM · 1 October 2008

Do you mean one megabase? Megabyte is a measure of storage not necessarily information content. A better question which avoids this confusion is to ask, is the genetic information sufficient to generate an organism. The answer so far is apparently so. This is based on both positive evidence from embryology as well as a lack of evidence of 1) insufficiency of DNA information 2) ways DNA information is to be supplemented. Lacking a competing hypothesis, your claim, like so many ID claims, lacks anything that makes it scientifically relevant. It's an interesting question which may lead to predictable tests, but so far you have shown no evidence or intention to present us with further details than your personal level of ignorance.
jobby said:
PvM said: The following website at the Max Planck Institute for developmental biology outlines the relevance. The basic model of patterning was predicted before the biochemical details were available and the data ended up largely supporting the original model, however the model itself generates additional requirements and predictions about how polarity is transmitted and more. Actually, somewhat ironically, the patterning of stripes is in this case not a Turing pattern. You remember Turing who pointed out that reaction diffusion models away from equilibrium can form patterns? The wave like patterns were indeed suggestive of such a model, which science found, in this case to be flawed. The site provides links to three pdf papers which outline the basics. Still with us?
Would one megabyte of DNA be enough info to construct the human body???

PvM · 1 October 2008

jobby said: dvise me also when you have your estimates of information content of the human body available. We are still waiting patiently ... YOU are making the claim. I am saying it seems unreasonable. Then you say that you feel it IS reasonable. This again is all, all a priori. We can debate about it forever. UNTIL You show me how you can falsify your assertion that the DNA contains enough info to construct a human body. Ptolemy came up with tons of explanations which his geocentrism was true. But an experiment proved him false. Where is your experiment??
It's called embryology. Have you been asleep? Ptolemy was disproven by evidence. you have none. Until then, your 'skepticism' which is based on a position of ignorance has no relevance. This is not a priori stuff, this is all based on the hard work of theoretical and experimental biologists who are unraveling how DNA regulates the formation of the embryo. And so far, other than your ignorance, you have not provided us with any evidence that DNA is insufficient in generating the embryo, and in fact you have ignored much of the evidence that shows that as far as science knows so far there is no need to invoke such a position. Until you show us that there is a real problem, your ignorance when compared to science fails scientifically to be relevant.

PvM · 1 October 2008

And no, you were making the claim that the human body is somehow more complex, and yet when asked, you provide no logic, no reason, no experiments, no hypothesis, nothing. You say it seems unreasonable, an argument from personal ignorance. I am saying it seems sufficient based on the following experiments and observations. Whose position is scientifically fruitful, whose position causes one to ignore scientific evidence?
jobby said: dvise me also when you have your estimates of information content of the human body available. We are still waiting patiently ... YOU are making the claim. I am saying it seems unreasonable. Then you say that you feel it IS reasonable. This again is all, all a priori. We can debate about it forever. UNTIL You show me how you can falsify your assertion that the DNA contains enough info to construct a human body. Ptolemy came up with tons of explanations which his geocentrism was true. But an experiment proved him false. Where is your experiment??

jobby · 1 October 2008

This is based on both positive evidence from embryology as well as a lack of evidence of 1) insufficiency of DNA information 2) ways DNA information is to be supplemented.

... the amount of data that can be store in the dna is 750 MB and you are saying that is enough. and your reasoning is that there is a lack of evidence that it is not enough.

circular logic again

... I can say I can jump 10 feet and you ask me to prove it. And I say that since there is no evidence that I cannot then I must be able to.

jeez!!

jobby · 1 October 2008

How many MB are needed to construct a fingernail?

Could it be done in 1 MB??

PvM · 1 October 2008

Again you are arguing a meaningless number, conflating data storage requirements with informational content. You are claiming, based on ignorance, that you believe such amount, which appears to be somewhat arbitrary, is insufficient. I point out that so far there appears to be no evidence that this is the case as science has shown for simple organisms how DNA regulates the process and there appears to be no need for additional mythical information flow. So far, you have expressed your position of personal disbelief, a position I cannot easily dispense with if you are reluctant to alleviate your level of ignorance. All I am doing is showing you the evidence that science has collected and how science explains it, in response you argue that 'I still don't believe it'. That's a position of ultimate ignorance my dear friend. I am sorry to hear that you seem to be unwilling to address the scientific data and facts and show us that there is a reasonable foundation for your disbelief.
jobby said: This is based on both positive evidence from embryology as well as a lack of evidence of 1) insufficiency of DNA information 2) ways DNA information is to be supplemented. ... the amount of data that can be store in the dna is 750 MB and you are saying that is enough. and your reasoning is that there is a lack of evidence that it is not enough. circular logic again ... I can say I can jump 10 feet and you ask me to prove it. And I say that since there is no evidence that I cannot then I must be able to. jeez!!

PvM · 1 October 2008

Mbytes of what? A better question may be: how many genes are involved in regulating the formation of the finger nail. Do you have any idea? Do you have any idea how you could gather such data? How much information is stored in a fingernail? Show us the necessary data and then argue, until then all you have is a position of ignorance.
jobby said: How many MB are needed to construct a fingernail? Could it be done in 1 MB??

PvM · 1 October 2008

In this context the following paper may be of interest

T SUMMARY Paleontological evidence indicates that the evolutionary diversification of mammals early in the Cenozoic era was characterized by an adaptive radiation of distal limb structures. Likewise, neontological data show that morphological variation in distal limb integumentary appendages (e.g., nails, hooves, and claws) can be observed not only among distantly related mammalian taxa but also among closely related species within the same clade. Comparative analysis of nail, claw, and hoof morphogenesis reveals relatively subtle differences in mesenchymal and epithelial patterning underlying these adult differences in distal limb appendage morphology. Furthermore, studies of regulatory gene expression during vertebrate claw development demonstrate that many of the signaling molecules involved in patterning ectodermal derivatives such as teeth, hair, and feathers are also involved in organizing mammalian distal limb appendages. For example, Bmp4 signaling plays an important role during the recruitment of mesenchymal cells into the condensations forming the terminal phalanges, whereas Msx2 affects the length of nails and claws by suppressing proliferation of germinal epidermal cells. Evolutionary changes in the form of distal integumentary appendages may therefore result from changes in gene expression during formation of mesenchymal condensations (Bmp4, posterior Hox genes), induction of the claw fold and germinal matrix (shh), and/or proliferation of epidermal cells in the claw matrix (Msx1, Msx2). The prevalence of convergences and parallelisms in nail and claw structure among mammals underscores the existence of multiple morphogenetic pathways for evolutionary change in distal limb appendages.

Note how many of the genes involved in fingernail formation are also used during distal limb patterning. A great example of how evolution reuses modules for different purposes. A simplistic Mbases to Mbytes would have ignored such facts. Thanks for bringing up finger nails, it's a real nail biter for your position...

Robin · 1 October 2008

jobby said: It’s not a scientific hypothesis, beandip. ... why not??
Because no scientist has put it forth as an hypothesis, beandip. That there appears to be information in the genome equivalent to about 750 (or 700 or 800 or 18000 or whatever) MBs is merely a metric. It has nothing to do with any hypothesis, beandip.

jobby · 1 October 2008

PvM said: Mbytes of what? A better question may be: how many genes are involved in regulating the formation of the finger nail. Do you have any idea? Do you have any idea how you could gather such data? How much information is stored in a fingernail? Show us the necessary data and then argue, until then all you have is a position of ignorance.
jobby said: How many MB are needed to construct a fingernail? Could it be done in 1 MB??
....Show ME the necessary data and then argue, until then all YOU have is a position of ignorance. .. you claim the DNA has enough X to construct a human body and your main proof is that is no evidence is does not. .... well how about the those invisible pink unicorns. show me your data they do not exist.

jobby · 1 October 2008

Because no scientist has put it forth as an hypothesis, beandip. That there appears to be information in the genome equivalent to about 750 (or 700 or 800 or 18000 or whatever) MBs is merely a metric. It has nothing to do with any hypothesis, beandip.

...dummie: merely a metric?? like the earth is not 7000 years old, just a dumb old metric that year thing.

....dummie: science is based on metrics! that's what the inverse proportionality of gravity is based on, dummie!

jobby · 1 October 2008

Bmp4 signaling plays an important role during the recruitment of mesenchymal cells into the condensations forming the terminal phalanges, whereas Msx2 affects the length of nails and claws by suppressing proliferation of germinal epidermal cells.

... and where do Bmp4 and Msx2 get the info to perform their tasks??

jobby · 1 October 2008

Can natural selection add information to the genome??

Robin · 1 October 2008

jobby said: Life isn’t programmed, beandip. .... Then what is the purpose of the DNA??
Your question is meaningless, beandip because "purpose" is an illusion. It is a concept humans impart on items in the world, but it has no objective value. What is the purpose of the planet Mars? What is the purpose of a rain drop? What is the purpose gold? What is the purpose of a star exploding 10,000 billion light years from Earth? What is the purpose of a rock?

jobby · 1 October 2008

Robin said:
jobby said: Life isn’t programmed, beandip. .... Then what is the purpose of the DNA??
Your question is meaningless, beandip because "purpose" is an illusion. It is a concept humans impart on items in the world, but it has no objective value. What is the purpose of the planet Mars? What is the purpose of a rain drop? What is the purpose gold? What is the purpose of a star exploding 10,000 billion light years from Earth? What is the purpose of a rock?
...OK dummie: Life isn’t programmed, beandip. .… Then what is the function of the DNA??

Robin · 1 October 2008

jobby said:
PvM said: Mbytes of what? A better question may be: how many genes are involved in regulating the formation of the finger nail. Do you have any idea? Do you have any idea how you could gather such data? How much information is stored in a fingernail? Show us the necessary data and then argue, until then all you have is a position of ignorance.
....Show ME the necessary data and then argue, until then all YOU have is a position of ignorance.
Burden of proof fallacy, beandip.
.. you claim the DNA has enough X to construct a human body and your main proof is that is no evidence is does not.
False. Argument from ignorance, beandip.
.... well how about the those invisible pink unicorns. show me your data they do not exist.
Fallacy of composition (along with question begging, digressing, moving the goal posts, and argument by question). Science does not prove (or even consider) negatives, beandip.

Robin · 1 October 2008

jobby said: Because no scientist has put it forth as an hypothesis, beandip. That there appears to be information in the genome equivalent to about 750 (or 700 or 800 or 18000 or whatever) MBs is merely a metric. It has nothing to do with any hypothesis, beandip. ...dummie: merely a metric??
Yes, beandip. It's just metric.
like the earth is not 7000 years old, just a dumb old metric that year thing.
That's not a metric, beandip. That's a conclusion drawn from a metric, beandip.
....science is based on metrics! that's what the inverse proportionality of gravity is based on!
Science is based on a lot of things, beandip - observations, hypotheses, tests, metrics, applied principles, peer reviews, practical applications, etc. Metrics are but one small part of science, beandip.

Robin · 1 October 2008

jobby said:
Robin said:
jobby said: Life isn’t programmed, beandip. .... Then what is the purpose of the DNA??
Your question is meaningless, beandip because "purpose" is an illusion. It is a concept humans impart on items in the world, but it has no objective value. What is the purpose of the planet Mars? What is the purpose of a rain drop? What is the purpose gold? What is the purpose of a star exploding 10,000 billion light years from Earth? What is the purpose of a rock?
.… Then what is the function of the DNA??
Information copying or transmission via complementary base-pairing.

fnxtr · 1 October 2008

jobby said: DNA is not an ASCII code. ... dummy: you can have bits and bytes without an ascii code.
Nor is it COBOL, or BASIC, or C++, or machine code. Let's clear this up, Yobbo: What part of the DNA molecule do you think is equivalent to one 8-bit byte? A single base? A base pair? A codon? 8 of any of these? Why? What 'information' do you think this 8-bit byte can store a) in a computer and b) in a genome? How do you convert one to the other? What's the genomic equivalent, for example, of "Clear register A" in Z80 code? What's the computer equivalent of 'create a template for alanine to form on'? You see, Yobbo: it's a garbage argument you are making.

jobby · 1 October 2008

Burden of proof fallacy, beandip.

.... dummie: So YOU have not burden of proof??

fnxtr · 1 October 2008

oops. Okay, "attach to", not "form on".

jobby · 1 October 2008

fnxtr said:
jobby said: DNA is not an ASCII code. ... dummy: you can have bits and bytes without an ascii code.
Nor is it COBOL, or BASIC, or C++, or machine code. Let's clear this up, Yobbo: What part of the DNA molecule do you think is equivalent to one 8-bit byte? A single base? A base pair? A codon? 8 of any of these? Why? What 'information' do you think this 8-bit byte can store a) in a computer and b) in a genome? How do you convert one to the other? What's the genomic equivalent, for example, of "Clear register A" in Z80 code? What's the computer equivalent of 'create a template for alanine to form on'? You see, Yobbo: it's a garbage argument you are making.
Funded by: National Institutes of Health; Grant Number: AR-39959, NS-32675 Neutrogena Corporation Dermatology Foundation Abstract The basal cell nevus syndrome (Gorlin syndrome) is characterized by multiple basal cell carcinomas and diverse developmental defects. The gene responsible for this syndrome has been mapped previously to a 2 cM interval between D9S196 and D9S180 at 9q22.3, and very recently mutations of a candidate gene in this region - the human homolog of the Drosophila patched gene - have been identified. We report here on physical mapping studies integrating a contig of yeast artificial chromosomes and bacterial artificial chromosomes with a long-range map spanning approximately 5 Mb between the recombination-determined flanking markers. Six genes have been mapped to this interval. Genes Chromosom. Cancer 18:305-309, 1997. © 1997 Wiley-Liss, Inc. Received: 28 June 1996; Accepted: 4 September 1996

jobby · 1 October 2008

The human genome consists of 3 billion base pairs, which is equivalent to about 750 MB. Our genome contains genetic information from more primitive organisms (bloatware?) just as our physical structure has primitive antecedents.

fnxtr · 1 October 2008

jobby said: Can natural selection add information to the genome??
Nope. Mutation and fertilization do that. You really do have a lot of reading to catch up on, don't you, Yobbo. Natural selection just tends to pick the more advantageous mutations, some of which include added information via duplication, etc. Make sense?

fnxtr · 1 October 2008

Mb means Mega-BASES, dolt. 5 million bases long. It's a measure of DISTANCE.

And you haven't answered my questions at all. Not that I really thought you would.

jobby · 1 October 2008

fnxtr said:
jobby said: Can natural selection add information to the genome??
Nope. Mutation and fertilization do that. You really do have a lot of reading to catch up on, don't you, Yobbo. Natural selection just tends to pick the more advantageous mutations, some of which include added information via duplication, etc. Make sense?
NS is not the driving force that adds info?? Mutation and fertilization without NS can add info? BULL! why do you lie like that?

Robin · 1 October 2008

Burden of proof fallacy, beandip.
jobby said: .... So YOU have not burden of proof??
No 'we' don't, beanddip. At least, not regarding the amount of MBs of information in the human (or any other organism's) genome.

David Stanton · 1 October 2008

This just in, I have found the reference tht hand jobby keeps demanding:

U. R. A. Dolt et al. (2008) Human genome size and human development. Journal of Metaphysics 1(6):660-666.

From the Abstract:

We performed in vitro fertilization under normal conditions as a control. We also perfored an identical experiment inside a stasis field specifically designed to prevent the entry of any information from any outside source, natural or supernatural. The developmental rates were identical between the two treatments and there was no statistically significant difference in mortality rates. We conclude that the amount of information in a diploid human genome is sufficient to generate a human individual without the need for any further information from any other source.

From the Future Research section:

We are planning to convert the information in the human genome into ASCII code and attempt to generate a human being using the information is this form. Preliminary results suggest that this approach will be unproductive.

Robin · 1 October 2008

jobby said:
fnxtr said:
jobby said: DNA is not an ASCII code. ... dummy: you can have bits and bytes without an ascii code.
Nor is it COBOL, or BASIC, or C++, or machine code. Let's clear this up, Yobbo: What part of the DNA molecule do you think is equivalent to one 8-bit byte? A single base? A base pair? A codon? 8 of any of these? Why? What 'information' do you think this 8-bit byte can store a) in a computer and b) in a genome? How do you convert one to the other? What's the genomic equivalent, for example, of "Clear register A" in Z80 code? What's the computer equivalent of 'create a template for alanine to form on'? You see, Yobbo: it's a garbage argument you are making.
Funded by: National Institutes of Health; Grant Number: AR-39959, NS-32675 Neutrogena Corporation Dermatology Foundation Abstract The basal cell nevus syndrome (Gorlin syndrome) is characterized by multiple basal cell carcinomas and diverse developmental defects. The gene responsible for this syndrome has been mapped previously to a 2 cM interval between D9S196 and D9S180 at 9q22.3, and very recently mutations of a candidate gene in this region - the human homolog of the Drosophila patched gene - have been identified. We report here on physical mapping studies integrating a contig of yeast artificial chromosomes and bacterial artificial chromosomes with a long-range map spanning approximately 5 Mb between the recombination-determined flanking markers. Six genes have been mapped to this interval. Genes Chromosom. Cancer 18:305-309, 1997. © 1997 Wiley-Liss, Inc. Received: 28 June 1996; Accepted: 4 September 1996
Non-sequitur, beandip. "MB" above refers to "Megabases" not "Megabytes", beandip. Read up on the subject you are complaining about, beandip.

Robin · 1 October 2008

jobby said:
fnxtr said:
jobby said: Can natural selection add information to the genome??
Nope. Mutation and fertilization do that. You really do have a lot of reading to catch up on, don't you, Yobbo. Natural selection just tends to pick the more advantageous mutations, some of which include added information via duplication, etc. Make sense?
NS is not the driving force that adds info??
No, beandip, it isn't.
Mutation and fertilization without NS can add info?
Yes, beandip.
BULL! why do you lie like that?
The only person who has presented any lies is you beandip. In this case however, you apparently are not very knowledgable about evolution, beandip.

jobby · 1 October 2008

“MB” above refers to “Megabases” not “Megabytes”, beandip.

dummie a megabase is roughly equivalent to a megabyte. look it up dummie.

jobby · 1 October 2008

NS is not the driving force that adds info??

No, beandip, it isn’t.

.... so one celled animals could have evolved into humans without NS???

that is one of the stupidest things i have heard

hahahah bwahahah!

eric · 1 October 2008

jobby said: Bmp4 signaling plays an important role during the recruitment of mesenchymal cells into the condensations forming the terminal phalanges, whereas Msx2 affects the length of nails and claws by suppressing proliferation of germinal epidermal cells. ... and where do Bmp4 and Msx2 get the info to perform their tasks??
As I said earlier PvM, he's demanding a perfect, comprehensive explanation.
..you claim the DNA has enough X to construct a human body and your main proof is that is no evidence is does not.
Actually no. PvM cited tons of papers of experiments showing that, if you mess with DNA, it changes the development of an organism. If you remove stretches of DNA, certain developmental processes don't happen. That's called evidence for his hypothesis. In contrast you have cited no evidence for your idea that something other than DNA carries information. So, on PvM's side, lots of papers. On Jobby's, no papers. PvM's is therefore the best explanation. Cheer up though. You now have a chance to marshall and present your evidence. When its stronger than PvM's, you will have the best explanation. But just to be clear, a nonexplanation such as what you currently have never trumps a partial explanation. To be "best" you have to have *more* evidence *for* your hypothesis, not just poke holes in other peoples'.
.… Then what is the function of the DNA??
AFAIK its mechanical function is to take unlinked amino acids and link them up into long-string proteins.

Robin · 1 October 2008

jobby said: “MB” above refers to “Megabases” not “Megabytes”, beandip. dummie a megabase is roughly equivalent to a megabyte. look it up dummie.
False, beandip. Megabase From Wikipedia, the free encyclopedia Jump to: navigation, search A megabase (Mb) is a unit of length for DNA fragments, equal to 1 million nucleotides. In the human genome, one megabase is roughly equivalent to one centimorgan (cM) or 1 million base pairs (bps). When the Human Genome Project notes that: "One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space." They are talking about the computer storage space they need to store all the genetic information they have mapped out not the amount of information contained in the genome itself, beandip: "How big is the human genome? The human genome is made up of DNA, which has four different chemical building blocks. These are called bases and abbreviated A, T, C, and G. In the human genome, about 3 billion bases are arranged along the chromosomes in a particular order for each unique individual. To get an idea of the size of the human genome present in each of our cells, consider the following analogy: If the DNA sequence of the human genome were compiled in books, the equivalent of 200 volumes the size of a Manhattan telephone book (at 1000 pages each) would be needed to hold it all. It would take about 9.5 years to read out loud (without stopping) the 3 billion bases in a person's genome sequence. This is calculated on a reading rate of 10 bases per second, equaling 600 bases/minute, 36,000 bases/hour, 864,000 bases/day, 315,360,000 bases/year. Storing all this information is a great challenge to computer experts known as bioinformatics specialists. One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space. Since the human genome is 3 billion base pairs long, 3 gigabytes of computer data storage space are needed to store the entire genome. This includes nucleotide sequence data only and does not include data annotations and other information that can be associated with sequence data. As time goes on, more annotations will be entered as a result of laboratory findings, literature searches, data analyses, personal communications, automated data-analysis programs, and auto annotators. These annotations associated with the sequence data will likely dwarf the amount of storage space actually taken up by the initial 3 billion nucleotide sequence. Of course, that's not much of a surprise because the sequence is merely one starting point for much deeper biological understanding!" http://www.ornl.gov/sci/techresources/Human_Genome/faq/faqs1.shtml Once again, you are wrong beandip.

PvM · 1 October 2008

I too find this argument a bit 'wanting'. But let me explain what increases information in the genome: the process of 1. Variation 2. Inheritance 3. Natural Selection Variation by itself, unless in small populations, is unlikely to add new information by itself. Natural selection without variation is powerless and without inheritance, there is no way of this information to be passed on.
jobby said: NS is not the driving force that adds info?? No, beandip, it isn’t. .... so one celled animals could have evolved into humans without NS??? that is one of the stupidest things i have heard hahahah bwahahah!

phantomreader42 · 1 October 2008

Actually, when asked, he not only provides no logic or evidence, he denies making the claim, repeatedly, even when quoted, and then makes the same claim again after declaring he'd never made it. This creature just does not live in the real world. It has never had anything to say but lies and endless bullshitting. In conclusion, bobby the boob is a worthless lying sack of shit and all his future comments should be immediately deleted as spam.
PvM said: And no, you were making the claim that the human body is somehow more complex, and yet when asked, you provide no logic, no reason, no experiments, no hypothesis, nothing. You say it seems unreasonable, an argument from personal ignorance. I am saying it seems sufficient based on the following experiments and observations. Whose position is scientifically fruitful, whose position causes one to ignore scientific evidence?
jobby said: dvise me also when you have your estimates of information content of the human body available. We are still waiting patiently ... YOU are making the claim. I am saying it seems unreasonable. Then you say that you feel it IS reasonable. This again is all, all a priori. We can debate about it forever. UNTIL You show me how you can falsify your assertion that the DNA contains enough info to construct a human body. Ptolemy came up with tons of explanations which his geocentrism was true. But an experiment proved him false. Where is your experiment??

Robin · 1 October 2008

jobby said:
Beandip: NS is not the driving force that adds info?? Robin said: No, beandip, it isn’t.
.... so one celled animals could have evolved into humans without NS???
Fallacy of the general rule and question begging, beandip.
that is one of the stupidest things i have heard hahahah bwahahah!
Sure is, beandip. Why did you ask the question then?

phantomreader42 · 1 October 2008

jobby said: NS is not the driving force that adds info?? No, beandip, it isn’t. .... so one celled animals could have evolved into humans without NS??? that is one of the stupidest things i have heard hahahah bwahahah!
Well, YOU'RE the one who made it up, so I guess you agree that you're a worthless lying sack of shit without a single functioning brain cell.

jobby · 1 October 2008

Once again, you are wrong beandip.

... dummie: what was i wrong about??

PvM · 1 October 2008

Again you misrepresent the history of the argument. You argued that the information in the genome was somehow insufficient. I proposed that instead we determine if DNA was sufficient in explaining the genesis of a fetus (pardon the pun). In order to compare the two 'competing hypotheses' I furthered a positive hypothesis which outlines how genetic DNA is translate into messenger RNA (where alternative splicing can cause the same gene to be translated differently) and how mRNA is expressed as a protein which then folds in to a structure which enables it to interact in a particular manner with other proteins and chemicals. I showed how the combination of proteins, regulatory elements form genetic networks which together with the laws of physics and chemistry can form 'patterns' which guide the development of the embryo. So far I have shown how DNA appears to be sufficient and while there of course always remains a possibility that DNA is insufficient, there is no evidence to support said claim, there are no observations to support said claim and there are no logical of physical reasons to suggest that there exists another unspecified source of information.
jobby said:
PvM said: Mbytes of what? A better question may be: how many genes are involved in regulating the formation of the finger nail. Do you have any idea? Do you have any idea how you could gather such data? How much information is stored in a fingernail? Show us the necessary data and then argue, until then all you have is a position of ignorance. Your argument is one of ignorance, just like the pink unicorn which lacks in any detail. It's non productive, counter factual and provides no testable hypotheses. If that's what you intend, then fine, I will agree that science can never exclude the possibility that a yet to be determined, unknown, unquantifiable, factor is necessary for the development of the embryo, what I can say is that given our present knowledge of this, which I admit in many areas is quite lacking in sufficient details, there appears to be no need to invoke such a 'gap claim'.
jobby said: How many MB are needed to construct a fingernail? Could it be done in 1 MB??
....Show ME the necessary data and then argue, until then all YOU have is a position of ignorance. .. you claim the DNA has enough X to construct a human body and your main proof is that is no evidence is does not. .... well how about the those invisible pink unicorns. show me your data they do not exist.

PvM · 1 October 2008

jobby said: Can natural selection add information to the genome??
Yes, once variation exists, the process is all but inevitable

PvM · 1 October 2008

jobby said: Bmp4 signaling plays an important role during the recruitment of mesenchymal cells into the condensations forming the terminal phalanges, whereas Msx2 affects the length of nails and claws by suppressing proliferation of germinal epidermal cells. ... and where do Bmp4 and Msx2 get the info to perform their tasks??
Typically these are cascading hierarchies where previous expressed genes guide the next level of gene expression, all jump started by the maternal gene products. What I am showing here is how nails not only show a fascinating example of evolution, but also show how the genes involved are reused. In other words, your guestimates of information content, which are based on 'storage requirements' are flawed since they fail to incorporate 1. multiple splicing 2. multiple re-use of the same protein pathways.

PvM · 1 October 2008

Mb : mega bases not mega bytes. Sorry Jobby. The jump from mega bases to mega bytes is at best an estimate of storage requirements not necessary the information content.
jobby said:
fnxtr said:
jobby said: DNA is not an ASCII code. ... dummy: you can have bits and bytes without an ascii code.
Nor is it COBOL, or BASIC, or C++, or machine code. Let's clear this up, Yobbo: What part of the DNA molecule do you think is equivalent to one 8-bit byte? A single base? A base pair? A codon? 8 of any of these? Why? What 'information' do you think this 8-bit byte can store a) in a computer and b) in a genome? How do you convert one to the other? What's the genomic equivalent, for example, of "Clear register A" in Z80 code? What's the computer equivalent of 'create a template for alanine to form on'? You see, Yobbo: it's a garbage argument you are making.
Funded by: National Institutes of Health; Grant Number: AR-39959, NS-32675 Neutrogena Corporation Dermatology Foundation Abstract The basal cell nevus syndrome (Gorlin syndrome) is characterized by multiple basal cell carcinomas and diverse developmental defects. The gene responsible for this syndrome has been mapped previously to a 2 cM interval between D9S196 and D9S180 at 9q22.3, and very recently mutations of a candidate gene in this region - the human homolog of the Drosophila patched gene - have been identified. We report here on physical mapping studies integrating a contig of yeast artificial chromosomes and bacterial artificial chromosomes with a long-range map spanning approximately 5 Mb between the recombination-determined flanking markers. Six genes have been mapped to this interval. Genes Chromosom. Cancer 18:305-309, 1997. © 1997 Wiley-Liss, Inc. Received: 28 June 1996; Accepted: 4 September 1996

phantomreader42 · 1 October 2008

jobby said: Once again, you are wrong beandip. ... dummie: what was i wrong about??
There's a hole with no bottom. Do you have some sort of bizarre medical condition that causes you to forget every event the instant it happens? A total lack of even the concept of past events? You've been telling blatant lies in this thread for over a week, and every time you're proven wrong you deny whatever idiocy you said that's been totally demolished. Since you're obviously very stupid as well as a liar, perhaps it hasn't been pointed out that there is a RECORD of hte things you've said. Countless times, you've made claims that are plainly, factually false, and been shown that they are false. Then, of course, you lie. Ladies and gentlement, this is creationism in a nutshell. This pathetic empty husk of a man cannot face reality. So it lies, constantly, without remorse and without end. When one of its claims is shown to be wrong, it pretends it never made that claim, no matter how many times the evidence is shown, then picks up the same discredited bullshit again and again. This creature does not understand how anyone can even see a problem with lying. The concept of truth is alien to it. Its ideology demands endless fraud, and it complies gladly. The whole Intelligent Design movement is founded on lying, and this undead sockpuppet troll is a perfect example. There is no hope of reasoning with it. It has wrapped itself up so tightly in delusion that reality will never penetrate. In conclusion, bobby the boob is a worthless lying sack of shit and all his future posts should be automatically deleted as spam.

David Stanton · 1 October 2008

So let's review shall we? So far the troll of many names has claimed that proteins are "merely bricks" and that one mega base is the same as one megabyte. Is it any wonder that no one will take it seriously when it tries to argue about human development?

Now I propose an experiment. Let's try to determine the information content in the 10 megabytes of garbage that it has spewed all over this thread. That shouldn't be so hard considering the highly repetitive nature of it's ranting.

Closing in on 1000. Yea.

Robin · 1 October 2008

jobby said: Once again, you are wrong beandip. ... dummie: what was i wrong about??
Megabase is a length. It has nothing to do with storage, beandip.

Paul Burnett · 1 October 2008

jobby said: ...science is based on metrics! that's what the inverse proportionality of gravity is based on...
Where you read about the "inverse proportionality of gravity"? Literary citation, please.

jobby · 1 October 2008

Can natural selection add information to the genome??

Yes, once variation exists, the process is all but inevitable

.... information has been added gradually since millions of years ago so that what was a reptile eventually became a human?

jobby · 1 October 2008

Megabase is a length. It has nothing to do with storage, beandip.

... dummie. are you saying that 2 Megabases have the same info storage as 1 megabase??

jobby · 1 October 2008

phantomreader42 said:
jobby said: Once again, you are wrong beandip. ... dummie: what was i wrong about??
There's a hole with no bottom. Do you have some sort of bizarre medical condition that causes you to forget every event the instant it happens? A total lack of even the concept of past events? You've been telling blatant lies in this thread for over a week, and every time you're proven wrong you deny whatever idiocy you said that's been totally demolished. Since you're obviously very stupid as well as a liar, perhaps it hasn't been pointed out that there is a RECORD of hte things you've said. Countless times, you've made claims that are plainly, factually false, and been shown that they are false. Then, of course, you lie. Ladies and gentlement, this is creationism in a nutshell. This pathetic empty husk of a man cannot face reality. So it lies, constantly, without remorse and without end. When one of its claims is shown to be wrong, it pretends it never made that claim, no matter how many times the evidence is shown, then picks up the same discredited bullshit again and again. This creature does not understand how anyone can even see a problem with lying. The concept of truth is alien to it. Its ideology demands endless fraud, and it complies gladly. The whole Intelligent Design movement is founded on lying, and this undead sockpuppet troll is a perfect example. There is no hope of reasoning with it. It has wrapped itself up so tightly in delusion that reality will never penetrate. In conclusion, bobby the boob is a worthless lying sack of shit and all his future posts should be automatically deleted as spam.
... you seem to be unable to stop responding to me. I have fun watching you squirm.

jobby · 1 October 2008

Information copying or transmission via complementary base-pairing.

.... and it does not store info???

jobby · 1 October 2008

What I am showing here is how nails not only show a fascinating example of evolution, but also show how the genes involved are reused. In other words, your guestimates of information content, which are based on ‘storage requirements’ are flawed since they fail to incorporate 1. multiple splicing 2. multiple re-use of the same protein pathways.

.... when a human sperm unites with a human egg how does that cell know to become a human??

Stanton · 1 October 2008

jobby said: Megabase is a length. It has nothing to do with storage, beandip. ... dummie. are you saying that 2 Megabases have the same info storage as 1 megabase??
What evidence is there that shows how bytes correspond to DNA and RNA base pairs? You have not presented any evidence that demonstrates this, nor have you explained how bytes are analogous to DNA bases.
jobby said: Information copying or transmission via complementary base-pairing. .... and it does not store info???
You were the one who claimed that the information contained within the genome is insufficient, and you have not presented evidence to support this claim, and you have not explained how genomic information is insufficient.

Stanton · 1 October 2008

jobby said: .... when a human sperm unites with a human egg how does that cell know to become a human??
Have you ever tried reading a biology textbook to find out?

jobby · 1 October 2008

.… when a human sperm unites with a human egg how does that cell know to become a human??

Have you ever tried reading a biology textbook to find out?

dummie: does that mean you do not have and answer??

jobby · 1 October 2008

You were the one who claimed that the information contained within the genome is insufficient, and you have not presented evidence to support this claim, and you have not explained how genomic information is insufficient.

... you have not provided evidence to support YOUR claim either.

Dan · 1 October 2008

jobby said: You know I am talking about experimental proof in journals.
As a matter of fact, no, I'm not a mind reader. I don't know what you mean, I only know what you say. I answered the question you asked. If you intended to ask a different question, you should have asked that one instead.

jobby · 1 October 2008

You know I am talking about experimental proof in journals.

As a matter of fact, no, I’m not a mind reader. I don’t know what you mean, I only know what you say.

I answered the question you asked. If you intended to ask a different question, you should have asked that one instead.

... then you have not been following the thread

PvM · 1 October 2008

Oh man, I underestimated you level of knowledge when I assumed a basic understanding of embryology. I apologize. Let me go back to the birds and the bees first...Sigh... The answer, in a few words is, that the cell really does not 'know' but rather that the pattern emerges to hierarchical cascades of modular events in which proteins are expressed, interact with other proteins, and are shaped by the laws of chemistry and physics. In the beginning all cells are totipotent (I guess omnipotent was too confusing a term) and they really do not know their future, and yet, especially in lower organisms, the fate map of every single cell can be determined and is predictable once established. The fate is determine through the unraveling of said hierarchical gene expressions, the interactions, feedbacks etc. Well, now I repeat myself. So how does cell 'x' knows to become a bone cell? Because his neighbor tells him so. How does the neighbor 'know', it all goes back to an unfolding of actions, leading to what is more commonly described by the term 'emergence'. Nothing mythical but much is determined by local gradients, local boundaries, local chemistry. There is no single DNA which necessarily tells a cell. You are destined to become 'x'. And yet when the cascades unfold, the outcome is quite predictable. Do you own any textbooks on embryology? What did you do with the links on bicoid and drosophila or c elegans and the vulva development? I could show you how science has unraveld the eye formation on drosophila, would that be educational and worth my effort? Note that much of this knowledge I have yet to acquire, although I have read the various review papers which have outlined this fascinating story of research, experiment, hypothesis forming. Would you be interested to explore such a concept together? What do you say...
jobby said: What I am showing here is how nails not only show a fascinating example of evolution, but also show how the genes involved are reused. In other words, your guestimates of information content, which are based on ‘storage requirements’ are flawed since they fail to incorporate 1. multiple splicing 2. multiple re-use of the same protein pathways. .... when a human sperm unites with a human egg how does that cell know to become a human??

PvM · 1 October 2008

I guess that makes you a dummie as well as you have remained totally unable to support your claim about the information in a human. Does this mean that you do not have an answer. And, contrary to your claim, there exists many good text books which exactly deal with this problem and yet when I point you in a particular direction you become easily distracted or discouraged and quickly chose another direction? Have you no interest to learn about science?
jobby said: .… when a human sperm unites with a human egg how does that cell know to become a human?? Have you ever tried reading a biology textbook to find out? dummie: does that mean you do not have and answer??

Stanton · 1 October 2008

jobby said:

You were the one who claimed that the information contained within the genome is insufficient, and you have not presented evidence to support this claim, and you have not explained how genomic information is insufficient.

... you have not provided evidence to support YOUR claim either.
Your lying about us not presenting evidence demonstrating that the genome is sufficient for the development of the (human) body does not do anything about the fact that you have not bothered to presented any evidence to suggest that the genome is insufficient. I repeat my question: what evidence do you have to suggest that the genome has insufficient information for the growth and development of the (human) body?
jobby said: when a human sperm unites with a human egg how does that cell know to become a human??

Have you ever tried reading a biology textbook to find out?

dummie: does that mean you do not have and answer??
Did it ever occur to you that I was trying to give you a subtle hint that biologists have already found out how animals develop from gametogenesis to embryogenesis to development and birth decades ago, and have labored hard in order to put this information in almost every biology textbook that has been published in the last 50 years?

Stanton · 1 October 2008

PvM said: [Has Bobby/jobby/jacob/balanced/hamstrung] no interest to learn about science?
Do you want to answer the €64,000,000 question, or shall I?

jobby · 1 October 2008

Stanton said:
jobby said:

You were the one who claimed that the information contained within the genome is insufficient, and you have not presented evidence to support this claim, and you have not explained how genomic information is insufficient.

... you have not provided evidence to support YOUR claim either.
Your lying about us not presenting evidence demonstrating that the genome is sufficient for the development of the (human) body does not do anything about the fact that you have not bothered to presented any evidence to suggest that the genome is insufficient. I repeat my question: what evidence do you have to suggest that the genome has insufficient information for the growth and development of the (human) body?
jobby said: when a human sperm unites with a human egg how does that cell know to become a human??

Have you ever tried reading a biology textbook to find out?

dummie: does that mean you do not have and answer??
Did it ever occur to you that I was trying to give you a subtle hint that biologists have already found out how animals develop from gametogenesis to embryogenesis to development and birth decades ago, and have labored hard in order to put this information in almost every biology textbook that has been published in the last 50 years?
YOU ARE A LIAR!

jobby · 1 October 2008

Stanton said:
PvM said: [Has Bobby/jobby/jacob/balanced/hamstrung] no interest to learn about science?
Do you want to answer the €64,000,000 question, or shall I?
... has Pvm no desire to open up his mind and try to shrug off the brainwashing?

wad of id · 1 October 2008

yup, i'm convinced. jobby said it, therefore it must be true.

ROFL

Stanton · 1 October 2008

jobby said: YOU ARE A LIAR!
Why would I lie about biologists wanting to disseminate information about the gametogenesis and embryogenesis of the development of animals? Furthermore, how is falsely claiming that I'm a liar supposed to be evidence to support your claim that the genome is somehow insufficient for the growth and development of the (human) body? Is that all you can muster?

Stanton · 1 October 2008

jobby said:
Stanton said:
PvM said: [Has Bobby/jobby/jacob/balanced/hamstrung] no interest to learn about science?
Do you want to answer the €64,000,000 question, or shall I?
... has Pvm no desire to open up his mind and try to shrug off the brainwashing?
Then how come you are unwilling to provide evidence that the genome is somehow insufficient for the growth and development of the (human) body?

jobby · 1 October 2008

Then how come you are unwilling to provide evidence that the genome is somehow insufficient for the growth and development of the (human) body?

....Then how come you are unwilling to provide evidence that the genome is somehow sufficient for the growth and development of the (human) body?

Stanton · 1 October 2008

jobby said:

Then how come you are unwilling to provide evidence that the genome is somehow insufficient for the growth and development of the (human) body?

....Then how come you are unwilling to provide evidence that the genome is somehow sufficient for the growth and development of the (human) body?
We have already presented you with lots of evidence, but, you have consistently ignored all of them. Furthermore, you are the one making the extraordinary claim: in order for people to take extraordinary claims into serious consideration, evidence must be given to support the aforementioned claims. That you continue to demand evidence from us that is freely available on the Internet via a search engine such as Google or PubMed in response to a request that you provide evidence to support your own extraordinary claim strongly suggests that you have no evidence to support your extraordinary claim, and that your demands that we support what has already been proven and supported is nothing more than a pitiful attempt at distraction. If you really had evidence that the genome is somehow insufficient for storing the information needed for the growth and development of the (human) body, you should have been able to have presented this evidence over 800 comments ago.

jobby · 1 October 2008

We have already presented you with lots of evidence, but, you have consistently ignored all of them.

...Bull! show me one piece of evidence

jobby · 1 October 2008

If you really had evidence that the genome is truly sufficient for storing the information needed for the growth and development of the (human) body, you should have been able to have presented this evidence over 800 comments ago.

PvM · 1 October 2008

jobby said: Then how come you are unwilling to provide evidence that the genome is somehow insufficient for the growth and development of the (human) body? ....Then how come you are unwilling to provide evidence that the genome is somehow sufficient for the growth and development of the (human) body?
The latter assertion is disproven by the facts that indeed such evidence was provided and understandably ignored

Stanton · 1 October 2008

jobby said: We have already presented you with lots of evidence, but, you have consistently ignored all of them. ...Bull! show me one piece of evidence
You were the one who made the claim, and it's your responsibility to support your own claim. Shifting the burden onto us reflects poorly only on you, as it suggests that you are incapable of supporting your own claim.
jobby said: If you really had evidence that the genome is truly sufficient for storing the information needed for the growth and development of the (human) body, you should have been able to have presented this evidence over 800 comments ago.
So then why can't you show evidence to support your own claims? In fact, you have never explained why you think that the human genome is allegedly informationally insufficient beyond an extremely brief and inept comparison of DNA to ASCII.

PvM · 1 October 2008

Now that's ironic
jobby said:
Stanton said:
PvM said: [Has Bobby/jobby/jacob/balanced/hamstrung] no interest to learn about science?
Do you want to answer the €64,000,000 question, or shall I?
... has Pvm no desire to open up his mind and try to shrug off the brainwashing?

PvM · 1 October 2008

Nope, that's what i was attempting to walk you through. Perhaps your argument is that science has not all the answers but there is surely no evidence that DNA is not sufficient to explain the fetus. Simple fact.
jobby said:
Stanton said:
jobby said:

You were the one who claimed that the information contained within the genome is insufficient, and you have not presented evidence to support this claim, and you have not explained how genomic information is insufficient.

... you have not provided evidence to support YOUR claim either.
Your lying about us not presenting evidence demonstrating that the genome is sufficient for the development of the (human) body does not do anything about the fact that you have not bothered to presented any evidence to suggest that the genome is insufficient. I repeat my question: what evidence do you have to suggest that the genome has insufficient information for the growth and development of the (human) body?
jobby said: when a human sperm unites with a human egg how does that cell know to become a human??

Have you ever tried reading a biology textbook to find out?

dummie: does that mean you do not have and answer??
Did it ever occur to you that I was trying to give you a subtle hint that biologists have already found out how animals develop from gametogenesis to embryogenesis to development and birth decades ago, and have labored hard in order to put this information in almost every biology textbook that has been published in the last 50 years?
YOU ARE A LIAR!

Stanton · 1 October 2008

PvM said:
jobby said: Then how come you are unwilling to provide evidence that the genome is somehow insufficient for the growth and development of the (human) body? ....Then how come you are unwilling to provide evidence that the genome is somehow sufficient for the growth and development of the (human) body?
The latter assertion is disproven by the facts that indeed such evidence was provided and understandably ignored
The troll is obviously not aware that we have seen him repeatedly ignore all evidence that we have provided for his inane demands time and time again.

jobby · 1 October 2008

Nope, that’s what i was attempting to walk you through. Perhaps your argument is that science has not all the answers but there is surely no evidence that DNA is not sufficient to explain the fetus.

Simple fact.

.... but there is surely no evidence that DNA IS sufficient to explain the fetus.

jobby · 1 October 2008

The latter assertion is disproven by the facts that indeed such evidence was provided and understandably ignored

... sorry wrong.

PvM · 1 October 2008

jobby said: Can natural selection add information to the genome?? Yes, once variation exists, the process is all but inevitable .... information has been added gradually since millions of years ago so that what was a reptile eventually became a human?
Poor description but sufficiently accurate considering the source. Hint: A better statement is that reptiles and humans share common ancestor not reptiles became humans. The information concept addresses the evolution of all life. But yes, natural selection and sufficient variation are sufficient to explain increase in information in the genome. Your point? If any

PvM · 1 October 2008

jobby said: The latter assertion is disproven by the facts that indeed such evidence was provided and understandably ignored ... sorry wrong.
as I said, understandably ignored Now one may wonder why that is, but I am at the moment less interested in speculation and more in the facts.

PvM · 1 October 2008

Nope, still failing to admit your flaws I notice.
jobby said: Megabase is a length. It has nothing to do with storage, beandip. ... dummie. are you saying that 2 Megabases have the same info storage as 1 megabase??

PvM · 1 October 2008

jobby said: We have already presented you with lots of evidence, but, you have consistently ignored all of them. ...Bull! show me one piece of evidence
If you deny that we have not, then there is little hope for you, however anyone reading this thread can read and observe that such information was shared with you. You may claim that the information is insufficient but it addresses, at least in part how science established the foundations for its claims and allows it to be compared to an ID position of no evidence, no data, no hypotheses, exemplifying why ID is doomed to remain scientifically without any content. Even Jobby serves a purpose on the forum :-)

jobby · 1 October 2008

A better statement is that reptiles and humans share common ancestor not reptiles became humans.

... are you saying reptiles are not ancestors of humans??

jobby · 1 October 2008

If you deny that we have not, then there is little hope for you, however anyone reading this thread can read and observe that such information was shared with you.

.... if you think the unrelated cut and pastes you presented were proof that the DNA has sufficient info there is very, very little hope for YOU

PvM · 1 October 2008

I believe that the problem is with your characterization of 'cut and paste' which was an attempt to educate you as to how science explains how DNA regulates the formation of the embryo. I am somewhat surprised that someone who claims to be so interested in science, can so easily reject science
jobby said: If you deny that we have not, then there is little hope for you, however anyone reading this thread can read and observe that such information was shared with you. .... if you think the unrelated cut and pastes you presented were proof that the DNA has sufficient info there is very, very little hope for YOU

PvM · 1 October 2008

jobby said: A better statement is that reptiles and humans share common ancestor not reptiles became humans. ... are you saying reptiles are not ancestors of humans??
Do you?

fnxtr · 1 October 2008

You know, there's a much simpler solution to the puzzle of why Yobbo acts the way he does: he's crazy. Just plain nuts. Unhinged. Fits all the facts.

Adjusted your tinfoil hat lately, Yobbo? After all the aliens who created you can surely read your mind if you don't keep changing the jamming frequency.

tresmal · 1 October 2008

jobby said: This is based on both positive evidence from embryology as well as a lack of evidence of 1) insufficiency of DNA information 2) ways DNA information is to be supplemented. ... the amount of data that can be store in the dna is 750 MB and you are saying that is enough. and your reasoning is that there is a lack of evidence that it is not enough. circular logic again ... I can say I can jump 10 feet and you ask me to prove it. And I say that since there is no evidence that I cannot then I must be able to. jeez!!
That one actually made my eyes bleed. OK jobby your analogy is hopelessly wrong (surprise!), but it can be tweaked into something more informative. A man is undeniably and repeatedly observed to move himself backwards 10 feet through the air. He is observed making jumping motions. It is demonstrated that at no point does he touch the ground in between. His finish position is carefully measured and documented to be 10 feet behind his start position. etc. Along comes jobby who flat out declares that the man's legs are not strong enough to allow him to jump 10 feet backwards. Jobby provides absolutely no evidence whatsoever. He simply finds it hard to believe so therefore he is right. It is pointed out to jobby that there is no evidence that there is anything helping the man jump. There are no springs or motors or rockets etc. on the man's legs. There are no cables helping to support the mans weight. All that is observed is the man jumping backward and subsequently being 10 feet behind his original position. Jobby says that's not proof! Until you quantize the strength of the man's leg muscles all you have is FAITH that they're strong enough! He asks where is your peer reviewed paper that quantizes the man's muscles and shows that they're strong enough? etc.

Henry J · 1 October 2008

A better statement is that reptiles and humans share common ancestor not reptiles became humans.

The Tree-of-Life page http://tolweb.org/Amniota refers to the clade containing reptiles and mammals as amniota, and shows reptilia and synapsida (which includes mammals) as separate branches. So not everybody regards early amniotes as already being reptiles, though I suppose it's likely that some label them as such. Henry

tresmal · 1 October 2008

fnxtr said: You know, there's a much simpler solution to the puzzle of why Yobbo acts the way he does: he's crazy. Just plain nuts. Unhinged. Fits all the facts. Adjusted your tinfoil hat lately, Yobbo? After all the aliens who created you can surely read your mind if you don't keep changing the jamming frequency.
I have picked up in this and in other threads that jobby has some notions regarding aliens. Anybody care to fill me in?

PvM · 1 October 2008

Would Jobby even understand the difference?
Henry J said:

A better statement is that reptiles and humans share common ancestor not reptiles became humans.

The Tree-of-Life page http://tolweb.org/Amniota refers to the clade containing reptiles and mammals as amniota, and shows reptilia and synapsida (which includes mammals) as separate branches. So not everybody regards early amniotes as already being reptiles, though I suppose it's likely that some label them as such. Henry

Stanton · 1 October 2008

tresmal said:
jobby said: This is based on both positive evidence from embryology as well as a lack of evidence of 1) insufficiency of DNA information 2) ways DNA information is to be supplemented. ... the amount of data that can be store in the dna is 750 MB and you are saying that is enough. and your reasoning is that there is a lack of evidence that it is not enough. circular logic again ... I can say I can jump 10 feet and you ask me to prove it. And I say that since there is no evidence that I cannot then I must be able to. jeez!!
That one actually made my eyes bleed. OK jobby your analogy is hopelessly wrong (surprise!), but it can be tweaked into something more informative. A man is undeniably and repeatedly observed to move himself backwards 10 feet through the air. He is observed making jumping motions. It is demonstrated that at no point does he touch the ground in between. His finish position is carefully measured and documented to be 10 feet behind his start position. etc. Along comes jobby who flat out declares that the man's legs are not strong enough to allow him to jump 10 feet backwards. Jobby provides absolutely no evidence whatsoever. He simply finds it hard to believe so therefore he is right. It is pointed out to jobby that there is no evidence that there is anything helping the man jump. There are no springs or motors or rockets etc. on the man's legs. There are no cables helping to support the mans weight. All that is observed is the man jumping backward and subsequently being 10 feet behind his original position. Jobby says that's not proof! Until you quantize the strength of the man's leg muscles all you have is FAITH that they're strong enough! He asks where is your peer reviewed paper that quantizes the man's muscles and shows that they're strong enough? etc.
And when the peer reviewed papers quantifying the man's muscle strength are produced, he pretends they don't exist, while continuing on with his babbling about how no one can provide evidence that the man can jump approximately 10 feet backwards.

Stanton · 1 October 2008

tresmal said:
fnxtr said: You know, there's a much simpler solution to the puzzle of why Yobbo acts the way he does: he's crazy. Just plain nuts. Unhinged. Fits all the facts. Adjusted your tinfoil hat lately, Yobbo? After all the aliens who created you can surely read your mind if you don't keep changing the jamming frequency.
I have picked up in this and in other threads that jobby has some notions regarding aliens. Anybody care to fill me in?
Potential candidates for the "Intelligent Designers" of "Intelligent Design Theory," though he claims that he isn't an Intelligent Design proponent.

Wayne Francis · 1 October 2008

jobby said:
David Stanton said: So, hand jobby finally gets it. His feeble attempt at converting bases into megabytes is NOT A SCIENTIFIC HYPOTHESIS. Finally, some progress.
So you feel that the scientists that state the following are in error?? Comparative Sequence Sizes (Bases) (yeast chromosome 3) 350 Thousand Escherichia coli (bacterium) genome 4.6 Million Largest yeast chromosome now mapped 5.8 Million Entire yeast genome 15 Million Smallest human chromosome (Y) 50 Million Largest human chromosome (1) 250 Million Entire human genome 3 Billion
Without looking them up I'll assume you've got your figures right (which is granting you a lot) No one has a problem with the following question, Is 3 billion base pairs enough DNA hold the hereditary information for a human? You're question is Is 750Mb enough to form a human? See how the 2 are different? The 1st question asks in clear and relevant terms to the topic. Again asking if the number of Mb in the human genome is enough to account for everything is like asking if a teaspoon of sugar is enough to account for global warming. The 2 have nothing to do with each other. No one G.A.F. about how you or anyone else decides to digitally represent the genome when answering questions about developmental biology. What they do care about is things like, "Is their a heritable trait that doesn't seem to stem from the individuals genome" and I know I'm going to regret this but the answer is YES. We know of heritable traits that can be caused by the environment during development of an individual and can, even after that environmental factor is gone, effect development of subsequent generations though this trait normally reverts back to the default karyotype. IE the effect can be seen on multiple generations even after the environmental factor has been removed but is not stored within the DNA. The effect does not last forever. This is another example of Epigenetics. All of this is useless to you until you understand the basics of genetics and biological development. Talking about epigenetics to you is like talking about calculus to a kid that can't count yet. I suggest you go to the HHMI web site. They have a great series of lecture called the HHMI Holiday Lectures. They are geared toward a bit more towards intellectual high school students but they convey a good amount of information in a pretty easy format.

Paul Burnett · 1 October 2008

Wayne Francis said: I suggest you ("jobby") go to the HHMI web site. They have a great series of lecture called the HHMI Holiday Lectures. They are geared toward a bit more towards intellectual high school students... (emphasis added)
That'll never work, as it's obviously way over jobby's head.

Stanton · 1 October 2008

Paul Burnett said:
Wayne Francis said: I suggest you ("jobby") go to the HHMI web site. They have a great series of lecture called the HHMI Holiday Lectures. They are geared toward a bit more towards intellectual high school students... (emphasis added)
That'll never work, as it's obviously way over jobby's head.
Then again, Google.com is over jobby/bobby/jacob/balanced/hamstrung/goff's head, too.

Wayne Francis · 1 October 2008

jobby said: dvise me also when you have your estimates of information content of the human body available. We are still waiting patiently ... YOU are making the claim. I am saying it seems unreasonable. Then you say that you feel it IS reasonable. This again is all, all a priori. We can debate about it forever. UNTIL You show me how you can falsify your assertion that the DNA contains enough info to construct a human body. Ptolemy came up with tons of explanations which his geocentrism was true. But an experiment proved him false. Where is your experiment??
Ok Hand Jobby, how can we prove it false, forgetting known and expected epigenetic traits? Find one, just 1 heritable trait that we can not account for from the genome of that species. Just one...that is all that is needed. Like why do you have as many hairs as a chimp but you don't look as hairy? Why person X has blue eyes and person Y has brown? Something like that. Hell go for something like how do bones form? Everything we've seen so far fits the current model. All you have to do is find ONE thing that can't.

Wayne Francis · 1 October 2008

jobby said:
PvM said: The following website at the Max Planck Institute for developmental biology outlines the relevance. The basic model of patterning was predicted before the biochemical details were available and the data ended up largely supporting the original model, however the model itself generates additional requirements and predictions about how polarity is transmitted and more. Actually, somewhat ironically, the patterning of stripes is in this case not a Turing pattern. You remember Turing who pointed out that reaction diffusion models away from equilibrium can form patterns? The wave like patterns were indeed suggestive of such a model, which science found, in this case to be flawed. The site provides links to three pdf papers which outline the basics. Still with us?
Would one megabyte of DNA be enough info to construct the human body???
Once again Blow Jobby a comparison of DNA to a digitally encoding scheme means nothing. I can encode the human genome to 1bit all to many petabytes or more. It doesn't effect what said genome can do.

Paul Burnett · 1 October 2008

Wayne Francis asked jobby: Like why do you have as many hairs as a chimp but you don't look as hairy?
Oh - you've met jobby? Are his knuckles closer to the ground than normal humans?

Stanton · 1 October 2008

Paul Burnett said:
Wayne Francis asked jobby: Like why do you have as many hairs as a chimp but you don't look as hairy?
Oh - you've met jobby? Are his knuckles closer to the ground than normal humans?
What did chimpanzees ever do to you to deserve such a cruel and decidedly malicious comparison?

Wayne Francis · 1 October 2008

jobby said: This is based on both positive evidence from embryology as well as a lack of evidence of 1) insufficiency of DNA information 2) ways DNA information is to be supplemented. ... the amount of data that can be store in the dna is 750 MB and you are saying that is enough. and your reasoning is that there is a lack of evidence that it is not enough. circular logic again ... I can say I can jump 10 feet and you ask me to prove it. And I say that since there is no evidence that I cannot then I must be able to. jeez!!
You are stuck on the problem that if you used DNA as a storage medium for digital data that you could only have 750Mb. So what? We've shown how DNA is a VERY BAD storage mechanism for digital data that relies on the data staying in a given sequence, not tolerant to alterations of any kind. DNA is VERY good for holding the patterns needed to make RNA and ultimately proteins. To your second statement. There is no proof that you have ever been laid before either and you know what none of us care. You can make claims all you want but without proof the claims are meaningless.

Wayne Francis · 1 October 2008

jobby said: How many MB are needed to construct a fingernail? Could it be done in 1 MB??
Once again Blow Jobby the analogy FAILS. You could ask, What genes are used in producing a fingernail but then you would be asking a logical question....which you seem incapable of doing.

Wayne Francis · 1 October 2008

jobby said:
PvM said: Mbytes of what? A better question may be: how many genes are involved in regulating the formation of the finger nail. Do you have any idea? Do you have any idea how you could gather such data? How much information is stored in a fingernail? Show us the necessary data and then argue, until then all you have is a position of ignorance.
jobby said: How many MB are needed to construct a fingernail? Could it be done in 1 MB??
....Show ME the necessary data and then argue, until then all YOU have is a position of ignorance. .. you claim the DNA has enough X to construct a human body and your main proof is that is no evidence is does not. .... well how about the those invisible pink unicorns. show me your data they do not exist.
Ok you've proven you are a troll and we've got to 1,000 posts. Lets end this now.

Paul Burnett · 1 October 2008

Wayne Francis said to jobby: Ok you've proven you are a troll and we've got to 1,000 posts. Lets end this now.
Please.

Wayne Francis · 1 October 2008

jobby said:
fnxtr said:
jobby said: DNA is not an ASCII code. ... dummy: you can have bits and bytes without an ascii code.
Nor is it COBOL, or BASIC, or C++, or machine code. Let's clear this up, Yobbo: What part of the DNA molecule do you think is equivalent to one 8-bit byte? A single base? A base pair? A codon? 8 of any of these? Why? What 'information' do you think this 8-bit byte can store a) in a computer and b) in a genome? How do you convert one to the other? What's the genomic equivalent, for example, of "Clear register A" in Z80 code? What's the computer equivalent of 'create a template for alanine to form on'? You see, Yobbo: it's a garbage argument you are making.
Funded by: National Institutes of Health; Grant Number: AR-39959, NS-32675 Neutrogena Corporation Dermatology Foundation Abstract The basal cell nevus syndrome (Gorlin syndrome) is characterized by multiple basal cell carcinomas and diverse developmental defects. The gene responsible for this syndrome has been mapped previously to a 2 cM interval between D9S196 and D9S180 at 9q22.3, and very recently mutations of a candidate gene in this region - the human homolog of the Drosophila patched gene - have been identified. We report here on physical mapping studies integrating a contig of yeast artificial chromosomes and bacterial artificial chromosomes with a long-range map spanning approximately 5 Mb between the recombination-determined flanking markers. Six genes have been mapped to this interval. Genes Chromosom. Cancer 18:305-309, 1997. © 1997 Wiley-Liss, Inc. Received: 28 June 1996; Accepted: 4 September 1996
Blow Jobby you do realize that the notation of 5Mb means 5Mega base pairs and not 5Mega Bytes right? We all know you don't realize that Blow Jobby so don't bother trying to say otherwise. You have been using Mb to mean Megabyte all along because you keep using the term in the same context as digital data like ascii, computer code, etc. Blow Jobby you are truly an ignorant ass incapable of understanding ANYTHING you read.

Wayne Francis · 1 October 2008

jobby said:
fnxtr said:
jobby said: Can natural selection add information to the genome??
Nope. Mutation and fertilization do that. You really do have a lot of reading to catch up on, don't you, Yobbo. Natural selection just tends to pick the more advantageous mutations, some of which include added information via duplication, etc. Make sense?
NS is not the driving force that adds info?? Mutation and fertilization without NS can add info? BULL! why do you lie like that?
Amazing Blow Jobby you just can't nail it can you. RM (Random mutation) can add information to the genome (but so can't a few other mechanisms). NS (Natural Selection) just explains why these changes in information content can either be lost or fixed within a population. So RM without NS isn't going to do much long term. NS means nothing without some information change. IE without change we would all still be 1 cell life forms.

Wayne Francis · 1 October 2008

jobby said: Megabase is a length. It has nothing to do with storage, beandip. ... dummie. are you saying that 2 Megabases have the same info storage as 1 megabase??
Yup. There are probably stretches of millions of base pairs that have zero information when it comes to the development of a human in the human genome where there are stretches of about one thousand base pairs that is involved with a HUGE amount of development. Which has more "information"? Is the amount of "Information" correlated to the number of base pairs? Think of it this way. You can read an article in Nature and read a similar sized article in the Inquirer. Which one do you think will have more information? What if the article in the Inquirer was 2x as big? Would the information change? I say the information within the Enquirer doesn't change from Zero ever regardless of the size of the article. For that fact 2 equally sized articles in Nature won't have the same amount of "Information" either. You have to define what you mean by "Information" before conclusion can be made. Larger genes != more important genes in Genomes.

David Stanton · 1 October 2008

Wow, 1000 posts. WOW. And not one of them on the topic of the thread. WOW, JUST WOW. Still no sign of any evidence from hand jobby, not even an example of one protein to support it's silly claims.

The answer to it's inane question is yes, 3 billion base pairs is plenty of information to direct the development of a human being, given the proper environment. Too bad it can't just admit this and grow up. I guess it sees little blue demons everywhere and wonders why the rest of us can't see them.

One last question for you hand jobby, are 5,000 genes enough to make a fruit fly? You can use all the bricks in your head to ponder that one. Don't take too many megabites.

Wayne Francis · 1 October 2008

Paul Burnett said:
Wayne Francis asked jobby: Like why do you have as many hairs as a chimp but you don't look as hairy?
Oh - you've met jobby? Are his knuckles closer to the ground than normal humans?
Hey don't insult chimps. There hair is thicker, and well technically their skull is to, but I'd bet on the chimps in learning exercises over Blow Jobby any day.

Wayne Francis · 1 October 2008

Ok I'm now fully caught up from last night.

Do I get a prize for being the 1,000th poster? :P

Definition of insanity : doing the same thing over and over but expecting different results.

I would be insane if I thought I or anyone else could educate him because he does not want to be educated. I post here purely for the lurkers.

I think this whole thread has been on topic. Blow Jobby is totally "immune to evidence".

jobby · 2 October 2008

David Stanton said: Wow, 1000 posts. WOW. And not one of them on the topic of the thread. WOW, JUST WOW. Still no sign of any evidence from hand jobby, not even an example of one protein to support it's silly claims. The answer to it's inane question is yes, 3 billion base pairs is plenty of information to direct the development of a human being, given the proper environment. Too bad it can't just admit this and grow up. I guess it sees little blue demons everywhere and wonders why the rest of us can't see them. One last question for you hand jobby, are 5,000 genes enough to make a fruit fly? You can use all the bricks in your head to ponder that one. Don't take too many megabites.
Is THIS post on topic^^^?

jobby · 2 October 2008

You have to define what you mean by “Information” before conclusion can be made.

.... read up on what 'information' is when used in science.

jobby · 2 October 2008

Blow Jobby is totally “immune to evidence”.

... how mature! A true scientist!

jobby · 2 October 2008

Oh - you’ve met jobby? Are his knuckles closer to the ground than normal humans?

.... shows the maturity level here.^^

jobby · 2 October 2008

You can read an article in Nature and read a similar sized article in the Inquirer. Which one do you think will have more information?

... according to information theory: about the same.

you really do not understand these things do you?

Wayne Francis · 2 October 2008

jobby said: You have to define what you mean by “Information” before conclusion can be made. .... read up on what 'information' is when used in science.
Hi Hand Jobby! You seemed to not answer this question the first time I asked it so I'll ask it agian. What has more "information" 10,000 pennies or a 100 dollar bill? What are you defining as "information" when I ask that question. Normally the person asking the question would define what "information" they are looking for from something but you seem to think their is some universal "information" that every agrees to all the time.

Wayne Francis · 2 October 2008

jobby said: Oh - you’ve met jobby? Are his knuckles closer to the ground than normal humans? I expect this type of responce from you and immature 5 year olds. .... shows the maturity level here.^^
like your you yelling in this post, isn't that right Blow Jobby.
jobby said:
Stanton said:
jobby said:

You were the one who claimed that the information contained within the genome is insufficient, and you have not presented evidence to support this claim, and you have not explained how genomic information is insufficient.

... you have not provided evidence to support YOUR claim either.
Your lying about us not presenting evidence demonstrating that the genome is sufficient for the development of the (human) body does not do anything about the fact that you have not bothered to presented any evidence to suggest that the genome is insufficient. I repeat my question: what evidence do you have to suggest that the genome has insufficient information for the growth and development of the (human) body?
jobby said: when a human sperm unites with a human egg how does that cell know to become a human??

Have you ever tried reading a biology textbook to find out?

dummie: does that mean you do not have and answer??
Did it ever occur to you that I was trying to give you a subtle hint that biologists have already found out how animals develop from gametogenesis to embryogenesis to development and birth decades ago, and have labored hard in order to put this information in almost every biology textbook that has been published in the last 50 years?
YOU ARE A LIAR!

Wayne Francis · 2 October 2008

woops sorry the above should have been
jobby said: You can read an article in Nature and read a similar sized article in the Inquirer. Which one do you think will have more information? ... according to information theory: about the same. you really do not understand these things do you?
like your you yelling in this post, isn’t that right Blow Jobby. I expect this type of responce from you and immature 5 year olds. ... Sorry

Dan · 2 October 2008

Stanton said: I repeat my question: what evidence do you have to suggest that the genome has insufficient information for the growth and development of the (human) body? ... Did it ever occur to you that I was trying to give you a subtle hint that biologists have already found out how animals develop from gametogenesis to embryogenesis to development and birth decades ago, and have labored hard in order to put this information in almost every biology textbook that has been published in the last 50 years?
To which
jobby replied: YOU ARE A LIAR!
This is truly amazing. In jobby's lexicon, a question can be a lie!

Wayne Francis · 2 October 2008

jobby said: You can read an article in Nature and read a similar sized article in the Inquirer. Which one do you think will have more information? ... according to information theory: about the same. you really do not understand these things do you?
Blow Jobby Jobby Jobby!!! For the lurkers goto some place like wikipedia and spend 5 minutes to read an article discribing "information" and "information theory" and decide for your self how much of an ignorant ass Blow Jobby is. An article that doesn't convey anything useful to the sender and reciever does not have as much "information" as one that does even if they have the same number of characters.

eric · 2 October 2008

I find Casey Luskin's argument regarding the origin of the immune system to be unconvincing. N=1. :)
David Stanton said: Wow, 1000 posts. WOW. And not one of them on the topic of the thread. WOW, JUST WOW. Still no sign of any evidence from hand jobby, not even an example of one protein to support it's silly claims. The answer to it's inane question is yes, 3 billion base pairs is plenty of information to direct the development of a human being, given the proper environment. Too bad it can't just admit this and grow up. I guess it sees little blue demons everywhere and wonders why the rest of us can't see them. One last question for you hand jobby, are 5,000 genes enough to make a fruit fly? You can use all the bricks in your head to ponder that one. Don't take too many megabites.

jobby · 2 October 2008

Blow Jobby Jobby Jobby!!!

... how mature!

jobby · 2 October 2008

ike your you yelling in this post, isn’t that right Blow Jobby. I expect this type of responce from you and immature 5 year olds.

... show the maturity level here.

jobby · 2 October 2008

What has more “information” 10,000 pennies or a 100 dollar bill? What are you defining as “information” when I ask that question.

... are these posters retarded?

jobby · 2 October 2008

I feel sorry for serious young students who might to this site expecting adult conversation. And this site is highly rated. I really have not seen such bad behaviour since I taught junior high in the inner city. You should be ashamed of yourselves!

David Stanton · 2 October 2008

I completely agree hand jobby. Your behavior has been almost as bad as your grammar.

Stanton · 2 October 2008

jobby said: ike your you yelling in this post, isn’t that right Blow Jobby. I expect this type of responce from you and immature 5 year olds. ... show the maturity level here.
Then how come you accused PvM of being brainwashed, yet, refuse to present evidence of why you think the genome is informationally insufficient for the growth and development of (the human) body? How do you honestly expect people to shrug off any alleged brainwashing if you don't present evidence contrary to what they have learned? But, since you refuse to provide any evidence of why the genome is informationally insufficient, to the point of making the childish and absurd accusation of me being a liar for asking so, as well as demanding that we provide more evidence for our position so you can ignore it again, leads me to realize that you don't even believe in your own moronic claim.

Wayne Francis · 2 October 2008

jobby said: What has more “information” 10,000 pennies or a 100 dollar bill? What are you defining as “information” when I ask that question. ... are these posters retarded?
Blow Jobby, you didn't answer the question. I'd ask if you are retarded but that is an insult to retarded people.

Stanton · 2 October 2008

jobby said: I feel sorry for serious young students who might to this site expecting adult conversation. And this site is highly rated. I really have not seen such bad behaviour since I taught junior high in the inner city. You should be ashamed of yourselves!
So whenever your students asked you a question during class, did you shout at them, accusing them of being liars, or did you demand that they provide evidence contrary to whatever it was you were claiming, and ignored them when they did?

Wayne Francis · 2 October 2008

jobby said: I feel sorry for serious young students who might to this site expecting adult conversation. And this site is highly rated. I really have not seen such bad behaviour since I taught junior high in the inner city. You should be ashamed of yourselves!
You taught JHS? Holy crap. Your spelling and grammar are like a 3rd grader. What subject(s) did you teach?

Stanton · 2 October 2008

Wayne Francis said:
jobby said: I feel sorry for serious young students who might to this site expecting adult conversation. And this site is highly rated. I really have not seen such bad behaviour since I taught junior high in the inner city. You should be ashamed of yourselves!
You taught JHS? Holy crap. Your spelling and grammar are like a 3rd grader. What subject(s) did you teach?
Basic Stupidity, Malignant Stupidity and General Incompetence

Henry J · 2 October 2008

David Stanton | October 1, 2008 11:30 PM ... One last question for you hand jobby, are 5,000 genes enough to make a fruit fly?

It doesn't take genes to make a fruit fly. Just pick up the piece of fruit and throw it. ;)

Henry J · 2 October 2008

PvM replied to comment from Henry J | October 1, 2008 10:12 PM Would Jobby even understand the difference? Henry J said: A better statement is that reptiles and humans share common ancestor not reptiles became humans. The Tree-of-Life page http://tolweb.org/Amniota refers to the clade containing reptiles and mammals as amniota, and shows reptilia and synapsida (which includes mammals) as separate branches. So not everybody regards early amniotes as already being reptiles, though I suppose it’s likely that some label them as such. Henry

Not that he'd admit. But then I don't expect understanding from somebody who "thinks" the validity of a theory depends on the ability of posters on a blog to convince an amateur who decides to object to that theory, and without 1) studying the subject matter, or 2) listening to what others say about it. Henry

fnxtr · 2 October 2008

Hey, Yobbo,

Did you know you can save hard drive space by converting all your text files to a smaller font? Less information, right?

jobby · 2 October 2008

Wayne Francis said:
jobby said: I feel sorry for serious young students who might to this site expecting adult conversation. And this site is highly rated. I really have not seen such bad behaviour since I taught junior high in the inner city. You should be ashamed of yourselves!
You taught JHS? Holy crap. Your spelling and grammar are like a 3rd grader. What subject(s) did you teach?
.... Really is this all you can do is regurgitate junior high slams??

jobby · 2 October 2008

Henry J said:

PvM replied to comment from Henry J | October 1, 2008 10:12 PM Would Jobby even understand the difference? Henry J said: A better statement is that reptiles and humans share common ancestor not reptiles became humans. The Tree-of-Life page http://tolweb.org/Amniota refers to the clade containing reptiles and mammals as amniota, and shows reptilia and synapsida (which includes mammals) as separate branches. So not everybody regards early amniotes as already being reptiles, though I suppose it’s likely that some label them as such. Henry

Not that he'd admit. But then I don't expect understanding from somebody who "thinks" the validity of a theory depends on the ability of posters on a blog to convince an amateur who decides to object to that theory, and without 1) studying the subject matter, or 2) listening to what others say about it. Henry
Then you are saying Hylonomus was not an ancestor of humans??

jobby · 2 October 2008

One last question for you hand jobby, are 5,000 genes enough to make a fruit fly?

... the point is we cannot answer these questions based on what we 'believe' in. We need experimentation and data studies. Right now we cannot determine the answer to the above question. And to say as you want to to support your FAITH that it is enough it not science.

Henry J · 2 October 2008

I said nothing whatsoever about Hylonomus. A few minutes of googling, though, and it's fairly clear that Hylonomus is within the reptile clade, well after it separated from the line leading to mammals.

Henry

Stanton · 2 October 2008

jobby said:
Wayne Francis said: You taught JHS? Holy crap. Your spelling and grammar are like a 3rd grader. What subject(s) did you teach?
.... Really is this all you can do is regurgitate junior high slams??
Then how come you can not provide evidence to support your claim that the genome is informationally insufficient?

jobby · 2 October 2008

Then how come you can not provide evidence to support your claim that the genome is informationally insufficient?
Stanton said:
jobby said:
Wayne Francis said: You taught JHS? Holy crap. Your spelling and grammar are like a 3rd grader. What subject(s) did you teach?
.... Really is this all you can do is regurgitate junior high slams??
Then how come you can not provide evidence to support your claim that the genome is informationally insufficient?
Then how come you can not provide evidence to support your claim that the genome is informationally sufficient?

PvM · 2 October 2008

Again you are wrong. So far the work done indeed indicates that the information is sufficient. But it does require you to actually look at the data which you refuse to do by faith
jobby said: One last question for you hand jobby, are 5,000 genes enough to make a fruit fly? ... the point is we cannot answer these questions based on what we 'believe' in. We need experimentation and data studies. Right now we cannot determine the answer to the above question. And to say as you want to to support your FAITH that it is enough it not science.

Stanton · 2 October 2008

The fact that you have ignored all of the evidence we have presented to you does not make them go away, nor can it make up for the fact that you have not bothered presenting any form of support for your claims, nor can it somehow magically shift the burden of proof onto us.

So, then, why can't you present any evidence to support your claim that the genome is informationally insufficient?

PvM · 2 October 2008

I note that Bobby once again has given up supporting his claims and has resorted to spamming

He served his purpose well my friend.

Thanks Bobby.

PvM · 2 October 2008

Because his position is one of scientific vacuity.
Stanton said: The fact that you have ignored all of the evidence we have presented to you does not make them go away, nor can it make up for the fact that you have not bothered presenting any form of support for your claims, nor can it somehow magically shift the burden of proof onto us. So, then, why can't you present any evidence to support your claim that the genome is informationally insufficient?

PvM · 2 October 2008

Shows us the information content of the human body. Of course, for Bobby to refer others to science is somewhat ironic given his propensity to refuse to do the necessary work to support his position or study data which contradict them.
jobby said: You have to define what you mean by “Information” before conclusion can be made. .... read up on what 'information' is when used in science.

Henry J · 2 October 2008

information content of the human body

I thought the issue was the amount of "information" transferred from the parents to the offspring, rather than the "information" present in the offspring after he/she has grown up? Henry

Henry J · 2 October 2008

Apparently Bobby and bobby are two entirely different people.

phantomreader42 · 2 October 2008

Henry J said: Apparently Bobby and bobby are two entirely different people.
And that doesn't even count the voices in the troll's head.

Henry J · 2 October 2008

I meant there's another poster who goes by "Bobby", so capitalizing "bobby" might cause others to not know which one you're talking about.

phantomreader42 · 2 October 2008

Henry J said: I meant there's another poster who goes by "Bobby", so capitalizing "bobby" might cause others to not know which one you're talking about.
I knew what you meant, I recall another Bobby commenting on another troll-infested thread that this one was disgracing his name.

David Stanton · 2 October 2008

Got you hand jobby. We have sequenced the entire fruit fly genome and it is one of the most intensely studied developmental systems ever. We know in great and excrutiating detail exactly what proteins are coded, when and where the genes are expressed, what mechanisms control their expression, how they generate morphological features and how changes in the genes change the morphology. In two hundred years of intensive study that has been accomplished not one single example of any protein that is needed for fruit fly develoment has ever been found that is not coded in the fly genome. You have a lot of reading to do to catch up on all of this research.

There is plenty of evidence that about 5,000 genes are completely sufficient to make a fruit fly. There is absolutely no evidence whatsoever that any other information is required. If you believe that more information is needed than your belief is based solely on FAITH.

Bye bye troll.

jobby · 2 October 2008

how they generate morphological features

... they do not know how it generates the shape of the wing

jobby · 2 October 2008

The fact that you have ignored all of the evidence we have presented to you does not make them go away, nor can it make up for the fact that you have not bothered presenting any form of support for your claims, nor can it somehow magically shift the burden of proof onto us.

So, then, why can’t you present any evidence to support your claim that the genome is informationally insufficient?

.... why do you think you have no burden to prove your claims? do you feel your FAITH is enough?

PvM · 2 October 2008

You shamelessly ignore what he said 'The fact that you have ignored all of the evidence we have presented to you " why is that bobby?
jobby said: The fact that you have ignored all of the evidence we have presented to you does not make them go away, nor can it make up for the fact that you have not bothered presenting any form of support for your claims, nor can it somehow magically shift the burden of proof onto us. So, then, why can’t you present any evidence to support your claim that the genome is informationally insufficient? .... why do you think you have no burden to prove your claims? do you feel your FAITH is enough?

Dale Husband · 2 October 2008

Perhaps bobby could explain to us why he thinks our support for evolution is based on faith. That seems like an odd assertion to me. Then again, almost everything he says is odd assertions. He lives in his own little world where science is religion, religion is science, and Big Brother rules all ("War is peace; Freedom is slavery; Ignorance is strength.")

David Stanton · 2 October 2008

Perhaps you can explain it to us.

jobby · 2 October 2008

Dale Husband said: Perhaps bobby could explain to us why he thinks our support for evolution is based on faith. That seems like an odd assertion to me. Then again, almost everything he says is odd assertions. He lives in his own little world where science is religion, religion is science, and Big Brother rules all ("War is peace; Freedom is slavery; Ignorance is strength.")
... I said religion is science? are you hallucinating. religion and science should be seperate. ...based on FAITH: because you do not need proof for your beliefs. you said you do not have the burden of proof. to believe something is true without the burden of proof = FAITH. nothing wrong with that but it is not science it is religion.

David Stanton · 2 October 2008

For anyone who is really interested in drosophila wing development, a quick google search turns up 187,000 references. The very first hit contains the following references:

Aegerter-Wilmsen, T., Aegerter, C. M., Hafen, E. and Basler, K. (2007). Model for the regulation of size in the wing imaginal disc of Drosophila. Mech. Dev. 124(4): 318-26. PubMed citation: 17293093

Butler, M. J., et al. (2003). Discovery of genes with highly restricted expression patterns in the Drosophila wing disc using DNA oligonucleotide microarrays. Development 130: 659-670. 12505997

Campbell, G., Weaver, T. and Tomlinson, A. (1993). Axis specification in the developing Drosophila appendage: The role of wingless, decapentaplegtic and the homeobox gene aristaless. Cell 74: 1113-1123. 8104704

Cohen, B., Simcox, A.A. and Cohen, S.M. (1993). Allocation of the thoracic imaginal primordia in the Drosophila embryo. Development 117: 597-608. 8330530

Fuse, N., Hirose, S. and Hayashi, S. (1996). Determination of wing cell fate by the escargot and snail genes in Drosophila. Development 122: 1059-67

Kiger, J. A. Jr., Natzle, J. E., Kimbrell, D. A., Paddy, M. R., Kleinhesselink, K. and Green. M. M. (2007). Tissue remodeling during maturation of the Drosophila wing. Dev. Biol. 301(1): 178-91. Medline abstract: 16962574

Ren, N., Zhu, C., Lee, H. and Adler, P. N. (2005). Gene expression during Drosophila wing morphogenesis and differentiation. Genetics [Epub ahead of print]. 15998724

Sturtevant, M. A. and Bier, E. (1995). Analysis of the genetic hierarchy guiding wing vein development in Drosophila. Development 121: 785-801. 7720583

I know that hand jobby will be fascinated by these studies. I have FAITH that he will read all of these papers.

jobby · 2 October 2008

Stanton said:
Wayne Francis said:
jobby said: I feel sorry for serious young students who might to this site expecting adult conversation. And this site is highly rated. I really have not seen such bad behaviour since I taught junior high in the inner city. You should be ashamed of yourselves!
You taught JHS? Holy crap. Your spelling and grammar are like a 3rd grader. What subject(s) did you teach?
Basic Stupidity, Malignant Stupidity and General Incompetence
... I also taught college. Has anyone here gone to college or intend to when they gradutate ( if they graduate ) ??

jobby · 2 October 2008

For anyone who is really interested in drosophila wing development, a quick google search turns up 187,000 references. The very first hit contains the following references:

... yes of course a lot is know but they do not know how the shape is formed.

PvM · 2 October 2008

jobby said: For anyone who is really interested in drosophila wing development, a quick google search turns up 187,000 references. The very first hit contains the following references: ... yes of course a lot is know but they do not know how the shape is formed.
That of course shows how little Jobby knows. And worse, he refuses to look shudder, the devastating costs of an Intelligent Design position ...

Stanton · 2 October 2008

jobby said: ... I also taught college. Has anyone here gone to college or intend to when they gradutate ( if they graduate ) ??
You're now claiming to have taught college, even though you can not be bothered to provide evidence for your other claim of how the genome is informationally insufficient? You're an idiot if you think anyone here is stupid enough to believe you, of all trolls, could teach at a college level.

David Stanton · 2 October 2008

Hand Jobby wrote:

"… yes of course a lot is know but they do not know how the shape is formed."

Come now hand jobby, if you haven't read all of these papers, how could you possibly have any idea what is known and what is not known? More importantly, if you are completely ignorant of all of this research, why on earth should anyone care about your opinion?

Exactly how much evidence would be good enough to convince you? Remind me again, how much evidence do you have for your "hypothesis"?

Still gramatically challenged I see and still immune to evidence as well.

Henry J · 2 October 2008

Then again, almost everything he says is odd assertions.

Like that question about Hylonomus - where the heck did that question come from? Afaik, there was no previous mention of that critter in this thread, and also afaik, nobody has ever proposed it as a candidate for ancestry of any mammals. Henry

tresmal · 2 October 2008

... I also taught college. Has anyone here gone to college or intend to when they gradutate ( if they graduate ) ??
Um... Standing in the quad dressed in tinfoil ranting about alien "information" in our DNA does not count as "teaching" in college.

PvM · 2 October 2008

I am merely asking you if you are sure about your statement about reptiles and mammals. Why is it so hard for you to make and support any statement of science or fact? Puzzling
jobby said: Then you are saying Hylonomus was not an ancestor of humans??

Dan · 2 October 2008

Some time ago in this thread, jobby said:
I am not a supporter ID nor Creationism nor Darwinism. I am a supporter of the scientific method
The scientific method as usually understood (http://en.wikipedia.org/wiki/Scientific_method) is
  • Observe
  • Form a hypothesis
  • Make predictions
  • Test those predictions
Careful observers of jobby's writing will note that, despite his avowed support of the scientific method, jobby has yet to do any of these things. At his most coherent, he has said that natural selection can be responsible for the observed facts of biology, but that there might be other, unknown and unnamed, phenomena that might also be responsible. This is trivially true. For example, Zeus could have created all living things, but Zeus created the things in such a way that they appear to have evolved. More frequently, however, he has used his own "method":
  • Ask a question
  • Skim the answer
  • Insult the answerer
  • Belittle the answerer
  • Insult Panda's Thumb
  • Denigrate Panda's Thumb
  • Claim that he's being minimized by Panda's Thumb
  • Reask the same question

PvM · 2 October 2008

Touche...
Dan said: Some time ago in this thread, jobby said:
I am not a supporter ID nor Creationism nor Darwinism. I am a supporter of the scientific method
The scientific method as usually understood (http://en.wikipedia.org/wiki/Scientific_method) is
  • Observe
  • Form a hypothesis
  • Make predictions
  • Test those predictions
Careful observers of jobby's writing will note that, despite his avowed support of the scientific method, jobby has yet to do any of these things. At his most coherent, he has said that natural selection can be responsible for the observed facts of biology, but that there might be other, unknown and unnamed, phenomena that might also be responsible. This is trivially true. For example, Zeus could have created all living things, but Zeus created the things in such a way that they appear to have evolved. More frequently, however, he has used his own "method":
  • Ask a question
  • Skim the answer
  • Insult the answerer
  • Belittle the answerer
  • Insult Panda's Thumb
  • Denigrate Panda's Thumb
  • Claim that he's being minimized by Panda's Thumb
  • Reask the same question

David Stanton · 2 October 2008

The scientific method according to hand jobby:

Ask a question

Ignore all evidence

Insult the person who answered (using bad grammar)

Claim that the evidence was not sufficient (even though it did not look at it)

Ask the question again

Ignore all evidence again

Argue against it's original position

Claim that others don't understand when they point out the hypocricy

Quote mine responses

Accuse others of quote mining

Ask the same question again

Ignore all requests for evidence and ignore all evidence presented

Ask the same question again

Repeat for 1000 posts

Now you know why this turd has been banned on every other thread.

Dale Husband · 3 October 2008

OK, I'm more confused than ever. Is this guy on crack? He cannot give a straight answer to an obvious question!
jobby said:
Dale Husband said: Perhaps bobby could explain to us why he thinks our support for evolution is based on faith. That seems like an odd assertion to me. Then again, almost everything he says is odd assertions. He lives in his own little world where science is religion, religion is science, and Big Brother rules all ("War is peace; Freedom is slavery; Ignorance is strength.")
... I said religion is science? are you hallucinating. religion and science should be seperate. ...based on FAITH: because you do not need proof for your beliefs. you said you do not have the burden of proof. to believe something is true without the burden of proof = FAITH. nothing wrong with that but it is not science it is religion.

DaveH · 3 October 2008

jobby said: ... they do not know how it generates the shape of the wing
I think I get it now. PvM (I think, I'm not trawling back through all these posts!) hit the nail on the head. jobbie simply does not get emergence. At all. It seems to scare him, and he thinks only magic can explain it. Hence the above quote and "how does a zygote know to become a human". Also the fear of accepting computer simulations from a couple of threads back. "Simulating bird-flocking behaviour from a couple of simple rules? NOOOO! I refuse to grasp it! My special, secret invisible hand of information moves each bird to its individual place in the flock!" Try this jobbie: http://en.wikipedia.org/wiki/Emergence
The concept has been in use since at least the time of Aristotle.[1] John Stuart Mill[2] and Julian Huxley[3] are just some of the historic luminaries who have written on the concept.
Not scary, or freaky, honestly. DaveH

jobby · 3 October 2008

Perhaps bobby could explain to us why he thinks our support for evolution is based on faith.

... because you accept things as fact without proof.

jobby · 3 October 2008

emergence.

... explains many things but not complex inter-working parts as in the human body.

jobby · 3 October 2008

David Stanton said: The scientific method according to hand jobby: Ask a question Ignore all evidence Insult the person who answered (using bad grammar) Claim that the evidence was not sufficient (even though it did not look at it) Ask the question again Ignore all evidence again Argue against it's original position Claim that others don't understand when they point out the hypocricy Quote mine responses Accuse others of quote mining Ask the same question again Ignore all requests for evidence and ignore all evidence presented Ask the same question again Repeat for 1000 posts Now you know why this turd has been banned on every other thread.
no: scientific method means that hypotheses must be verified by experimentation.

jobby · 3 October 2008

The scientific method as usually understood (http://en.wikipedia.org/wiki/Scientific_method) is

* Observe
* Form a hypothesis
* Make predictions
* Test those predictions

.... yes exactly. now show what predictions the following make and how they are tested:

1.the DNA has sufficient info to construct a human body

2. NS can change a simple body plan to a complex one.

Go for it!

jobby · 3 October 2008

Also the fear of accepting computer simulation

... well I would not call it fear but not science. computer simulations are not proof. read the literature. they are good to form hypotheses but testing has to be done in real life.

jobby · 3 October 2008

… they do not know how it generates the shape of the wing

I think I get it now. PvM (I think, I’m not trawling back through all these posts!) hit the nail on the head. jobbie simply does not get emergence.

.... you think the shape of a wing comes from 'emergence'??

better read that wiki article again!

jobby · 3 October 2008

tresmal said:
... I also taught college. Has anyone here gone to college or intend to when they gradutate ( if they graduate ) ??
Um... Standing in the quad dressed in tinfoil ranting about alien "information" in our DNA does not count as "teaching" in college.
... well I would never do that since in would not be in the syllabus. I did encourage students to learn by 'discovery' rather than by memorization as it seems had happened to many of the posters here. Not able to think for themselves.

Dan · 3 October 2008

jobby said: scientific method means that hypotheses must be verified by experimentation.
This is a common misconception. The oldest and most precise science of all, astronomy, never performs an experiment, but only makes observations.

jobby · 3 October 2008

This is a common misconception. The oldest and most precise science of all, astronomy, never performs an experiment, but only makes observations.

... no they do experiments. you have a misconception about what an experiment is.

wiki
The essence of an experiment is to introduce a change in a system (the independent variable) and to study the effect of this change (the dependent variable). Two fundamental considerations of experimental design are:

* That the independent variable is the only factor that varies systematically in the experiment; in other words, that the experiment is appropriately controlled - that confounding variables are eliminated; and
* That the dependent variable truly reflects the phenomenon under study (a question of validity) and that the variable can be measured accurately (i.e., that various types of experimental error, such as measurement error can be eliminated).

David Stanton · 3 October 2008

Hand jobby the worthless troll of many names wrote:

"no: scientific method means that hypotheses must be verified by experimentation."

So why won't you read any of the papers about those experiments? Why won't you admit that experiments have actaually been done by real scientists? Why won't you admit that we actually understand some things? Why won't you do any experiments to suppoert your "hypothesis"? Why do you use the methods I described if you know that that is not the way to understand anything? If you have so got a brain then why don't you use it?

Did you teach your students to do experiments? Did you teach your students to read the scientific literature? Since you have demoinstrated that you are incapable of doing so, the evidence makes it clear that you did not. More is the pity.

Still grammatically challenged I see and still immune to evidence . Man I hope it never taught english. That just ain't right.

fnxtr · 3 October 2008

jobby said: Also the fear of accepting computer simulation ... well I would not call it fear but not science. computer simulations are not proof. read the literature. they are good to form hypotheses but testing has to be done in real life.
If you have no faith in computer simulations then why oh why were you so infatuated with the idea that genomic information can be converted to megabytes? Or have you forgotten that argument, and will you now deny it ever existed?

fnxtr · 3 October 2008

... and still, after all this time, not once has Yobbo ever clearly stated "I think this happened, at this time, through this mechanism, and here's my evidence". Like a typical ID nutjob, he just dances around with bullshit like "I don't think evolution can do X".

Loser.

Stanton · 3 October 2008

jobbyHypocritical Troll said: Perhaps bobbyHypocritical Troll could explain to us why he thinks our support for evolution is based on faith. ... because you accept things as fact without proof.
Then why do you refuse to provide evidence for your own claim of the genome being genetically insufficient? Do you honestly expect us to take your word on faith?

jobby · 3 October 2008

… and still, after all this time, not once has fnxtr ever clearly stated “I think this happened, at this time, through this mechanism, and here’s my evidence”. Like a typical Darwinist nutjob, he just dances around with bullshit like “I think evolution can do X”.

Loser.

jobby · 3 October 2008

Then why do you refuse to provide evidence for your own claim of the genome being genetically insufficient? Do you honestly expect us to take your word on faith?

... I said the data is inconclusive on this point. Do you think the data is conclusive in supporting that the genome is sufficient? Can you show me that data??

jobby · 3 October 2008

So why won’t you read any of the papers about those experiments?

... show me just ONE!

jobby · 3 October 2008

Did you teach your students to read the scientific literature? Since you have demoinstrated that you are incapable of doing so

.. I have read much of the literature, have YOU?

... show me a good study that supports the positions I have asked about!

jobby · 3 October 2008

PvM said:
jobby said: For anyone who is really interested in drosophila wing development, a quick google search turns up 187,000 references. The very first hit contains the following references: ... yes of course a lot is know but they do not know how the shape is formed.
That of course shows how little Jobby knows. And worse, he refuses to look shudder, the devastating costs of an Intelligent Design position ...
... show me the study! I keep asking and you never can produce one.

eric · 3 October 2008

jobby said: ... show me a good study that supports the positions I have asked about!
What exactly are you demanding? An article that explains the genetic origin of every single structure in the human body? How about studies showing that DNA codes for thousands of proteins used to build bodies? Will that do?

Science Avenger · 3 October 2008

I can't believe you are all still at this. You might as well argue with a Furbie.

Ban this fucking idiot. It's not complicated. If you can't block his IP address, then just keep deleting his posts until he gets tired of intellectually masterbating. If you think that makes PT like UD, well sorry, you're an idiot too.

Henry J · 3 October 2008

I can’t believe you are all still at this.

Isn't that an argument from incredulity? ;)

Henry J · 3 October 2008

1089 replies and counting...

How long does it take to point out

1) the validity of a conclusion does not depend on being able to convince an amateur who decides to declare himself as judge of it.

2) a scientific principle isn't proven by an individual experiment, but is supported by determining where contradictory evidence should be (or have been) found if the principle is wrong, followed by failure to find that contradictory evidence.

Henry

Vaughn · 3 October 2008

jobby said: ... I said the data is inconclusive on this point. Do you think the data is conclusive in supporting that the genome is sufficient? Can you show me that data??
A pet peeve of mine: "data" is plural, but yes, the data ARE conclusive going all the way back to Avery, MacLeod, and McCarty's demonstration that DNA is the molecule that carries hereditary information (1944, J. Exp. Med. 98:451-460) up to any of the last decade's experiments using nuclear transfer to clone mammals. You should be able to easily find any of those references, given your claim of having "read much of the literature". I'm curious - what subject have you taught in college? Vaughn

tresmal · 3 October 2008

OK jobby: Consider a 300 base segment of non-coding, non-regulatory "junk" DNA, and a 300 base segment that codes for a 100 amino acid protein. Both require the same amount of disk space to be stored. Does that mean they have the same amount of "information"?

Science Avenger · 3 October 2008

Henry J said:

I can’t believe you are all still at this.

Isn't that an argument from incredulity? ;)
Hey, when in Rome...

David Stanton · 3 October 2008

Hand jobby wrote:

"… show me just ONE!"

I showed you six, each with a medline link. Did you read them? If you didn't, how do you know that they are not sufficient to answer your question? Do you subscribe to the Behe method? You said you understood the scientific method. If you don't read the papers then you are proven to be wrong again.

I certainly have no further reason to respond to any nonsense you care to write until you prove that you have read the papers I presented. Of course, you never have in the past, so I don't really expect you to now either. Then again, I don't really care what you do. I'm just happy that you are being kept off of other threads.

jobby · 3 October 2008

David Stanton said: Hand jobby wrote: "… show me just ONE!" I showed you six, each with a medline link. Did you read them? If you didn't, how do you know that they are not sufficient to answer your question? Do you subscribe to the Behe method? You said you understood the scientific method. If you don't read the papers then you are proven to be wrong again. I certainly have no further reason to respond to any nonsense you care to write until you prove that you have read the papers I presented. Of course, you never have in the past, so I don't really expect you to now either. Then again, I don't really care what you do. I'm just happy that you are being kept off of other threads.
... did you READ any of the six??

jobby · 3 October 2008

Vaughn said:
jobby said: ... I said the data is inconclusive on this point. Do you think the data is conclusive in supporting that the genome is sufficient? Can you show me that data??
A pet peeve of mine: "data" is plural, but yes, the data ARE conclusive going all the way back to Avery, MacLeod, and McCarty's demonstration that DNA is the molecule that carries hereditary information (1944, J. Exp. Med. 98:451-460) up to any of the last decade's experiments using nuclear transfer to clone mammals. You should be able to easily find any of those references, given your claim of having "read much of the literature". I'm curious - what subject have you taught in college? Vaughn
... You should be able to easily find any of those references. Now you want me to find references to support YOUR point? ... pick one and lets talk about it here. What the morons are doing now simple googling for a study that has a key word in the question I ask and saying there is your proof without reading the study. You can tell by the titles that the studies are not appropriate. Guess thats why they call them trolls.

jobby · 3 October 2008

tresmal said: OK jobby: Consider a 300 base segment of non-coding, non-regulatory "junk" DNA, and a 300 base segment that codes for a 100 amino acid protein. Both require the same amount of disk space to be stored. Does that mean they have the same amount of "information"?
... of course not! why would you think it does? why dont you read up on all of this?

David Stanton · 3 October 2008

Hand jobby.

"… did you READ any of the six??"

jobby · 3 October 2008

jobby said:
Vaughn said:
jobby said: ... I said the data is inconclusive on this point. Do you think the data is conclusive in supporting that the genome is sufficient? Can you show me that data??
A pet peeve of mine: "data" is plural, but yes, the data ARE conclusive going all the way back to Avery, MacLeod, and McCarty's demonstration that DNA is the molecule that carries hereditary information (1944, J. Exp. Med. 98:451-460) up to any of the last decade's experiments using nuclear transfer to clone mammals. You should be able to easily find any of those references, given your claim of having "read much of the literature". I'm curious - what subject have you taught in college? Vaughn
... You should be able to easily find any of those references. Now you want me to find references to support YOUR point? ... pick one and lets talk about it here. What the morons are doing now simple googling for a study that has a key word in the question I ask and saying there is your proof without reading the study. You can tell by the titles that the studies are not appropriate. Guess thats why they call them trolls.
'data' is singular or plural. languages evolve.

jobby · 3 October 2008

David Stanton said: Hand jobby. "… did you READ any of the six??"
did YOU read any of the six? pick one and let discuss it?

jobby · 3 October 2008

...oberservers: note how the posters make fun other other peoples handles like addressing me as 'handy jobby' and 'blow jobby' I think this makes them look like awkward junior high boys. I have never seen true academics, scholars or scientists use this kind of language esp in a website trying to promote 'science' not 'beavis and butthead' I just picture B & B everytime they say 'hand jobby' etc.

they are very immature

tresmal · 3 October 2008

jobby said:
tresmal said: OK jobby: Consider a 300 base segment of non-coding, non-regulatory "junk" DNA, and a 300 base segment that codes for a 100 amino acid protein. Both require the same amount of disk space to be stored. Does that mean they have the same amount of "information"?
... of course not! why would you think it does? why dont you read up on all of this?
Jobby: First of all I don't think that it does, that's my point. Your assertion requires that they have the same amount of "information".
1) You derailed this thread with the claim that the human genome was 750 MB, and that this wasn't "enough information to construct a human". That 750 MB figure comes from the amount of disk space required to store the genome as an ASCII file. One major unspoken premise in your argument is that file size is somehow equivalent to "quantity of information".

2) If the coding DNA segment contains more information than the non-coding segment of the same size, then the 750 MB genome can contain more than 750 MB of "information", a lot more. Enough,in fact,to do all the things that you are incredulous about it doing.

jobby · 3 October 2008

That 750 MB figure comes from the amount of disk space required to store the genome as an ASCII file.

... wrong? where did you get that idea. do you even know what ascii is?

David Stanton · 3 October 2008

Sorry hand jobby. I didn't mean to offend you. It's just that, if you use made up names and different made up names, then everyone is going to make fun of them. If you were not such a coward and used your real name, or if you at least chose to obey the rules and used just one name, then maybe people wouldn't make fun of you. Otherwise you are being disrespectful in your dealings with people here so you can't really expect them to treat you with respect now can you?

As for your request, I recommend that you start with the Ren et. al. paper:

Genetics (2005) 171(2):625-38

However, this is just one of over a million papers on this topic, If you expect to find all of the answers in just one paper then you are just fooling yourself. That is why you must become an expert in a field and become familiar with the literature before anyone is going to take any of your unsubstantiated claims seriously.

Here, I'll help to get you started. From the abstract of the paper:

The simple cellular composition and array of distally pointing hairs has made the Drosophila wing a favored system for studying planar polarity and the coordination of cellular and tissue level morphogenesis. We carried out a gene expression screen to identify candidate genes that functioned in wing and wing hair morphogenesis. Pupal wing RNA was isolated from tissue prior to, during, and after hair growth and used to probe Affymetrix Drosophila gene chips. We identified 435 genes whose expression changed at least fivefold during this period and 1335 whose expression changed at least twofold. As a functional validation we chose 10 genes where genetic reagents existed but where there was little or no evidence for a wing phenotype. New phenotypes were found for 9 of these genes, providing functional validation for the collection of identified genes. Among the phenotypes seen were a delay in hair initiation, defects in hair maturation, defects in cuticle formation and pigmentation, and abnormal wing hair polarity. The collection of identified genes should be a valuable data set for future studies on hair and bristle morphogenesis, cuticle synthesis, and planar polarity.

tresmal · 3 October 2008

I said:"That 750 MB figure comes from the amount of disk space required to store the genome as an ASCII file."
Jobby said:"… wrong? where did you get that idea?"

Here:
jobby said: The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

Science Avenger · 3 October 2008

BAN IT!

Science Avenger · 3 October 2008

I actually make it a personal policy to not alter people's names, even the obnoxious ones. I don't use IDiot, GOoPers, or call him Dumbski. It is juvenile on some levels, not on others.

I call this idiot handjobby because his entire approach is one giant case of mental masterbation. He's not having dialogue. You could swap his reponses around and not even notice, there is so little content, so little evidence that he even read what he responds to. Dialogue requires substantive responses, and consistent application of rhetorical rules, in response to what the other person is saying. The only rule he follows is "never accept the burdon of proof".

That's not dialogue, that's mental masterbation, and that's why he'll always be handjobby to me, regardless of what he goes by next week.

Stanton · 3 October 2008

Yet, you fail to also mention that you've been trolling in this blog for the past 5 to 8 months under a dozen different names, making inane statements that scream of your profound ignorance and belligerent stupidity, as well as ignoring all evidence we provide for your inane demands, while insulting us simply because we do not appreciate your abominably poor social skills and moronically false statements. Of course, then there's the fact that you've demonstrated that you can not be bothered to provide even the most piddling piece of evidence to support any of your abominably stupid claims, whether it's "Darwinism hasn't been proven," "The genome isn't enough to build a human being" or even that you are allegedly a teacher, while you hypocritically accuse us of having blind faith simply because we accept what has been experimentally verified by other scientists and scholars for the past century and a half.
jobby saidLying Troll lied: ...oberservers: note how the posters make fun other other peoples handles like addressing me as 'handy jobby' and 'blow jobby' I think this makes them look like awkward junior high boys. I have never seen true academics, scholars or scientists use this kind of language esp in a website trying to promote 'science' not 'beavis and butthead' I just picture B & B everytime they say 'hand jobby' etc. they are very immature

tresmal · 3 October 2008

Science Avenger said: BAN IT!
I say let him comment on this one thread to his heart's content. I say that after conceding every point made in favor of banning him. I have a few reasons for doing so:
1) He is apparently posting from a library somewhere which presents difficulties to a site that wishes to ban him.

2) While he has turned this into the "jobby thread", he has left other threads on this site pretty much unmolested by his unthought.

3) People who argue with him with some idea of persuading him or just getting him to understand other viewpoints are going to be frustrated, because that is, of course, impossible. On the other hand, if you see him as an automated unthinking sparring partner your experience will be different. I don't argue with him to get through to him, I do it to sharpen and improve my own thinking and skills.

4) Some people like beating their heads against a wall. :)

5) This is obviously very important to him. As an act of simple human kindness, let him have this one thread.

btw: I agree with you on the fun with names business.

David Stanton · 3 October 2008

Here is an oldy but a goody:

Williams, Bell and Carroll (1991) Control of Drosophila wing and haltere development by the nuclear vestigial gene product. Genes and Development 5:2481-2495.

After you are done reading the first eight papers I recommended you can move on to this one. I'm sure you will find a paper that convinces you that someone understands fruti fly development eventually.

By the way, I warned you guys that this troll would argue both sides of an argument. Apparently it doesn't think that anyone will notice when it conradicts itself.

Alan Kellogg · 3 October 2008

Lying Troll,

DNA does not encode the whole thing, DNA encodes the instructions for building the structure, and the instructions for when the construction instructions will be carried out. Much like the plans for a building, which allow the erection of a structure much larger than one would think possible. The recipe for kiln fired bricks is a simple one, but with it you can make tons of kiln fired bricks.

Stanton · 3 October 2008

Alan Kellogg said: Lying Troll, DNA does not encode the whole thing, DNA encodes the instructions for building the structure, and the instructions for when the construction instructions will be carried out. Much like the plans for a building, which allow the erection of a structure much larger than one would think possible. The recipe for kiln fired bricks is a simple one, but with it you can make tons of kiln fired bricks.
Of course, then there is the little matter of the introns encoded within the genes, and how the gene can produce different gene products depending on which introns are spliced out or left in, and how much of the introns are spliced out or left in. (i.e., glazed kiln bricks versus unglazed kiln bricks versus adobe bricks)

Wayne Francis · 3 October 2008

jobby said: That 750 MB figure comes from the amount of disk space required to store the genome as an ASCII file. ... wrong? where did you get that idea. do you even know what ascii is?
Hand Jobby is right for once but then a broken clock is right twice a day. Jobby please, in your own words describe the encoding mechanism used to store the human genome in about 750Megabytes on a digitial medium. Until you actually show that you actually understand what is being said, in this case that "the human genome can be stored in about 750Megabyts" I'll have to assume that your are just barking back and you still don't know what you are talking about. It should only take a few lines to explain. I'll give you a hint. I've already explained this somewhere in the last 37 pages of posts

Wayne Francis · 3 October 2008

Actually...My above post is technically wrong. The human genome can be represented in 750Mb of ASCII so Jobby is wrong. It jus isn't represented as a string of "A" "C" "G" "T" but it still can be represented as ASCII

Stanton · 3 October 2008

Wayne Francis said: I've already explained this somewhere in the last 37 pages of posts
Asking jobby/bobby/jacob/balanced/hamstrung/goffTroll to look back at a previous post is tantamount to asking him to lay a golden egg that will hatch out into Diana Ross II. In fact, it would be far easier to ask jobby/bobby/jacob/balanced/hamstrung/goffTroll to lay a golden egg that will hatch out into Diana Ross II than to have him look at a previous post.

DaveH · 4 October 2008

It was simply beyond irony that I turned from reading jobbie's demands for a single paper showing that the last 60 years of research into genetics wasn't based on a false premise, to this obituary yesterday.

http://www.guardian.co.uk/science/2008/oct/03/genetics.universityofsheffield

The troll honestly believes that it is more insightful and has greater knowledge than John Thoday.

dobby · 4 October 2008

DaveH said: It was simply beyond irony that I turned from reading jobbie's demands for a single paper showing that the last 60 years of research into genetics wasn't based on a false premise, to this obituary yesterday. http://www.guardian.co.uk/science/2008/oct/03/genetics.universityofsheffield The troll honestly believes that it is more insightful and has greater knowledge than John Thoday.
DUH!!! of course genetics works and is a well researched science. Its Darwinism that has little basis.

jobby · 4 October 2008

'That 750 MB figure comes from the amount of disk space required to store the genome as an ASCII file'

... this is the statement I say was incorrect. Any neutral observer can see how the opposition here squirms to backtrack their ignorances.

jobby · 4 October 2008

What keeps happening here over and over is ask for studies backing up their claims. The 2 now is the 750 MB one and the NS one. Then they google for studies using key words and those areas and the presenting me with a list of studies that have the key words and then saying: here is your proof.

The problem is that those studies although in the right general direction really do not answer the question I asked.

The opposition needs to state in their own words how those studies back up their positions.

I have never seen them do that.

DaveH · 4 October 2008

dobby said: DUH!!! of course genetics works and is a well researched science. Its Darwinism that has little basis.
Darwinism?! the jobbie question for the last zillion posts has been about whether genetics works and is a well researched science. Thanks for finally admitting it.
The opposition needs to state in their own words how those studies back up their positions. I have never seen them do that.
It's called a textbook. Read, comprehend and inwardly digest. Then you will have the understanding of the current theory of developmental biology (whether you disagree with it or not) and will be able to see how the hundreds of experiments in the hundreds of papers to which you have been referred (but have never read) all tend to support the hypothesis that the genes in a fertilised egg have enough information to produce a human. As you said: "genetics works and is a well researched science."

David Stanton · 4 October 2008

Hand jobby wrote:

"The problem is that those studies although in the right general direction really do not answer the question I asked. The opposition needs to state in their own words how those studies back up their positions. I have never seen them do that."

Once again hand jobby, you have shown no evidence whatsoever that you have even attempted to actually read the paper, even though I supplied you with the entire abstract. You said you would read it. You said you wanted to discuss it. Well...? I told you that the answer would not be contained completely in one paper. But, if you won't read even one paper then how will you ever know if the answer is there or not?

OK, in my own words. The papers show that cascades of gene expression are sufficient to produce the wing of a fruit fly. The references I cited come from a web site that describes most of the important proceeees involved:

http://www.sdbonline.org/fly/aimorph/wing.htm

The site lists over 200 proteins that are involved in wing morphogenesis and describes in detail how their expression is regulated. The point is that every one of the proteins is coded for in the fly genome and is regulated by other genes in the fly genome. There is no need for any other information at all, period. And before you start ranting that there would not be enough genes to make the rest of the fly, you must understand that many of these genes are also important in producing other structures as well. You see Bobby, (if that is your real name), proteins are not "merely bricks". They also regualte developmental pathways and catalyze chemical reactions. If you knew anything at all about biology you would understand this basic concept.

Now you worthless sack of crap, one last time just to be fair, do you have any evidence that more information is required or not? If not, then demanding it of others is simply insane. Read the papers or not, no one really cares. But you can't claim that there is not evidence just because you are too stubborn to look at it or too stupid to understand it.

When you are done whining about development, there is a stack of papers on the evolution of the immune system that you really should read. That was the original topic of this thread, 1200 comments ago.

jobby · 4 October 2008

David Stanton said: Hand jobby wrote: "The problem is that those studies although in the right general direction really do not answer the question I asked. The opposition needs to state in their own words how those studies back up their positions. I have never seen them do that." Once again hand jobby, you have shown no evidence whatsoever that you have even attempted to actually read the paper, even though I supplied you with the entire abstract. You said you would read it. You said you wanted to discuss it. Well...? I told you that the answer would not be contained completely in one paper. But, if you won't read even one paper then how will you ever know if the answer is there or not? OK, in my own words. The papers show that cascades of gene expression are sufficient to produce the wing of a fruit fly. The references I cited come from a web site that describes most of the important proceeees involved: http://www.sdbonline.org/fly/aimorph/wing.htm The site lists over 200 proteins that are involved in wing morphogenesis and describes in detail how their expression is regulated. The point is that every one of the proteins is coded for in the fly genome and is regulated by other genes in the fly genome. There is no need for any other information at all, period. And before you start ranting that there would not be enough genes to make the rest of the fly, you must understand that many of these genes are also important in producing other structures as well. You see Bobby, (if that is your real name), proteins are not "merely bricks". They also regualte developmental pathways and catalyze chemical reactions. If you knew anything at all about biology you would understand this basic concept. Now you worthless sack of crap, one last time just to be fair, do you have any evidence that more information is required or not? If not, then demanding it of others is simply insane. Read the papers or not, no one really cares. But you can't claim that there is not evidence just because you are too stubborn to look at it or too stupid to understand it. When you are done whining about development, there is a stack of papers on the evolution of the immune system that you really should read. That was the original topic of this thread, 1200 comments ago.
How many bytes do you think it would take to store all those genes?? Please specify where the shape of the wing is contructed by these genes. Just to google and list proves nothing. Do a little research please.

Error: Either 'id' or 'blog_id' must be specified.

jobby · 4 October 2008

Now you worthless sack of crap, one last time just to be fair, do you have any evidence that more information is required or not? If not, then demanding it of others is simply insane.

... I never said I had evidence. My point is that the data on this is inconclusive. It might have enough or it might not. From my observations and a priori reasonings I would say not. But I never claimed I know of a study that says either way.

Now you believe it does have enough info which is OK. But please do not say there is a fact unless you can come up with evidence.

David Stanton · 4 October 2008

Hand jobby wrote:

"How many bytes do you think it would take to store all those genes??"

Don't know, don't care. Why don't you tell us? How may gallons of ice cream would it take? I can tell you exactly where each gene is located in the fly genome. If you want to know how the shape of the wing is produced you will have to read the papers. Do a little research please.

Thanks for admitting that you have no evidence. I guess your conclusion is based on FAITH. Well I had faith that you would read the paper. I have lost my faith because of you. Until you produce some evidence, no one else has any burden of proof, especially since no one cares what you think.

Now you claimed that all of this nonsense somehow disproved "Darwinism". Sorry, wrong again. Of course I have faith that you don't have any evidence for that either.

Science Avenger · 4 October 2008

I have faith that this idiocy can continue for another 30 pages.

jobby · 4 October 2008

Hand jobby wrote:

“How many bytes do you think it would take to store all those genes??”

Don’t know, don’t care..

... you should care, It is essential to the theory.

jobby · 4 October 2008

Science Avenger said: I have faith that this idiocy can continue for another 30 pages.
... If the trolls did not respond there would not be so much wasted space.

jobby · 4 October 2008

Thanks for admitting that you have no evidence. I guess your conclusion is based on FAITH.

... I have said that I am not sure. I have a best guess but that is it. But YOU are certain without evidence. That is FAITH.

jobby · 4 October 2008

If you want to know how the shape of the wing is produced you will have to read the papers.

... I am not going to read 20 papers to search for evidence which I feel is not there. Why dont YOU cut and paste the pertinent paragraphs. You are familiar with these studies arent you. See I think you are bluffing. I you had read them you would paste the verbage right here:

jobby · 4 October 2008

Now you claimed that all of this nonsense somehow disproved “Darwinism”.

... again I am saying there is insufficient data. Darwinism and ID at this point cannot be proven or disproven. That is my assessment.

David Stanton · 4 October 2008

I weary of your stupidity. One last time

Cascades of gene expression establish morphogenic fields that determine cell fates and thus wing shape. This is the exactly same way that every structure in biology is formed. I provided you with a list of over 200 proteins that are required for wing development you cannot find one that isn't coded for in the fly genome. YOU LOSE PERIOD - END OF STORY - PISS OFF YOU WICKED LOSER.

You refuse to read the papers because you don't feel the answer will be there. The point is that unless you read the papers you will never know. That is your problem, You are not an expert, you won't listen to experts and you don't want ot learn anything at all. All you want to do is stand on the side lines and cry that you can't play. Fine with me, wallow in ignorance.

And no one cares if you think that there is enough evidence for "Darwinism" either. You have not provided even the faintest hint of any reason why any of this has anything to do with "Darwinism". Go masturbate somewhere else. That library chair must be getting pretty sticky.

jobby · 4 October 2008

Cascades of gene expression establish morphogenic fields that determine cell fates and thus wing shape.

... show me the study!

jobby · 4 October 2008

You refuse to read the papers because you don’t feel the answer will be there.

... well show everyone how wrong I am. paste the name of the article and the paragraphs here. I do not think you read ANY of these articles.

jobby · 4 October 2008

Go masturbate somewhere else. That library chair must be getting pretty sticky.

... this ^^ really should be deleted. What a gutter mind. Hope kids are not reading this vulgar site.

jobby · 4 October 2008

Go masturbate somewhere else. That library chair must be getting pretty sticky.

... are you a college instructor. I am telling you right now to stop this or else I will take serious action. There might be a Dave Stanton whom you are libeling. You sound like a pedophile.

David Stanton · 4 October 2008

You can't dictate anything to me bobby boy. I can write whatever I want.

As for your opinion, my opinion is that your opinion is worthless. Anyone who thinks that proteins are "merely bricks" really can't be taken seriously.

Since you spend so much time in the library you should be able to get off that chair and read one paper. I even copied the abstract for you. You said that you wanted to discuss the paper and you didn't. You lied once again.

I will never respond to anything else you write under this or any other name. You have proven that you just aren't worth the effort. You are truly a waste of protoplasm.

jobby · 4 October 2008

David Stanton said: You can't dictate anything to me bobby boy. I can write whatever I want. As for your opinion, my opinion is that your opinion is worthless. Anyone who thinks that proteins are "merely bricks" really can't be taken seriously. Since you spend so much time in the library you should be able to get off that chair and read one paper. I even copied the abstract for you. You said that you wanted to discuss the paper and you didn't. You lied once again. I will never respond to anything else you write under this or any other name. You have proven that you just aren't worth the effort. You are truly a waste of protoplasm.
Saginaw Valley State University 7400 Bay Road, University Center, MI 48710 I am assuming you teach here. You are an embarrassment. Your students should know about your pedophilic nature.

David Stanton · 4 October 2008

To any lurkers,

I accused it of mental masturbation and getting the chair sticky with it's drool. What other interpretation could there be?

Notice that bobby has accused me of being a pedophile. No that is libel folks. I demand that the moderator take steps to find the real identy of this person so that legal proceedings can be initiated.

David Stanton · 4 October 2008

It turns out that there is a real Dr. Stanton in Saginaw. I have contacted him and apologized for dragging his name into this. He has assured me that any libelous or slanderous statments will be dealt with in the appropriate manner. I have promised him that I will change my handle. If the moderators feel that this is inappropriate then they can ban me.

Meanwhile, I will keep my promise to not respond to bobby, jobby, jacod, observer, goff, etc. etc. I suggest that everyone else follow this example.

PvM · 4 October 2008

You are confusing the "Bobby doesn't know" with "science does not know" Support your assertions
jobby said: how they generate morphological features ... they do not know how it generates the shape of the wing

PvM · 4 October 2008

Again jobby shows the scientific vacuity of his position. Well done.
jobby said: If you want to know how the shape of the wing is produced you will have to read the papers. ... I am not going to read 20 papers to search for evidence which I feel is not there. Why dont YOU cut and paste the pertinent paragraphs. You are familiar with these studies arent you. See I think you are bluffing. I you had read them you would paste the verbage right here:

jobby · 4 October 2008

PvM said: Again jobby shows the scientific vacuity of his position. Well done.
jobby said: If you want to know how the shape of the wing is produced you will have to read the papers. ... I am not going to read 20 papers to search for evidence which I feel is not there. Why dont YOU cut and paste the pertinent paragraphs. You are familiar with these studies arent you. See I think you are bluffing. I you had read them you would paste the verbage right here:
I seriously doubt that any poster here has read ANY of those studies. If they had they would simply post a few paragraphs from them here to show their points. It is all a huge bluff. ... I call your hand!

jobby · 4 October 2008

David Stanton said: To any lurkers, I accused it of mental masturbation and getting the chair sticky with it's drool. What other interpretation could there be? Notice that bobby has accused me of being a pedophile. No that is libel folks. I demand that the moderator take steps to find the real identy of this person so that legal proceedings can be initiated.
You are constantly referring to me as second grader who masturbates in libraries. I consider that pedophilic at least in thought. And I am contacting Dave Stanton and his college to that your behavior can be stopped.

Stanton · 4 October 2008

jobby said: Cascades of gene expression establish morphogenic fields that determine cell fates and thus wing shape. ... show me the study!
We have shown you studies, only for you to dismiss and ignore them, and then continue lying about how no one can present you any evidence. That, and you also continue to refuse to present even the most piffling bit of evidence to support your own outrageous claims.

PvM · 4 October 2008

Indeed, when we show him studies which outline how science approaches the problem he refuses to acknowledge them, let alone read them and insists that no such information had been provided to him. And yet, time after time, he shows himself woefully equipped to present his arguments, and defend them with any relevant data. The vacuity of Jobby's approach helps us understand why ID is doomed scientifically speaking to remain free of content. All it does is state "I do not want to understand".
Stanton said:
jobby said: Cascades of gene expression establish morphogenic fields that determine cell fates and thus wing shape. ... show me the study!
We have shown you studies, only for you to dismiss and ignore them, and then continue lying about how no one can present you any evidence. That, and you also continue to refuse to present even the most piffling bit of evidence to support your own outrageous claims.

Stanton · 4 October 2008

Tell us why we should be afraid of this latest threat when your previous threat(s) of reporting this site as a porn site have amounted to absolutely nothing?
jobby said:
David Stanton said: To any lurkers, I accused it of mental masturbation and getting the chair sticky with it's drool. What other interpretation could there be? Notice that bobby has accused me of being a pedophile. No that is libel folks. I demand that the moderator take steps to find the real identy of this person so that legal proceedings can be initiated.
You are constantly referring to me as second grader who masturbates in libraries. I consider that pedophilic at least in thought. And I am contacting Dave Stanton and his college to that your behavior can be stopped.

Stanton · 4 October 2008

PvM said: Indeed, when we show him studies which outline how science approaches the problem he refuses to acknowledge them, let alone read them and insists that no such information had been provided to him. And yet, time after time, he shows himself woefully equipped to present his arguments, and defend them with any relevant data. The vacuity of Jobby's approach helps us understand why ID is doomed scientifically speaking to remain free of content. All it does is state "I do not want to understand".
Thus demonstrating that bobby/jobby/jacob/hamstrung/balanced/goff's claim of being "pro-science" is a shoddy, hole-ridden lie.

jobby · 4 October 2008

Stanton said: Tell us why we should be afraid of this latest threat when your previous threat(s) of reporting this site as a porn site have amounted to absolutely nothing?
jobby said:
David Stanton said: To any lurkers, I accused it of mental masturbation and getting the chair sticky with it's drool. What other interpretation could there be? Notice that bobby has accused me of being a pedophile. No that is libel folks. I demand that the moderator take steps to find the real identy of this person so that legal proceedings can be initiated.
You are constantly referring to me as second grader who masturbates in libraries. I consider that pedophilic at least in thought. And I am contacting Dave Stanton and his college to that your behavior can be stopped.
...Actually I believe you ARE David Stanton. Everything fits too well. Show me how fearless you and continue to post child porn on this site in your own name. If you are NOT David Stanton then you post that you are not the person from Saginaw but are using his name? For what purpose? Then you are guilty of hurting this persons reputation. .. Well in some nanny filters there are warnings about this site.

tresmal · 4 October 2008

This is how jobby gets out of a corner.

PvM · 4 October 2008

Now back to real science

Growth and patterning during fly wing development are mediated by signaling from the dorsoventral (DV) organizer. Interactions between dorsal and ventral cells of the wing pouch set up the organizer by activating Notch (N) at the DV boundary (Diaz-Benjumea and Cohen, 1993Go; Diaz-Benjumea and Cohen, 1995Go; Williams et al., 1994Go; Irvine and Wieschaus, 1994Go; Kim et al., 1995Go; de Celis et al., 1996bGo). N, in turn, activates Wingless (Wg), Cut (Ct) and Vestigial (Vg) at the DV boundary (Couso et al., 1995Go; Kim et al., 1995Go; Rulifson and Blair, 1995Go; Kim et al., 1996Go; Neumann and Cohen, 1996Go). Wg is known to diffuse to non-DV cells from the DV boundary to act as a morphogen (Zecca et al., 1996Go; Neumann and Cohen, 1997Go). High levels of Wg are required for activating Achaete (Ac), whereas moderate levels are sufficient to activate Distal-less (Dll) and low levels to activate Vg (Neumann and Cohen, 1997Go). Thus, Vg is expressed in both DV and non-DV cells. It has been shown that two different promoters regulate Vg expression in DV and non-DV cells (Kim et al., 1996Go). They are vg-boundary enhancer (vg-BE) and vg-quadrant enhancer (vg-QE).

and

The halteres and wings of Drosophila are homologous thoracic appendages, which share common positional information provided by signaling pathways. The activity in the haltere discs of the Ultrabithorax (Ubx) Hox gene establishes the differences between these structures, their different size being an obvious one. We show here that Ubx regulates the activity of the Decapentaplegic (Dpp) signaling pathway at different levels, and that this regulation is instrumental in establishing the size difference. Ubx downregulates dpp transcription and reduces Dpp diffusion by repressing the expression of master of thick veins and division abnormally delayed and by increasing the levels of thick veins, one of the Dpp receptors. Our results suggest that modulation in Dpp expression and spread accounts, in part, for the different size of halteres and wings.

Remind us again how ID explains these? Or Jobby? Or is his response going to be "I could not possibly imagine". Remember how he still owes us an estimate of the information content of humans. Another lost battle it seems...

Stanton · 4 October 2008

jobby Idiot said: ...Actually I believe you ARE David Stanton. Everything fits too well. Show me how fearless you and continue to post child porn on this site in your own name. If you are NOT David Stanton then you post that you are not the person from Saginaw but are using his name? For what purpose? Then you are guilty of hurting this persons reputation. .. Well in some nanny filters there are warnings about this site.
Among other things, Idiot, "Stanton" happens to be the given name that my parents gave upon my birth, which is the specific reason why I use the handle "Stanton," and secondly, I have never posted child pornography anywhere, ever. If you don't believe me, follow my link to my DeviantArt account and see for yourself. And as such, your claim that I have been posting child pornography here demonstrates that you are a bald-faced liar and a troll. Did it ever occur to you that there are more than 2 dozen people living on this planet who have the first name of "Stanton"? Your insultingly stupid accusations prove that you're an idiot if you can not be bothered to tell the difference between David Stanton's posts and mine.

PvM · 4 October 2008

Shocking
tresmal said: This is how jobby gets out of a corner.

Stanton · 4 October 2008

PvM said: Remind us again how ID explains these? Or Jobby? Or is his response going to be "I could not possibly imagine". Remember how he still owes us an estimate of the information content of humans. Another lost battle it seems...
You forget that bobbyIdiot does not profess to be a supporter of Intelligent Design Theory, instead claiming that "insufficient data exists to support either ID or Darwinism (sic)" In other words, he's a fence-sitting troll who's too lazy and mean-spirited to make up his mind.

jobby · 4 October 2008

You forget that bobbyIdiot does not profess to be a supporter of Intelligent Design Theory, instead claiming that “insufficient data exists to support either ID or Darwinism (sic)”

In other words, he’s a fence-sitting troll who’s too lazy and mean-spirited to make up his mind.

... well I have looked at the evidence objectively and have found insufficient for either side. According to you one HAS to choose a side? Sound very political to me!

... DS, I see you have stopped the porn.

jobby · 4 October 2008

PvM said: Now back to real science

Growth and patterning during fly wing development are mediated by signaling from the dorsoventral (DV) organizer. Interactions between dorsal and ventral cells of the wing pouch set up the organizer by activating Notch (N) at the DV boundary (Diaz-Benjumea and Cohen, 1993Go; Diaz-Benjumea and Cohen, 1995Go; Williams et al., 1994Go; Irvine and Wieschaus, 1994Go; Kim et al., 1995Go; de Celis et al., 1996bGo). N, in turn, activates Wingless (Wg), Cut (Ct) and Vestigial (Vg) at the DV boundary (Couso et al., 1995Go; Kim et al., 1995Go; Rulifson and Blair, 1995Go; Kim et al., 1996Go; Neumann and Cohen, 1996Go). Wg is known to diffuse to non-DV cells from the DV boundary to act as a morphogen (Zecca et al., 1996Go; Neumann and Cohen, 1997Go). High levels of Wg are required for activating Achaete (Ac), whereas moderate levels are sufficient to activate Distal-less (Dll) and low levels to activate Vg (Neumann and Cohen, 1997Go). Thus, Vg is expressed in both DV and non-DV cells. It has been shown that two different promoters regulate Vg expression in DV and non-DV cells (Kim et al., 1996Go). They are vg-boundary enhancer (vg-BE) and vg-quadrant enhancer (vg-QE).

and

The halteres and wings of Drosophila are homologous thoracic appendages, which share common positional information provided by signaling pathways. The activity in the haltere discs of the Ultrabithorax (Ubx) Hox gene establishes the differences between these structures, their different size being an obvious one. We show here that Ubx regulates the activity of the Decapentaplegic (Dpp) signaling pathway at different levels, and that this regulation is instrumental in establishing the size difference. Ubx downregulates dpp transcription and reduces Dpp diffusion by repressing the expression of master of thick veins and division abnormally delayed and by increasing the levels of thick veins, one of the Dpp receptors. Our results suggest that modulation in Dpp expression and spread accounts, in part, for the different size of halteres and wings.

Remind us again how ID explains these? Or Jobby? Or is his response going to be "I could not possibly imagine". Remember how he still owes us an estimate of the information content of humans. Another lost battle it seems...
Of course there are regulatory genes etc. But the point is there is no explanation how the actual shape is formed. Go ahead try to find it. ... where is YOUR estimate of the information content of humans? you have NO burden of proof for YOUR theory. again as I have always state the data is insufficeint for either. DO YOU AGREE OR DISAGREE WITH THAT???

tresmal · 4 October 2008

jobby said: ... well I have looked at the evidence objectively cluelessly and have found insufficient for either side. According to you one HAS to choose a side? Sound very political to me!
Jobby, if you had looked at the evidence objectively the first thing you would have noticed is that only one side (evolution) has evidence to look at.

Stanton · 4 October 2008

1)I'm not David Stanton, Idiot; 2)I never posted pornography to begin with, you lying sack of stupidity: no doubt that one of the games you're playing is seeing how far you can destroy whatever remains of your pathetic credibility; 3)People who claim to reject "Darwinism" (sic) because of the evidence are lying because they either a) reject "Darwinism" for political reasons, or b) reject "Darwinism" because they were mislead by other people, and are too lazy to actually look at the evidence in the first place.
jobbyLying Sack of Stupidity said: You forget that bobbyIdiot does not profess to be a supporter of Intelligent Design Theory, instead claiming that “insufficient data exists to support either ID or Darwinism (sic)” In other words, he’s a fence-sitting troll who’s too lazy and mean-spirited to make up his mind. ... well I have looked at the evidence objectively and have found insufficient for either side. According to you one HAS to choose a side? Sound very political to me! ... DS, I see you have stopped the porn.

AlphaOmegA · 4 October 2008

Jobby

Provided you are representing yourself and your views accurately here (which is far from obvious), it would be instructive and enlightening if you could disclose any allegiances/sympathies you might have to dualism, supernaturalism in general, or what most people would call "paranormal" or "pseudoscientific" phenomena/disciplines. Also instructive would be what, if any, religious or "spiritual" upbringing you had. This is completely void of malicious intent. I just want to know what forces shaped your current views into what they are today. If none of factors are present I am even more intrigued. Do any of the concepts involved in discussing evolution provoke an emotional response in you? Revulsion? Disgust?

Finally I am interested in what makes you doubt the well-confirmed expert explanation of biodiversity on this planet. Your suggestion that no evidence has been provided is ludicrous. Do you think that the vast reservoir of theoretical and applied research represented in peer-reviewed journals is just lots of blank paper? Do you think that millions of brilliant people who stand to become famous (and possibly very rich) by proving the scientific consensus radically wrong fail to do so because they aren't as brilliant as you? They fail because the scientific method is truth-tracking and the scientific community has mastered its application, even building in safeguards like peer review to stamp out researchers' honest (and dishonest) mistakes. Successful ideas in science remain because they have survived the INTENSE scrutiny of the world's best minds. There is no conspiracy and there is no "faith", just a ton of hard-working people who are trying to unravel the mysteries of the universe.

If you aren't satisfied with that, hit the books and learn modern biology for yourself (these people have suffered enough). When you post two minutes after another person links one (or several) complex scientific article/s or makes a complex argument and claim that it doesn't provide evidence for their position it is clear that you did not read, much less absorb, anything.

By the way, your use of the word "Darwinism" is hopelessly inaccurate and will make scientifically literate people assume you are in the camp of people who don't understand what Darwin said and more importantly DID NOT say. Don't do it if you want any kind of credibility.

Cordially yours,
AlphaOmegA

P.S. Hi Panda People

Stanton · 4 October 2008

jobby Lying Sack of Stupidity said: Of course there are regulatory genes etc. But the point is there is no explanation how the actual shape is formed. Go ahead try to find it. ... where is YOUR estimate of the information content of humans? you have NO burden of proof for YOUR theory. again as I have always state the data is insufficeint for either. DO YOU AGREE OR DISAGREE WITH THAT???
So if there is no data, then, tell us what you think geneticists and other biologists do in the lab all day? What do you think Intelligent Design proponents do all day? And if you are a teacher, then how come you do not know the difference between "evidence" or "burden of proof"?

tresmal · 4 October 2008

jobby said: you have NO burden of proof for YOUR theory. again as I have always state the data is insufficeint for either.
Jobby, the burden of proof is on your side because the weight of evidence is on our side.

Stanton · 4 October 2008

tresmal said:
jobby said: you have NO burden of proof for YOUR theory. again as I have always state the data is insufficeint for either.
Jobby, the burden of proof is on your side because the weight of evidence is on our side.
But the thing is, tresmal, bobbyLying Sack is pretending that there is insufficient evidence for Evolutionary Biology, that, and he doesn't appear to realize that there is a difference between evidence and "burden of proof."

PvM · 4 October 2008

you have NO burden of proof for YOUR theory. again as I have always state the data is insufficeint for either. DO YOU AGREE OR DISAGREE WITH THAT???

— Jobby
Of course I disagree with that because it requires one to ignore vast amounts of scientific knowledge, an inevitability when it comes to ID. You're doing a good job showing this

PvM · 4 October 2008

If it looks like a duck, walks like a duck and expresses the same lack of scientific relevance like ID then for all practical purposes, they are very similar positions. Jobby, like ID, ignores the scientific evidence and claims, a controversy since neither side knows, and yet when comparing the two sides one observes vast amounts of knowledge, research, data and evidence versus... Nothing really.
jobby said: You forget that bobbyIdiot does not profess to be a supporter of Intelligent Design Theory, instead claiming that “insufficient data exists to support either ID or Darwinism (sic)” In other words, he’s a fence-sitting troll who’s too lazy and mean-spirited to make up his mind. ... well I have looked at the evidence objectively and have found insufficient for either side. According to you one HAS to choose a side? Sound very political to me! ... DS, I see you have stopped the porn.

tresmal · 4 October 2008

Stanton said: But the thing is, tresmal, bobbyLying Sack is pretending that there is insufficient evidence for Evolutionary Biology, that, and he doesn't appear to realize that there is a difference between evidence and "burden of proof."
Yes, he has a wealth of ignorance that is truly astounding.*

*from Ren and Stimpy.

Science Avenger · 4 October 2008

jobby said: ... DS, I see you have stopped the porn.
Yeah, now if you would stop the porn, and stop doing the sitting herky jerky while you should be reading those papers. I'm sure you'll think that qualifies as porn, which merely reveals just how obsessed you are with porn.

Dale Husband · 4 October 2008

This is like a comedy club, and here's the joke:

jobby: "Show me the evidence for evolution."

science fan: "Here you go: [Link]"

jobby: "That is not sufficient. Give me MORE evidence."

science fan: "Here's some more: [Link]"

jobby: "That is not specific enough. What about this problem? [non-issue]."

science fan: "What problem? That doesn't disprove evolution at all."

jobby: "I say it does, and it is up to YOU to prove me wrong!"

science fan: "Read this, [Link]."

jobby: "That's just one man's word. How about more proof?"

science fan: "One man's word should be enough if he is right."

jobby: "You never proved him right!"

science fan: "Why are you acting so stupid?"

jobby: "PERSONAL ATTACK! You lose! This site is worthless! [More insults, lies and personal attacks]"

Look, we ALL know that jobby is a patholigical liar and bigot and it's been proven here over and over. What more damage can we do to him that's been done?

Dale Husband · 4 October 2008

jobby said:
PvM said: Again jobby shows the scientific vacuity of his position. Well done.
jobby said: If you want to know how the shape of the wing is produced you will have to read the papers. ... I am not going to read 20 papers to search for evidence which I feel is not there. Why dont YOU cut and paste the pertinent paragraphs. You are familiar with these studies arent you. See I think you are bluffing. I you had read them you would paste the verbage right here:
I seriously doubt that any poster here has read ANY of those studies. If they had they would simply post a few paragraphs from them here to show their points. It is all a huge bluff. ... I call your hand!
Well, at least we know YOU never read them, jobby. You are not here to learn, but to disrupt. And we've been laughing at you for several days. Real students of science do not balk at doing actual research, including looking up and reading HUNDREDS of papers from science journals, as well as writing a few of their own, to gather and analyse all the relevant data when called upon to do so. That's how we all know you are a fraud. You couldn't understand real science papers if you read them. That's why you refuse to speak at length and in detail about any of them. Now, let's see you write an actual science paper supporting your case against us. And then link to it here!

Dale Husband · 4 October 2008

From a long time ago:
jobby said:

To disprove NS, just find cases in which the varieties that produce more offspring don’t increase their numbers faster than the other varieties.

... you missed the point: of course evolution and NS happen. But does NS cause complex structures to evolve from simpler ones. show me the test
We don't have to show you anything. DO THE TEST YOURSELF! GO TO A LAB AND TRY TO MAKE MORE COMPLEX ORGANIC MOLECULES FROM SIMPLER ONES AND PROVE THAT IT CANNOT HAPPEN! OTHERWISE, SHUT UP! Oh, the experiments have already been done, many, many times, and have shown that such complexities can arise under the right conditions. Why? Because there is no known limit to how large and complex organic molecules can grow. NONE!

SWT · 4 October 2008

Dale Husband said: This is like a comedy club, and here's the joke: [Accurate synopsis removed for brevity]
Close, but misses one of the sub-themes: jobby: "Show me one paper that shows the evidence for evolution." science fan: "Here are a couple of hundred papers related to your specific question." jobby: "No! I said show me ONE paper. Why won't you answer my question? I think you are faking it."

PvM · 4 October 2008

… you missed the point: of course evolution and NS happen. But does NS cause complex structures to evolve from simpler ones.

— Jobby
The problem with these claims are Jobby's inability to define complexity in a meaningful manner. When using for instance Shannon information as the measure, it an be shown that variation and selection inevitable increase information. As to real examples, people have pointed to various extensive research and of course, invariably Jobby ignores the research, moves the goalposts. Jobby has the fascinating position where from ignorance he can close his mind from actual research and continue his mantra of 'not enough, not enough' Once again showing how ID's position adds nothing to scientific knowledge, is based on scientific ignorance and cannot even compete with evolutionary science. So what Jobby means is not that NS and variation has not been shown to increase complexity but rather that he remains unconvinced. When Jobby is invited to walk down a particular example, he quickly balks and moves to yet another ignorant and vacuous position. Now imagine your children to follow example from such a position. A virtual nightmare

Stanton · 4 October 2008

PvM said: ... When Jobby is invited to walk down a particular example, he quickly balks and moves to yet another ignorant and vacuous position. Now imagine your children to follow example from such a position. A virtual nightmare
In some species, individuals immediately cannibalize other individuals who engage in such socially aberrant behavior. Sometimes, I envy those species.

jobby · 5 October 2008

Provided you are representing yourself and your views accurately here (which is far from obvious), it would be instructive and enlightening if you could disclose any allegiances/sympathies you might have to dualism, supernaturalism in general, or what most people would call “paranormal” or “pseudoscientific” phenomena/disciplines.

... willing to do that if my opposition and YOU are willing to do so

Also instructive would be what, if any, religious or “spiritual” upbringing you had.

... willing to do that if my opposition and YOU are willing to do so

This is completely void of malicious intent. I just want to know what forces shaped your current views into what they are today. If none of factors are present I am even more intrigued. Do any of the concepts involved in discussing evolution provoke an emotional response in you? Revulsion? Disgust?

Do any of the concepts involved in discussing evolution provoke an emotional response in you? Revulsion? Disgust?

... evolution has been proven.it happens everyday. it is useful. I have no problem with it.

Finally I am interested in what makes you doubt the well-confirmed expert explanation of biodiversity on this planet.

... I am not doubting 98% of the explanation

Your suggestion that no evidence has been provided is ludicrous.

... I have asked over and over for this elusive evidenc but my oppostion refuses to present it.

Do you think that the vast reservoir of theoretical and applied research represented in peer-reviewed journals is just lots of blank paper?

... Of course not!

Do you think that millions of brilliant people who stand to become famous (and possibly very rich) by proving the scientific consensus radically wrong fail to do so because they aren’t as brilliant as you?

... No one can prove the scientific consensus radically wrong.

They fail because the scientific method is truth-tracking and the scientific community has mastered its application, even building in safeguards like peer review to stamp out researchers’ honest (and dishonest) mistakes.

... politics is an important factor here that you are ignoring.

Successful ideas in science remain because they have survived the INTENSE scrutiny of the world’s best minds.

... many misconceptions have survived that 'INTENSE scrutiny' for decades.

There is no conspiracy and there is no “faith”, just a ton of hard-working people who are trying to unravel the mysteries of the universe.

... believing something without evidence = FAITH, sorry.

If you aren’t satisfied with that, hit the books and learn modern biology for yourself (these people have suffered enough).

... I know bio quite well. I think my opposition needs to study it a bit more

When you post two minutes after another person links one (or several) complex scientific article/s or makes a complex argument and claim that it doesn’t provide evidence for their position it is clear that you did not read, much less absorb, anything.

...I said that many of these studies I did not read because I do not believe my opposition has read them. I asked that they tell in their own words why these studies support their position and they have rarely if ever responded. I am familiar with many of these studies and have researched them quite a bit. A few of the studies that I have been referred to that I have read simply do not address the issues we are debating. I think my opposition simply googles key words and gets lists of studies. I have examine the abstracts and they do not address this issues of the debate.

By the way, your use of the word “Darwinism” is hopelessly inaccurate and will make scientifically literate people assume you are in the camp of people who don’t understand what Darwin said and more importantly DID NOT say.

... Dawkins, Gould and many other mainstream biologists use the term Darwnism. If you can give me another term to use I will use it. We can call it X theory if that makes you feel better. However many here are equating evolution with Darwinism and they are not the same thing. My opposition refuses to define terms and use well defined terms in these debates. What term would you like to use to refer to the theory that humans came from one-celled animals mainly thru natural selection. We can call that X theory if you have a problem with the commonly used term: Darwinism.

Don’t do it if you want any kind of credibility.

Cordially yours, AlphaOmegA

P.S. Hi Panda People

jobby · 5 October 2008

Oh, the experiments have already been done, many, many times, and have shown that such complexities can arise under the right conditions. Why? Because there is no known limit to how large and complex organic molecules can grow. NONE!

.... again SHOW me those experiments.

jobby · 5 October 2008

Can any of my opposition just pick out ONE study they have READ and lets go over it. That cant be that difficult. See I think they are just googling key words and coming up with a list. I have looked at the abstracts to some of the studies they have referred me to and found that tho the studies contained the key words they did not contain data or info that backed up their points.

So pick one, read it, explain in YOUR OWN WORDS how it supports your position and then I will read it and give you my response.

SWT · 5 October 2008

jobby said: Can any of my opposition just pick out ONE study they have READ and lets go over it. That cant be that difficult. See I think they are just googling key words and coming up with a list. I have looked at the abstracts to some of the studies they have referred me to and found that tho the studies contained the key words they did not contain data or info that backed up their points. So pick one, read it, explain in YOUR OWN WORDS how it supports your position and then I will read it and give you my response.
You claim you've looked at some of the studies and claim that they do not "contain data or info that backed up their points." Please tell us which studies you've reviewed in sufficient depth to draw this conclusion, summarizing them in your own words, and explain to us precisely where you think the problems are either the studies or the citation of these studies in this context.

PvM · 5 October 2008

Why should we believe you this time? You have been presented countless examples before which you rejected as irrelevant. Such ignorance deserves only one response. We have provided how science explains the formation of body plans, show us your objections. Similarly you still owe as an estimate of the information content of the human body. Let's see if you can deliver.
jobby said: Can any of my opposition just pick out ONE study they have READ and lets go over it. That cant be that difficult. See I think they are just googling key words and coming up with a list. I have looked at the abstracts to some of the studies they have referred me to and found that tho the studies contained the key words they did not contain data or info that backed up their points. So pick one, read it, explain in YOUR OWN WORDS how it supports your position and then I will read it and give you my response.

PvM · 5 October 2008

And when you are done, I will share with you a paper A.. C, O... C, C... TC (2000). "XXXXXXXX". PNAS on how science looks at the issue of evolution, complexity and such.

Cheers my science avoiding friend

Dale Husband · 5 October 2008

jobby said:

Oh, the experiments have already been done, many, many times, and have shown that such complexities can arise under the right conditions. Why? Because there is no known limit to how large and complex organic molecules can grow. NONE!

.... again SHOW me those experiments.
jobby said: Can any of my opposition just pick out ONE study they have READ and lets go over it. That cant be that difficult. See I think they are just googling key words and coming up with a list. I have looked at the abstracts to some of the studies they have referred me to and found that tho the studies contained the key words they did not contain data or info that backed up their points. So pick one, read it, explain in YOUR OWN WORDS how it supports your position and then I will read it and give you my response.
No, you should be able to do it yourself. Unless and until you prove to us that you can do it, you cannot claim to be our equal in the understanding of science. We don't have to play by YOUR rules, only the rules that put all of us on the same level playing field. We give you links to the papers, you read them, YOU show us they are not sufficient to prove our case. That's how it really works among scientists. If we have to take you by the hand and lead you from A to B to C to D all the time, that only shows how inferior your knowledge is, and thus how you have no point even challenging any of us. PROVE TO US YOU CAN THINK LIKE A SCIENTIST! EXAMINE THE DATA YOURSELF! You will not get a passing grade here from being spoon fed.

Dale Husband · 5 October 2008

My point, of course, is that jobby knew from the very beginning that he lacked even the most basic science education to tackle the serious issues stated in technical science papers, let alone conduct his own experiments to actually do science on his own, but wanted to challenge us anyway. That's like a five pound monkey taking on an 800 pound gorilla. No contest. But jobby keeps plugging away, refusing to admit he has no case and was already defeated, and thus proving more and more his idiocy. Indeed, his behavior is the very definition of idiocy!

jobby · 5 October 2008

We give you links to the papers, you read them, YOU show us they are not sufficient to prove our case.

...OK give me a link that to a study YOU have read. I do not see why I should read one you have not.

jobby · 5 October 2008

I think it is pretty obvious what is going on here. My opposition has NOT read any of these studies. I am not going to read dozens of studies looking for the elusive data when they could simple pick one and explain in their own words why the study supports their point and paste some of the paragraphs.

Well it AINT gonna happen. Its a huge bluff!

PvM · 5 October 2008

That's a poor standard. Are you saying that you only read papers that would alleviate your ignorance if you believe your opponents have read them. Figures
jobby said: We give you links to the papers, you read them, YOU show us they are not sufficient to prove our case. ...OK give me a link that to a study YOU have read. I do not see why I should read one you have not.

PvM · 5 October 2008

Again Jobby is blaming his opponents for his failure to read the papers. As I predicted, Jobby shows no intention to reduce his level of ignorance, shows no intention of reading papers which do not support his ignorance, which would include almost any paper and instead insists that it is all a bluff... What a pathetic display of scientific vacuity... Thanks Jobby, job(by) well done
jobby said: I think it is pretty obvious what is going on here. My opposition has NOT read any of these studies. I am not going to read dozens of studies looking for the elusive data when they could simple pick one and explain in their own words why the study supports their point and paste some of the paragraphs. Well it AINT gonna happen. Its a huge bluff!

jobby · 5 October 2008

That’s a poor standard. Are you saying that you only read papers that would alleviate your ignorance if you believe your opponents have read them.

Figures

... I AM NOT going to read 20 papers and search them for the supposed proof that lies in them when my opposition will not even read ONE! its pretty obvious this is a bluff.

jobby · 5 October 2008

Again Jobby is blaming his opponents for his failure to read the papers.

... have YOU read any of the papers??

PvM · 5 October 2008

Irrelevant, these papers are provided to you to reduce the level of ignorance you have portrayed in discussing these issues. If you are not interested in educating yourself as to the status of science, then you should not be making the fallacious claim that science does not know 'X' when in fact science may not know all the details, it knows far more than you are willing and able to admit. In other words, your position of ignorance cannot be maintained in light of what science does know. And until you show some evidence that you have familiarized yourself with said research and point out what you believe are supporting evidence for your position, the mere existence of these many papers on these topics undermines your position. If you let your ignorance be driven by your perception of the ignorance of others, then I am not surprised that you have shown little interest so far. Thanks for helping understand how (B)(J)obby 'thinks'
jobby said: Again Jobby is blaming his opponents for his failure to read the papers. ... have YOU read any of the papers??

PvM · 5 October 2008

jobby said: Again Jobby is blaming his opponents for his failure to read the papers. ... have YOU read any of the papers??
And remind us again of the information content of the human body. After all you made a positive claim of such and ever since you made the claim, which is now several days ago, you have shown no intention to answer or attempt to answer the question. Why is that?

Stanton · 5 October 2008

PvM said:
jobby said: Again Jobby is blaming his opponents for his failure to read the papers. ... have YOU read any of the papers??
And remind us again of the information content of the human body. After all you made a positive claim of such and ever since you made the claim, which is now several days ago, you have shown no intention to answer or attempt to answer the question. Why is that?
Because he is scientifically vacuous and has abominable social skills

Dale Husband · 5 October 2008

jobby said: I think it is pretty obvious what is going on here. My opposition has NOT read any of these studies. I am not going to read dozens of studies looking for the elusive data when they could simple pick one and explain in their own words why the study supports their point and paste some of the paragraphs. Well it AINT gonna happen. Its a huge bluff!
Then go away, declare victory, and find something more productive to do. Meanwhile, we will continue our research, regardless of your lame trolling. You have failed to make a positive impression on us, and that's the first thing you must do to win us over your your point of view. Come to think of it, what is your point of view?

Dale Husband · 5 October 2008

PvM, could we have a list of the links to all the many papers presented to jobby that he has persistently ignored to further damage his credibility? It helps to have all the evidence in one place. Perhaps in the next Panda's Thumb post?

Dale Husband · 5 October 2008

PvM said: And remind us again of the information content of the human body. After all you made a positive claim of such and ever since you made the claim, which is now several days ago, you have shown no intention to answer or attempt to answer the question. Why is that?
You mean this, PvM?
jobby said: The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

tresmal · 5 October 2008

jobby said: Can any of my opposition just pick out ONE study they have READ and lets go over it. That cant be that difficult. See I think they are just googling key words and coming up with a list. I have looked at the abstracts to some of the studies they have referred me to and found that tho the studies contained the key words they did not contain data or info that backed up their points. So pick one, read it, explain in YOUR OWN WORDS how it supports your position and then I will read it and give you my response.
Jobby, you have had dozens of papers referred to you. You haven't read a single one. You won't read a scientific paper because you can't read scientific paper.
As far as reading a paper and rewriting it in our own words; that's just stupid.

1) And then you'll read it!?You mean you want us to translate it for you so you won't have to read it. Sorry but no.

2) If you want to verify whether or not someone has read a paper, the best way is to discuss it. If someone can talk intelligently and knowledgeably about it (which would be off the charts surprising in your case) then that person has read and understood it.

3) If someone was fool enough to comply with your unscientific request for a plain English translation, you would seize that as an excuse not to read the paper and would try to argue about the simplified paraphrasing instead of the precise, technical and carefully measured language of the paper. I don't think anyone here is dumb enough to fall for that.

Dale Husband · 5 October 2008

tresmal said: 3) If someone was fool enough to comply with your unscientific request for a plain English translation, you would seize that as an excuse not to read the paper and would try to argue about the simplified paraphrasing instead of the precise, technical and carefully measured language of the paper. I don't think anyone here is dumb enough to fall for that.
Especially since science by nature is obsessed with accuracy, with is exactly what you do NOT get when you substitute a paraphase with the actual text of the original paper. Can we ban jobby now?

jobby · 6 October 2008

Dale Husband said:
tresmal said: 3) If someone was fool enough to comply with your unscientific request for a plain English translation, you would seize that as an excuse not to read the paper and would try to argue about the simplified paraphrasing instead of the precise, technical and carefully measured language of the paper. I don't think anyone here is dumb enough to fall for that.
Especially since science by nature is obsessed with accuracy, with is exactly what you do NOT get when you substitute a paraphase with the actual text of the original paper. Can we ban jobby now?
... you can take direct quotes out of the study and then comment on those direct quotes. HAVE YOU READ ANY OF THE STUDIES???

jobby · 6 October 2008

You have failed to make a positive impression on us, and that’s the first thing you must do to win us over your your point of view.

... I am sure your FAITH in Darwinism will never change no matter how cogent the argument or how overwhelming the data. I am here mainly in case some young people are reading this so they will not think that Darwinism has really been proven and hopefully their minds will be free to explore options.

jobby · 6 October 2008

f you let your ignorance be driven by your perception of the ignorance of others, then I am not surprised that you have shown little interest so far.

... well then just pick one of the studies, READ IT!, and lets discuss it.

...HAVE YOU READ ANY OF THOSE STUDIES??

SWT · 6 October 2008

jobby said: f you let your ignorance be driven by your perception of the ignorance of others, then I am not surprised that you have shown little interest so far. ... well then just pick one of the studies, READ IT!, and lets discuss it. ...HAVE YOU READ ANY OF THOSE STUDIES??
PvM has provided you with quotes from relevant articles as well as his own commentary. Why don't you try addressing the technical content of some of his posts? Seriously, PvM and other posters here have placed a veritable smorgasbord of tasty developmental biology in front of you; you've responded by complaining about how hungry you are and asking others to chew your food for you.

PvM · 6 October 2008

Again irrelevant. I have presented you lots of outlines including supporting papers, others have presented you with relevant papers regarding developmental biology. If you chose to remain uninformed, that is surely you right and it helps understand the general nature of the discussion which shows you ill equipped to discuss. In my previous interactions with you, you have shown similar inability or disinterest in educating yourself. It shows.
jobby said: f you let your ignorance be driven by your perception of the ignorance of others, then I am not surprised that you have shown little interest so far. ... well then just pick one of the studies, READ IT!, and lets discuss it. ...HAVE YOU READ ANY OF THOSE STUDIES??

jobby · 6 October 2008

SWT said:
jobby said: f you let your ignorance be driven by your perception of the ignorance of others, then I am not surprised that you have shown little interest so far. ... well then just pick one of the studies, READ IT!, and lets discuss it. ...HAVE YOU READ ANY OF THOSE STUDIES??
PvM has provided you with quotes from relevant articles as well as his own commentary. Why don't you try addressing the technical content of some of his posts? Seriously, PvM and other posters here have placed a veritable smorgasbord of tasty developmental biology in front of you; you've responded by complaining about how hungry you are and asking others to chew your food for you.
Where??

PvM · 6 October 2008

In fact, Bobby made another assertion that the complexity of the human body was too high, much higher than when compared for instance with snowflakes. And yet, he refuses to show us this 'fact', mostly because I believe he lacks the relevant data and is extremely ill equipped to apply various measures of complexity to this problem.
Dale Husband said:
PvM said: And remind us again of the information content of the human body. After all you made a positive claim of such and ever since you made the claim, which is now several days ago, you have shown no intention to answer or attempt to answer the question. Why is that?
You mean this, PvM?
jobby said: The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

PvM · 6 October 2008

Pretending that you have not seen it, how novel
jobby said:
SWT said:
jobby said: f you let your ignorance be driven by your perception of the ignorance of others, then I am not surprised that you have shown little interest so far. ... well then just pick one of the studies, READ IT!, and lets discuss it. ...HAVE YOU READ ANY OF THOSE STUDIES??
PvM has provided you with quotes from relevant articles as well as his own commentary. Why don't you try addressing the technical content of some of his posts? Seriously, PvM and other posters here have placed a veritable smorgasbord of tasty developmental biology in front of you; you've responded by complaining about how hungry you are and asking others to chew your food for you.
Where??

Henry J · 6 October 2008

I wonder if somebody should point out that it's more important for the one arguing against the consensus to read the papers, than for the ones who figure experts know their subject better than amateurs who declare themselves to be the arbiters?

Henry

jobby · 6 October 2008

…HAVE YOU READ ANY OF THOSE STUDIES??

Robin · 6 October 2008

PvM said: Again Jobby is blaming his opponents for his failure to read the papers. What a pathetic display of scientific vacuity... Thanks Jobby, job(by) well done
Jobby's own posts are some of the best rebuttals against Jobby's claims. :)

PvM · 6 October 2008

Have you? After all it is you who should be worried about educating yourself about issues related to developmental biology. Does it matter if I have or have not read these papers? And why do you avoid discussing matters I did raise, and which you rejected or avoided dealing with based on your personal incredulity and remind us again of your progress on determining the complexity of the human body?
jobby said: …HAVE YOU READ ANY OF THOSE STUDIES??

jobby · 6 October 2008

Time for a recap:

There are no studies that show that 750 MBytes which seems to be about the amont of info in the DNA is enough to construct a human body

and

there are no studies that validate that NS is capable of causing complex body plans to evolve from simpler ones.

If anyone knows of studies that show any of the above please lets talk about them.

PvM · 6 October 2008

YOu are wrong and have been provided with evidence of the first and promised a reference for the second once you finish addressing the issues. Instead the facts show that you decided to waddle in ignorance. Fine with me, it's your choice to make.
jobby said: Time for a recap: There are no studies that show that 750 MBytes which seems to be about the amont of info in the DNA is enough to construct a human body and there are no studies that validate that NS is capable of causing complex body plans to evolve from simpler ones. If anyone knows of studies that show any of the above please lets talk about them.

Wayne Francis · 6 October 2008

Hand jobby said: This is a common misconception. The oldest and most precise science of all, astronomy, never performs an experiment, but only makes observations. ... no they do experiments. you have a misconception about what an experiment is. wiki The essence of an experiment is to introduce a change in a system (the independent variable) and to study the effect of this change (the dependent variable). Two fundamental considerations of experimental design are: * That the independent variable is the only factor that varies systematically in the experiment; in other words, that the experiment is appropriately controlled - that confounding variables are eliminated; and * That the dependent variable truly reflects the phenomenon under study (a question of validity) and that the variable can be measured accurately (i.e., that various types of experimental error, such as measurement error can be eliminated).
Hand Jobby, what variable/change do astronomers introduce into the systems they observe? Do they add mass to a star to check it luminosity? Do they introduce accretion disks around galactic black holes to see if they can produce polar jets? Do they push stars closer to white dwarfs to see if they can get the white dwarf to steal material away and under go dwarf nova burst?
Hand jobby said: ... you have a misconception about what an experiment is. ...
Maybe you have a misconception of what you cut and pasted into your post. I've bold faced the important bits in the definition for your tiny brain to nibble on. Astronomy is ultimately the science that we will rely on observation over experimentation for a long time to come. Funny enough modeling (and lately computer modeling), that Hand Jobby says isn't as a valid method of experimentation, is probably the 2nd way we learn so much from astronomy/cosmology. Again this post is not aimed at Hand Jobby. He will either ignore it or scream that I am wrong and not actually try to say why he thinks I am wrong, if he can even pull himself to reading the definition he himself pasted into his post. This post is aimed at the lurkers to aid them in their critical thinking skills and to point out how you should really read what is being said. Maybe Hand Jobby wouldn't make so many post where he contradicts himself, and here in the one post, if he did.

jobby · 6 October 2008

That the independent variable is the only factor that varies systematically in the experiment; in other words, that the experiment is appropriately controlled

... well of course they cannot push planets around but the point is that the indpendent variable 'varies' and this can be accomplished by measuring the dependent variable when the independent one varies by natural means.

OK now show me the experiments in Darwinism where the independent variable changed and how the dependent variable was measured and you will have a true scientific experiment but unfortunately these do not exist. if you know of one please present it so the 'lurkers' will be enlightened.

tresmal · 6 October 2008

jobby said: Time for a recap: There are no studies that show that 750 MBytes which seems to be about the amont of info in the DNA is enough to construct a human body
No jobby, that is the size of the genome as a computer file, not the amount of "information" in the genome. They are not the same thing. A 300 base segment of nonsense DNA has just as much data(which is all that that 750 MB number refers to) as a 300 base segment that codes for a 100 amino acid protein but not nearly as much "information". As far as these "studies" go, nobody, but you, has seen the need for such a study. There is absolutely no evidence of a vast body of missing "information". None at all. Period. Embryology and developmental biology are making enormous progress without it. This "dark information" is not dropping even the subtlest hint of its existence. There is absolutely no reason to believe, apart from your ignorance based incredulity, that the genome isn't big enough to play its role in development. You have been repeatedly shown in this thread how DNA, through epigenetics,gradients of regulators,etc works to guide development. You have been shown how the same genes are used repeatedly in the process (which dramatically reduces the need for "information").You have willfully ignored all this. Scientists are presented with two hypotheses. One has some evidence (quite a lot actually) and is a an excellent fit with all of the available facts. The second has no evidence at all and answers no questions that the first hypothesis can't answer. When scientists accept (not believe) the first hypothesis over the second they are not acting on "FAITH", they are being reasonable. The first hypothesis is a vastly superior fit with the facts. The burden of proof is on the proponents of the second hypothesis. To give you an analogy; there is no evidence or reason to believe that a supersecret advanced civilization exists under the Antarctic icecap. But nobody has done any "studies" to prove that there isn't one. According to your way of "thinking" we shouldn't prefer the No Hidden Civilization Hypothesis over the Yes Hidden Civilization Hypothesis because the "evidence is inconclusive" (this is stupid by the way).
and there are no studies that validate that NS is capable of causing complex body plans to evolve from simpler ones. If anyone knows of studies that show any of the above please lets talk about them.
Do you seriously believe that a single study can or should be able to do this? What you are asking for would take a fairly large book to do.

jobby · 6 October 2008

To give you an analogy; there is no evidence or reason to believe that a supersecret advanced civilization exists under the Antarctic icecap. But nobody has done any “studies” to prove that there isn’t one.

... of course that is a horrible analogy. we have no reason to believe in this subcap civilization. however we do know that the DNA stores info. and we do no that there must be some minimum of instruction to contruct the human body. these are facts. there are no facts such as these to move us to suppose there is this civilization.

tresmal · 6 October 2008

jobby said: To give you an analogy; there is no evidence or reason to believe that a supersecret advanced civilization exists under the Antarctic icecap. But nobody has done any “studies” to prove that there isn’t one. ... of course that is a horrible analogy. we have no reason to believe in this subcap civilization. however we do know that the DNA stores info. and we do no that there must be some minimum of instruction to contruct the human body. these are facts. there are no facts such as these to move us to suppose there is this civilization.
Not surprisingly, you missed the entire point. The point is is that the subcap civilization and your "dark information" have exactly the same amount of evidence: NO EVIDENCE AT ALL! NONE! PERIOD!

Dan · 6 October 2008

jobby said: You have failed to make a positive impression on us, and that’s the first thing you must do to win us over your your point of view.
jobby now believes he/she is royalty, and is using the "royal we" http://en.wikipedia.org/wiki/Pluralis_majestatis

PvM · 6 October 2008

And again, Bobby's argument is based on his personal ignorance. How does science control independent variables to determine its impacts on the dependent variables? Again, the answer is trivially simple through experiments which involve for instance knock out experiments, careful mutations, replacement of genes with other genes and so on to determine the effect of said genes on the development of the embryo. Another examples is how Kettlewell established support for his bird predation thesis and the change in frequency of the various forms of the Peppered Moth. In other instance, dependent variables cannot be manipulated directly by the investigator but by varying the experiments, such as outlined by Endler in his classic book "Natural Selection in the Wild"

Professor Endler finds that there are a remarkable number of direct demonstrations of selection in a wide variety of animals and plants. The distribution of observed magnitudes of selection in natural populations is surprisingly broad, and it overlaps extensively the range of values found in artificial selection. He argues that the common assumption that selection is usually weak in natural populations is no longer tenable, but that natural selection is only one component of the process of evolution; natural selection can explain the change of frequencies of variants, but not their origins.

Sufficient to say that one need not have to adjust the independent variables yourself to still have a wide range of said variables to conduct one's studies. There are just so many different ways in which science tackles problems related to looking into the past and still being able to perform scientific hypotheses, that I am not surprised that Bobby is not familiar with any of them, after all, they are common approaches to science and Bobby has shown himself to somewhat allergic to educate himself about how science goes about studying evolutionary theory.
jobby said: That the independent variable is the only factor that varies systematically in the experiment; in other words, that the experiment is appropriately controlled ... well of course they cannot push planets around but the point is that the indpendent variable 'varies' and this can be accomplished by measuring the dependent variable when the independent one varies by natural means. OK now show me the experiments in Darwinism where the independent variable changed and how the dependent variable was measured and you will have a true scientific experiment but unfortunately these do not exist. if you know of one please present it so the 'lurkers' will be enlightened.

Dan · 6 October 2008

jobby said: Time for a recap: there are no studies that validate that NS is capable of causing complex body plans to evolve from simpler ones. If anyone knows of studies that show any of the above please lets talk about them.
I've already pointed out that Origin of Species by Charles Darwin shows how natural selection is capable of causing complex body plans to evolve from simpler ones. And yes, I have read all of this book (sixth edition). In response to my making this observation, jobby insulted me and belittled me, but never claimed that I was wrong.

PvM · 6 October 2008

Sure, as tresmal points out, Bobby could be correct but he provides us with no evidence to support his claims while science provides us with much evidence that places doubt on said claims. Can science disprove Bobby's negative? Unlikely, but it can reduce it to a meaningless assertion through hard work.

What does Bobby intend to do to support his claim? Nothing, and that is exactly why ID is doomed to remain similarly without scientific content

Wayne Francis · 6 October 2008

jobby said: Time for a recap: There are no studies that show that 750 MBytes which seems to be about the amont of info in the DNA is enough to construct a human body and there are no studies that validate that NS is capable of causing complex body plans to evolve from simpler ones. If anyone knows of studies that show any of the above please lets talk about them.
Time for a recap. No one cares about the analogy of 750 MBytes to store an encoded version of the human genome besides Hand Jobby thus no one has bothered writing a paper on Hand Jobby's misunderstanding of biological processes and the correlation it has with storing a encoded genome on digital media. AND Hand Jobby pulls out an old debunked creationist argument about complex body plans not being able to evolve because of his inability to, again, understand MET at the level that my son did when he was 5 (granted my son is the top 1% of students but hey even 12 year old children don't have this much of a problem with MET). We know the Hand Jobby doesn't like to read so here is a quick 4 minute video from PBS on the evolution of the eye. http://www.pbs.org/wgbh/evolution/library/01/1/l_011_01.html And if he wants to read http://en.wikipedia.org/wiki/Evolution_of_the_eye which if he spends 2 seconds and looks at is FULLY referenced pointing to multiple papers that describe the evolution of the eye. I'd say that the eye counts as a complex organ. And before Hand Jobby tries to ignore it and asks "Have you read them", Yes Blow Jobby, I have read many papers on the evolution of the eye to include many that are cited in the Wikipedia entry. So IF Hand Jobby wishes to read and discuss, in his own words, why he things some of the peer reviewed papers are faulty by all means. But that would involve him doing more then typing "WRONG!!!" and running away.

tresmal · 6 October 2008

I wish to propose for the reader's favourable consideration a doctrine which may, I fear, appear wildly paradoxical and subversive. The doctrine in question is this: that it is undesirable to believe a proposition when there is no ground whatever for supposing it true. I must of course admit that if such an opinion became common it would completely transform our social life and our political system; since both are at present faultless, this must weigh against it.

[Bertrand Russell, Sceptical Essays

emphasis mine. Just snagged this from Pharyngula's Random Quotes. Posted it here for no particular reason at all. Certainly has nothing to do with anything talked about on this thread, nope nothing at all.


Wayne Francis · 6 October 2008

jobby said: You have failed to make a positive impression on us, and that’s the first thing you must do to win us over your your point of view. ... I am sure your FAITH in Darwinism will never change no matter how cogent the argument or how overwhelming the data. I am here mainly in case some young people are reading this so they will not think that Darwinism has really been proven and hopefully their minds will be free to explore options.
Hand Jobby provides no options beyond invisible pink unicorns following along side all living beings. Everyone should be weary of people, like Hand Jobby, that say that they shouldn't believe something like MET that has no proof against it and only those people's, like Hand Jobby, personal incredulity. Critical thinking is a good skill to have but what Hand Jobby is doing is not Critical thinking. It is denying/ignoring evidence and screaming "you don't know!" Everyone is welcome to challenge any scientific position but come prepared with a well thought out position and be prepared to discuss said position with positive evidence.

Wayne Francis · 6 October 2008

Henry J said: I wonder if somebody should point out that it's more important for the one arguing against the consensus to read the papers, than for the ones who figure experts know their subject better than amateurs who declare themselves to be the arbiters? Henry
Well put.

Dale Husband · 6 October 2008

jobby said: HAVE YOU READ ANY OF THE STUDIES??? ... I am sure your FAITH in Darwinism will never change no matter how cogent the argument or how overwhelming the data. I am here mainly in case some young people are reading this so they will not think that Darwinism has really been proven and hopefully their minds will be free to explore options. Time for a recap: There are no studies that show that 750 MBytes which seems to be about the amont of info in the DNA is enough to construct a human body and there are no studies that validate that NS is capable of causing complex body plans to evolve from simpler ones. If anyone knows of studies that show any of the above please lets talk about them. ... of course that is a horrible analogy. we have no reason to believe in this subcap civilization. however we do know that the DNA stores info. and we do no that there must be some minimum of instruction to contruct the human body. these are facts. there are no facts such as these to move us to suppose there is this civilization.
Lying for Jesus is not really that amusing, jobby. DNA does not store information at all. Information only exists in the human mind that reads it, whether in DNA, in a book....or in a science paper, which you seem incapable of reading, so you keep demanding we do it for you. The 750 MB of data that supposedly is necessary to make a human body is totally bogus. Human bodies are not computer software! And lab experiments showing simpler organic molecules evolving into more complex ones lead to the logical inference that such processes happened in the past. Now, unless you can show that there is some limit to the processes of chemical or biological evolution, there is no reason whatsoever to deny that complex life forms could have evolved from simpler ones. The laws of chemistry and physics, and the scientific method that we use to support and confirm those laws, are the guide for judging all claims in science. Not your standards that only serve your warped interests.

Wayne Francis · 6 October 2008

jobby said: To give you an analogy; there is no evidence or reason to believe that a supersecret advanced civilization exists under the Antarctic icecap. But nobody has done any “studies” to prove that there isn’t one. ... of course that is a horrible analogy. we have no reason to believe in this subcap civilization. however we do know that the DNA stores info. and we do no that there must be some minimum of instruction to contruct the human body. these are facts. there are no facts such as these to move us to suppose there is this civilization.
You miss the point again hand jobby. Analogy is our civilization exists = DNA exists super secret advanced civilization exists under the Antarctic icecap = your needed extra information. The world works just fine without the super secret civilization Development works just fine without your view that more information is needed beyond DNA. There are no facts, your personal incredulity doesn't count, that the DNA doesn't hold enough information to account for hereditary and that the known developmental processes can't account for the development of any living being. Go take your invisible pink unicorn somewhere else Hand Jobby.

jobby · 7 October 2008

Dale Husband:

"DNA does not store information at all."

... even creationists would disagree with that ridiculous statement. Any other posters agree with Dale?

jobby · 7 October 2008

Wayne Francis:

'There are no facts, your personal incredulity doesn’t count, that the DNA doesn’t hold enough information to account for hereditary and that the known developmental processes can’t account for the development of any living being.'

Dale Husband:

'DNA does not store information at all.'

... well who is correct???

jobby · 7 October 2008

Well here we go: they say there is enough info in the DNA to construct a human if one asks: 'Are you sure? Can you prove it?'

We are told we are being 'incredulous'

definition: 'not disposed or willing to believe; unbelieving'

Jeez just a lack of FAITH again!

Stanton · 7 October 2008

jobbyTroll said: Well here we go: they say there is enough info in the DNA to construct a human if one asks: 'Are you sure? Can you prove it?' We are told we are being 'incredulous' definition: 'not disposed or willing to believe; unbelieving' Jeez just a lack of FAITH again!
You were the one who originally made the claim of

The human genome consists of the equivalent of approximately 750 megabytes of data . this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.

And you have never once ever bothered to produce any evidence to support this claim. In fact, when asked to support your claim, you have refused, either trying to shift the burden of providing evidence on to us, or by accusing me of being a liar. That you accuse us of having blind faith for accepting proven and demonstrated science, while trying to convince us of your moronic claims without bothering to provide evidence demonstrates to us over and over again that you are nothing more than a pathetic, moronic hypocrite.

jobby · 7 October 2008

That you accuse us of having blind faith for accepting proven and demonstrated science, while trying to convince us of your moronic claims without bothering to provide evidence demonstrates to us over and over again that you are nothing more than a pathetic, moronic hypocrite.

.... do you assert that it is fact that the DNA has enough information?

..... you disagree with the other poster that there is NO information in the DNA??

... is basically all you can to is name-call?

jobby · 7 October 2008

Whatever happened to Dave Stanton? Did he realize that posting toilet mouth comments on the internet could get him in trouble at his college?

DS · 7 October 2008

I do not respond to pedophiles.

Science Avenger · 7 October 2008

Do I hear 42 pages of garbage?

Dale Husband · 7 October 2008

jobby said: Dale Husband: "DNA does not store information at all." ... even creationists would disagree with that ridiculous statement. Any other posters agree with Dale?
You are quote mining! I also said, "Information only exists in the human mind that reads it..." This would be obvious if you would use basic logic. Are you saying that information can exist if no human mind ever processes it? How can that be?
jobby said: Wayne Francis: 'There are no facts, your personal incredulity doesn’t count, that the DNA doesn’t hold enough information to account for hereditary and that the known developmental processes can’t account for the development of any living being.' Dale Husband: 'DNA does not store information at all.' ... well who is correct???
Both of us, of course. That you are too dumb to realize that is no one's fault but yours. Wayne Francis takes your delusion about DNA and information and plays with it, speaking according to your terms. I just went straight for the truth. A more accurate statement from Wayne Francis would have been, "Jobby, there may indeed be enough DNA sequences in human cells to make a human body and your disbelief about it is irrelvant."

Wayne Francis · 7 October 2008

Hand Jobby has once again ignored that which asked for and we provided.

He chooses to ignore the vast amounts of information known about the evolution of the eye and the genetic processes which both control for its developement and the pathways that where likely to have taken place to progress from a single light sensitive cell to very complex eyes.

Blow Jobby, you are a willfully ignorant liar. A bare, bald-faced, deceptive, deceitful, deliberate liar, with malice aforethought. as Dr Rev Lenny Flank might say.

yes the DNA has enough "information" to code (not computer code Blow Jobby) for hereditary traits within a species via, but not limited to, protein coding genes, regulatory genes. You will not find 1 paper addressing the the full development of a human just like you will not find a paper covering the full history of the universe. Saying DNA isn't enough is just as stupid as saying all the elements above lithium can't be accounted for by stellar processes and there must be some other mechanism needed. This despite the fact that all the evidence we have that points to stellar processes being responsible for forming all the natural elements.

You can yell about some invisible pink unicorn making heavy elements just as much as you can for development of features. No one that understands science will listen to you until you step up...fat chance of that happening. Now avoid the video, article and papers I pointed you. you are a troll and it is clear for all to see that you are a willfully ignorant lying troll.

Dale Husband · 7 October 2008

Watch what happens next: Jobby will go into a frenzy about me not making any sense. Of course, that assumes that common sense, or conventional wisdom, is always right. But that is not necesarily the case. Think about it: If you have a 350 page book on biology that no one ever reads, can you really say there it has information about biology in it? Why? What use is something that no one ever reads? DNA, books and computer programs can PRODUCE information when they are read, but they themselves MUST be read for that information. If you have a book written in Chinese and you read only English, is that book of any use to you? Do you get any information from it? Of course not!

PvM · 7 October 2008

Dale, your use of the term information is troubling.

A common way to look at information is the reduction in Shannon entropy and DNA as such can be shown to contain 'information'. Typically information describes the redundancy, so for instance if a particular gene across many members of the same species contains the same basepairs, it can be shown to contain the max possible information in Shannon sense, of 2 bits per nucleotide.

The problem is to extend the information content to a similar concept in the human body. For that one has to show how much information is contained in the human body, using a similar measure.

As to DNA being insufficient to explain the development of an embryo, there is no evidence supporting this notion and in fact much of embryological research has shown the contrary.

It seems however that not only is jobby unwilling to familiarize himself with the science involved, but he is using his ignorance as an argument in favor of his position.

Such is the scientific vacuity of ID and jobby is a useful example.

Wayne Francis · 7 October 2008

Dale Husband said:
jobby said: Dale Husband: "DNA does not store information at all." ... even creationists would disagree with that ridiculous statement. Any other posters agree with Dale?
You are quote mining! I also said, "Information only exists in the human mind that reads it..." This would be obvious if you would use basic logic. Are you saying that information can exist if no human mind ever processes it? How can that be?
jobby said: Wayne Francis: 'There are no facts, your personal incredulity doesn’t count, that the DNA doesn’t hold enough information to account for hereditary and that the known developmental processes can’t account for the development of any living being.' Dale Husband: 'DNA does not store information at all.' ... well who is correct???
Both of us, of course. That you are too dumb to realize that is no one's fault but yours. Wayne Francis takes your delusion about DNA and information and plays with it, speaking according to your terms. I just went straight for the truth. A more accurate statement from Wayne Francis would have been, "Jobby, there may indeed be enough DNA sequences in human cells to make a human body and your disbelief about it is irrelvant."
For the lurkers it has been pointed out to Hand Jobby before that information means nothing without a sender and receiver and that the quality of the "information" is directly related to the understanding of message by the receiver. Hand Jobby has shown he has no firm grasp on the following topics: Information Theory, Science(of any branch), grammar, spelling, integrity, or morals. He is a troll. Our responses to his stupidity are for the benefit of the lurkers out there. If you are stupid enough to take what he says with zero proof then you lack the critical reasoning skills of a 2 year old that would at least want an answer of "why?". We have provided Blow Jobby with many answers to his questions with him consistently ignoring them or refusing to read them because he doesn't believe that any of us have. But with the magic of the Internet lurkers and easily go through 42 pages of posts and see how Hand Jobby's personal incredulity about genetics leaves his arguments scientifically vacuous and you get to catch him in both blatent lying and "moving the goal post".

Dale Husband · 7 October 2008

Wayne Francis said: For the lurkers it has been pointed out to Hand Jobby before that information means nothing without a sender and receiver and that the quality of the "information" is directly related to the understanding of message by the receiver. Hand Jobby has shown he has no firm grasp on the following topics: Information Theory, Science(of any branch), grammar, spelling, integrity, or morals. He is a troll. Our responses to his stupidity are for the benefit of the lurkers out there. If you are stupid enough to take what he says with zero proof then you lack the critical reasoning skills of a 2 year old that would at least want an answer of "why?". We have provided Blow Jobby with many answers to his questions with him consistently ignoring them or refusing to read them because he doesn't believe that any of us have. But with the magic of the Internet lurkers and easily go through 42 pages of posts and see how Hand Jobby's personal incredulity about genetics leaves his arguments scientifically vacuous and you get to catch him in both blatent lying and "moving the goal post".
Then we are in agreement, Wayne Francis. Jobby, by definition, has no information about the issue at hand because he doesn't read the papers, books and other data sources available. For him, those sources HAVE no information. For us, they do. Thus my point above about information is proven!

Dale Husband · 7 October 2008

I was setting jobby up to blow him away later by proving why we have information about how evolution can work and he does not. Sorry for the confusion. Perhaps it would be better to specify that DNA, books, and other data sources have "potential information", which only becomes "kinetic information" when they are read and understood. What do you think?
PvM said: Dale, your use of the term information is troubling. A common way to look at information is the reduction in Shannon entropy and DNA as such can be shown to contain 'information'. Typically information describes the redundancy, so for instance if a particular gene across many members of the same species contains the same basepairs, it can be shown to contain the max possible information in Shannon sense, of 2 bits per nucleotide. The problem is to extend the information content to a similar concept in the human body. For that one has to show how much information is contained in the human body, using a similar measure. As to DNA being insufficient to explain the development of an embryo, there is no evidence supporting this notion and in fact much of embryological research has shown the contrary. It seems however that not only is jobby unwilling to familiarize himself with the science involved, but he is using his ignorance as an argument in favor of his position. Such is the scientific vacuity of ID and jobby is a useful example.

Robin · 7 October 2008

Wayne Francis said: Our responses to his stupidity are for the benefit of the lurkers out there.
...or merely a fun and entertaining exercise in just articulating a sound answer in a debate/discussion forum. There's nothing wrong, at least in my mind, to answering some questions for the sheer exercise in trying to answer them, even if only for one's own satisfaction that such inanity can be answered rationally.
PvM said: Again jobby shows the scientific vacuity of his position. Well done.
...of course, there's also the occasional satisfaction in just noting when someone is still being dense...

PvM · 7 October 2008

Information is a tough to capture topic and a clear definition can be helpful, however in many cases tracking the amount of information is non-trivial. Problems with DNA is that there appears to be no relationship between organismal complexity and the size of DNA. Adami et al provide a workable definition

To make a case for or against a trend in the evolution of complexity in biological evolution, complexity needs to be both rigorously defined and measurable. A recent information-theoretic (but intuitively evident) definition identifies genomic complexity with the amount of information a sequence stores about its environment.

See also an earlier paper C. Adami, N.J. Cerf Physical complexity of symbolic sequences, Physica D 137 (2000) 62–69 As such DNA can have zero information or its max information, depending on the environment. Science has gone on to outline how information and complexity in the genome can in fact increase under the proposed definition

jobby · 7 October 2008

Think about it: If you have a 350 page book on biology that no one ever reads, can you really say there it has information about biology in it? Why? What use is something that no one ever reads?

.... so you are saying if humans did not exist DNA would not contain any info??

Henry J · 7 October 2008

With 42 pages, you'd think this thread would have the answer to life, the universe, and everything...

PvM · 7 October 2008

I doubt it
jobby said: Think about it: If you have a 350 page book on biology that no one ever reads, can you really say there it has information about biology in it? Why? What use is something that no one ever reads? .... so you are saying if humans did not exist DNA would not contain any info??

tresmal · 7 October 2008

Robin said:
Wayne Francis said: Our responses to his stupidity are for the benefit of the lurkers out there.
...or merely a fun and entertaining exercise in just articulating a sound answer in a debate/discussion forum. There's nothing wrong, at least in my mind, to answering some questions for the sheer exercise in trying to answer them, even if only for one's own satisfaction that such inanity can be answered rationally. ...of course, there's also the occasional satisfaction in just noting when someone is still being dense...
I agree. Jobby is a lost cause but good practice. He is very much like a toy I'm sure they don't make any more. It was basically an inflatable punching bag, usually with a clown painted on it, that was weighted on the bottom so that no matter how hard you hit it it would bounce right back up.

Wayne Francis · 7 October 2008

jobby said: Think about it: If you have a 350 page book on biology that no one ever reads, can you really say there it has information about biology in it? Why? What use is something that no one ever reads? .... so you are saying if humans did not exist DNA would not contain any info??
Hand Jobby, get this through your head. Right now DNA has relatively little "information" for us Humans. Why? We are still learning to "read" it. For the estimated 22,000 protein coding genes there is a HUGE amount of information to the biological processes that use them. It is like saying Schrodinger's cat is dead and alive because no human has observed the decay. I'm not fool enough to think that humans are the only observers in the universe. That cat can observe the decay of an atom too. As we learn about a gene vast amounts of papers get written about it. Explaining in greater and greater detail what that gene does. The gene itself will ALWAYS have much more "information" then all the papers that have been written on it. The problem is spoken/written language is not very efficient in the amount of "information" it can store. Take HBB, this is one of the smallest genes in the human genome. It is a mere 1,604bp long. In your terms this is just 401 bytes. *Sarcasm ON* How can something 401 bytes long know how to bind with 1 other HBB and 2 other HBAs to carry oxygen around the body and release it when the oxygen is needed? Surely, in the tone of Hand Jobby, there isn't enough information there to do this. There needs to be more! *Sarcasm OFF* We know just a single point mutation within within HBB causes the shape of the cell to change in a predictable manner. This means that, again in Hand Jobby's terms, just 2bits of binary data can alter the red blood cell's shape in a predictable manner. According to Hand Jobby there needs to be LOTS of information to describe the shape of something but here is the shape of the cell being altered in just 2 bits. The amount of "Information" humans have written is very large and getting larger as time passes. Yet HBB is only 1604bp or 401bytes. Some how it does everything it needs to just from that size. To boot we are still finding new ways different species are using HBB in processes other then oxygen transport. I'd hope that Hand Jobby would see the errors in his logic by no but I'm a sane person and realize that it will never happen

Dale Husband · 7 October 2008

I love it when one of my predictions comes true!
Dale Husband said: Watch what happens next: Jobby will go into a frenzy about me not making any sense.
jobby said: Think about it: If you have a 350 page book on biology that no one ever reads, can you really say there it has information about biology in it? Why? What use is something that no one ever reads? .... so you are saying if humans did not exist DNA would not contain any info??
No, jobby. DNA still needs to be "read" by RNA strands to make proteins. THAT'S when the information of DNA is made manifest. DNA alone does nothing. Just like a book alone does nothing without a reader. :D

Dale Husband · 7 October 2008

No, jobby. DNA still needs to be "read" by RNA strands to make proteins. THAT'S when the information of DNA is made manifest. DNA alone does nothing. Just like a book alone does nothing without a reader. :D
I guess I should have been more specific in my earlier statements about human minds and information. Ironically, RNA is better at "reading" DNA code than human beings. Just as RNA could not read books, web pages, or science papers. So, jobby, are you claiming to be RNA, and not a human being?

Wayne Francis · 7 October 2008

Wayne Francis said: I'd hope that Hand Jobby would see the errors in his logic by no but I'm a sane person and realize that it will never happen
My fingers where not keeping up with my mind there. That should be the word "now"

Dale Husband · 8 October 2008

Here are all the papers, concepts, and data that jobby has been ignoring and denying all this time. I'm putting them all together on one comment for everyone's convienence. Shall we go through them again?
stevaroni said: The thing is jobby is hung up on is that he's conflating the final product, which can be very complicated, and the process that creates it. THe complexity of the two are not necessarily related. For instance, check out this picture, and tell me how much information is in it. http://upload.wikimedia.org/wikipedia/commons/3/37/Mandel_zoom_14_satellite_julia_island.jpg At first guess, you'd probably say a lot. The image is 2,560 × 1,920 pixels, the full file size is 4.93 MB, it's big even as a jpeg. But even if you said that, you'd still be dramatically underestimating it's complexity, because it's actually infinitely intricate. Complicated, huh? Not really. For those who are unfamiliar with it, it's a function called a "Mandlebrot Set", and it can be created with one equation. That one equation can be expressed in about 30 characters. Now, that's "data compression". So, Jobby, Google "fractal" and learn something. And before you start spouting about the fact that equations need to be executed before you see the results, well, so do genes.
tresmal said: Jobby is fractally wrong.
iml8 said:
fnxtr said: Yeah, that's kind of what I got to wondering: 800Mb of what?
It's basically an "information theory" type Darwin-basher argument, trying to compare the "information" in the genome to that of an OS. The sleight-of-hand is the vague and evasive definition of "information". I could go on here but I've done better elsewhere: http://www.vectorsite.net/tadarwin_24.html#m3 There are formal measures of "information", but they don't really address the issue of what the information DOES. Even restricted to computers the comparisons are dodgy. There are specialized CPUs for performing digital signal processing (DSP) -- they can blow the doors off a Pentium for signal processing tasks, but the Pentium can fly rings around them for general purpose computing. You can run a DSP program on a Pentium, but it will be bigger and slower than one run on a DSP chip (at least one running at the same clock speed). There's a saying in the industry: "There's lies, damn lies, statistics, damn statistics [FOUR OUT OF FIVE DOCTORS RECOMMEND!], and ... benchmarks." Now I suppose we can add "damn benchmarks". White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html
stevaroni said:

well any neutral party reading this could see that my opposition has little but wise cracks

Yeah. Well, just that and 227820 peer reviewed research papers on the subject. (as of this afternoon) http://www.ncbi.nlm.nih.gov/pubmed/
stevaroni said: Oh, and while I'm at it, start with this paper, troll. Darwin's greatest discovery: design without designer. http://www.ncbi.nlm.nih.gov/pubmed/17494753 or this one Darwin's artificial selection as an experiment. http://www.ncbi.nlm.nih.gov/pubmed/16473266 or this one The modern theory of biological evolution: an expanded synthesis. http://www.ncbi.nlm.nih.gov/pubmed/15241603 or this one Endosymbiosis, cell evolution, and speciation. http://www.ncbi.nlm.nih.gov/pubmed/17046345 or this one, an oldie, but a goodie on symbiotic evolution. From extracellular to intracellular: the establishment of mitochondria and chloroplasts. http://www.ncbi.nlm.nih.gov/pubmed/36620 Now, it's your turn troll. Either show me your evidence that 700Mb is not big enough or shut up. (Note, I know he will not actually answer the question, of course, he'll just say the papers are insufficient and change the subject. At this point, I'll just cut and paste my question again, since it's not good to let him play the martyr. Since he'll never answer the question {he can't answer it}, our exchange may get even more tedious than it has been, so I'll apologize in advance, and suggest the moderator simply close this thread.)
PvM said: To understand how science has been expanding its understanding of how genes form networks of interactions, see for starters Notes: Graphical Gaussian Models for Genome Data these gene networks are part of the answer to Bobby's argument from ignorance. Let's see how Bobby deals with science.
PvM said: Let's not confuse Dembski with 'mainstream science'. Why not focus on my claims. Or read some factual materials such as this faq at Caltech Surprise us and engage in an actual conversation based on facts rather than on meaningless one liners. After all, you did claim you are interested in science and data, so why do you have to ignore such science and data when presented to you?
jobby said: The claim that a snowflake has little information content appears to be a common fallacy, ... mainstream science seems to think so. well of course you might not be in step with them.
PvM said: Yes, it will take Bobby some time to come to realize how 'simple' diffusion reaction equations, similar to the ones which 'create' snowflakes, play a role all through biology. In this paper Eshel shows some exquisite formations of bacterial colonies. Look at fig 2.. So how do these bacteria know to form such patterns...
SWT said:
jobby said: There is no code for building a tibia. .... Wrong!...If that were true then the bone would not know how to grow into that shape.
Wow! What a bone-headed comment!
PvM said: Okay, I feel somewhat sorry for our friend so let's see if we can guide him towards a better understanding. Okay a combination of limb development and small selective processes

Writing in this week’s Proceedings of the National Academy of Sciences (PNAS), Hans Thewissen and his colleagues report that ancient whales--four-footed land animals not unlike large modern dogs--evolved into graceful, streamlined swimmers through a series of small genetic changes during the whales’ embryonic development.

For dolphins

Thewissen and his colleagues began by exploring the embryonic development of whales’ cousins, the dolphins. These creatures are intriguing because for a brief time during development they do sprout hind limbs, which quickly vanish again as the embryos reach the second month in a gestation period that lasts about 12 months. Why? In most mammals, explains Thewissen, "a series of genes is at work at different times, delicately interacting to form a limb with muscles, bones, and skin. The genes are similar to the runners in a complex relay race, where a new runner cannot start without receiving a sign from a previous runner." In dolphins, however, at least one of the genes drops out early in the race, disrupting the genes that were about to follow it. That causes the entire relay to collapse, ultimately leading to the regression of the animals’ hind limbs. By analyzing dolphin embryos, Thewissen showed that the dropout is a gene called "Sonic Hedgehog," which is important at several stages of limb formation. "That’s why dolphins lose their ’legs,’" he says.

for whales

In whales, however, the story is more complex. Between 41 million and 50 million years ago, whales’ hind limbs did shrink greatly as the former land animals began a return to the sea. But their legs showed no change in the basic arrangement and number of bones, which proved that Sonic Hedgehog was still functioning. Its loss must have come later. In short, "the dramatic loss of Sonic Hedgehog expression was not the genetic change that drove hind limb loss in whales," Lane said. Instead, Thewissen and his colleagues conclude, whales’ hind limbs regressed over millions of years via "Darwinian microevolution": a step-by-step process occurring through small changes in a number of genes relatively late in development.

David Stanton said: I once made a picture of a flower with a spirograph. It was really cool. Was the information for the structure of the flower in the genome of the spirograph?
Wayne Francis said:
jobby said: The same way a loaf of bread “knows” to be rectangular: because there’s physical impediments (a pan), raw material limitations .... so where is the mold for instance for the pelvis??
The "mold" is the surrounding environment for lurkers, as Hand Jobby will not read or understand the following abstract as he has proven many times before.
Key Interaction Elucidated in Fetal Bone Development As a human embryo forms, most of its bones begin as cartilage and are converted into bone. This developmental transition is orchestrated by a complex network of proteins known as transcription factors, which activate the appropriate genes at the appropriate time and duration to carry out the ossification process. One of the most-studied of these transcription factors is called Runx2. Without its transcriptional oversight in the ossification process, cartilage-producing chondrocytes will not fully mature, nor will bone-producing osteoblasts differentiate. What has intrigued scientists is Runx2 is expressed in fetal progenitor cells as early as embryonic day 10, or well before its curtain call to orchestrate chondrocyte and osteoblast differentiation. This has led some to wonder if during early skeletal development other transcription factors inhibit the activity of Runx2 and hold it in check until needed. In the December 12 issue of the Proceedings of the National Academy of Sciences, NIDCR grantees and their colleagues identify this inhibitory transcription factor as Sox9. They show in laboratory and animal studies that Sox9 directly interacts with Runx2 and dominantly represses its activity. The scientists also show that this repression likely takes place early on as precursor cells commit to cartilage-producing lineages and later during the development of cartilage. Further delineating the Sox9/Runx2 interaction will help to explain the biochemical underpinnings of several human skeletal malformations and will be useful in learning to engineer replacement bone.
Going over Hand Jobby's comments you have to come to the conclusion that he thinks that to build anything you would need a plan bigger then what is being built. He expect simple and easy to understand instructions which DNA is not. DNA has the advantage that one set of of genes and pathways can be used to develop things, like a tibia, across multiple species. The same genes that effect the development of your fingers is the same genes that effect the development of a birds wings as they do a fishes fins. Going back to conjoined twins Hand Jobby's statements would say that the "Plan" was for the twins to be conjoined from the start. This is not at all what happens. What happens is the area where the twins are attached the signals guiding normal development are influenced by the adjoining twins development and the cells go down a pathway that merges the 2 twins. In basic terms you might say Stem Cell A would normally form into Cell B given the normal development because of the cells around it. Introduce the twin's development into the picture and Stem Cell A gets different signals then it would if the twin was not there. This may cause the stem cells to develop into different cells then they normally would based on their position. In theory, I have never heard of this happening but it is possible, identical triplets could be born with 2 of them conjoined and one not. All have the exact same DNA. The conjoined pair just had a situation where they where not properly separated enough during the early developmental stages. Hand Jobby would have you believe there where 2 separate plans for the 3 identical triplets because 2 of them where born conjoined. Hand Jobby, where did the "Plan" for this skeleton come from? http://www.mae.nw.ru/images/floor/2_XIII_01b.jpg Look at the rib cage and pelvis. The twins development would have tried to proceed as normal but when a cell developed and was close to cells of the conjoined twin they adapted based on the signals around them.
PvM said: I ran across an fascinating post by PZ Zygotic genes which shows how patterning happens as well as reminds us of the relevance of 'maternal genes'. So in fact, this is one example of where not all information is stored in the DNA of the zygote, but rather comes from the mother.
PvM said: An example of

Each of the roughly 800 ommatidia in the compound eyes of fruit flies has a basically fixed number of cells that are programmed, or patterned, by a reaction-diffusion-like activation-inhibition system. Each has about 20 cells of seven different types,including eight photoreceptor cells,seven of which are arranged hexagon-like around the other(known as R8); six surrounding accessory cells; and four lens-generating cone cells.The eye develops from an imaginal disk of about 20,000 cells. The cells in the eye imaginal disk are apparently equivalent and equipotent (e.g., all expressing the Eyeless/Pax6 TF).These cells are induced to form ommatidia by a sweep of activation-inhibition activity induced by an indentation called the morphogenetic furrow that moves wavelike from posterior to anterior across the disk.

Weiss, Genetics and the Logic of Evolution p 234 See also the role of calcium in Calcium at Fertilization and in Early Development and Organization of early development by calcium patterns
PvM said: Show that the information content in the human cannot be accounted for by the DNA content of the human. Show that in the formation of an embryo, additional sources of information are used. If your argument is that 3 billion base pairs with 1.5% of them expressing proteins and an unknown quantity involved as regulatory elements or expressed as RNA is insufficient then you need to show that the detailed embryological experiments which have, in case of C Elegans, tracked the fate of every single cell, and is showing how the genetic networks affect said fate, repeatably amongst embryos is insufficient. I understand your reluctance to look at the actual evidence which shows that it is the combination of proteins, and their local gradients, as well as the boundary conditions and laws of physics (and chemistry) which all interact. Let me attempt to show you a fascinating example about hox genes In Drosophila, "Christiane Nüsslein-Volhard and Eric F. Wieschaus identified and classified 15 genes of key importance in determining the body plan and the formation of body segments of the fruit fly Drosophila melanogaster. Edward B. Lewis studied the next step - homeotic genes that govern the development of a larval segment into a specific body segment. " This information can be easily accessed from Wikipedia. Only 15 genes, determine the body plan and body segmentation of the fruit fly. How could this possibly be? Let's look at the details It all starts with maternal genes which express bicoid and nanos Bicoid is the interesting gene as it forms a gradient along the embryo, determining the lengthwise axis of the body. Hunchback is a zygotic gene, expressed by the embryo, not the mother, and is regulated by Bicoid, and thus matches the gradient established by bicoid. But what about the gap genes, such as Kruepel, Giant and Knirps, how do they know how to from stripes across the embryo? Simple, their expression is tightly coupled to a particular range in the value of hunchback. For Kruepel see this graph which shows how the gene is expressed only when the range of Hunchback is within a small window. Of course, all these genes are not only regulated by Hunchback but also by eachother, turning on or off, amplifying or supressing, causing an interesting pattern to emerge. The gap genes in turn regulate pair genes which form the beautiful striped pattern. So now we have gone from bicoid, a maternal gene product, to a striped pattern which describes the various body segments that will develop. Let's have a look at a gene network diagram As PZ explain, "The pair rule genes are numerous, and also interact with one another, and will in turn regulate yet another level of the hierarchy, the segment polarity genes. The segment polarity genes are turned in in every segment, within specific subregions of the segment. Years of tracing these interactions now allows us to assemble diagrams of the regulatory cascade involved that look like this, where arrows indicate that a gene activates another, and bars indicate that it inhibits it" Read it all at Zygotic genes For C elegans and Drosophila, these networks are best described due to their history. From there we can learn and expand. I showed you a reference of the vulva formation in C elegans, have you looked at the reference yet? The fascinating facts are that these hox genes are 'well conserved' across life, showing expansion, and they are all expressed in similar fashion across life. Still with me?
jobby said:
PvM said: Yes, his argument that the difference between a human and a chimp is 14Mbytes and finds this incredible suggests that Jobby's common 'scientific argument' is one of personal incredulity due to ignorance of science. Fascinating but in the end, doomed to remain as vacuous as its foundation, Intelligent Design. For that we should thank Bobby as he continues to underline that ID is not a scientifically relevant position and in fact relies on ignorance of science to make 'claims' that 'well heck I could not possibly understand how this could be the case'. When people attempt to clarify the ignorance, the subject refuses any attempt to educate. In order to present a scientific argument Bobby has to show that the information content in the genome (which he guestimates to be 750mb), is at odds with the information content of the human body (which he claims is complex but refuses to estimate). So far there has been no evidence of a conflict and much evidence of the contrary and yet, Bobby's argument? Are you sure... Science is never 100% sure, but its explanations surely beat the ignorance approach chosen by Bobby. And for what reason?
Show me how to falsify this hypothesis: The 750 MB of info in the human DNA is enough to construct a human.
PvM said: Sure, much more detail is needed to work out the fate of the individual segments, what I am showing is how a cascade of hierarchical activation of gene networks sets in motion a process which appears to be in no need of additional 'mythical' information. And for good reasons, after all many embryos are quite well protected from their environments. But let's explore further I mentioned bicoid and the gap genes "Acting as a transcription factor, Bicoid can activate a number of downstream gap genes, including hunchback, knirps, giant, and Krüppel, whose products cross-react in a complex and mainly repressive interaction network to modulate each other's expression (reviewed in [37]; modelled in [45,46])." 37 Rivera-Pomar R, Jäckle H. From gradients to stripes in Drosophila embryogenesis: filling in the gaps. Trends Genet. 1996 Nov;12(11):478-83.

Pattern formation along the anterior-posterior axis of the Drosophila embryo is organized by asymmetrically distributed maternal transcription factors. They initiate a cascade of spatially restricted and interacting zygotic gene activities that provide a molecular blueprint of the larval body at blastoderm stage. The key players in the pattern forming process have been identified. Recent progress has begun to reveal the mechanisms by which coherent positional information of maternal origin becomes transferred into serially repeated zygotic gene expression domains reflecting the metameric body plan of the larva.

45 Jaeger J, Blagov M, Kosman D, Kozlov KN, Manu , Myasnikova E, Surkova S, Vanario-Alonso CE, Samsonova M, Sharp DH, Reinitz J., " Dynamical analysis of regulatory interactions in the gap gene system of Drosophila melanogaster." Genetics. 2004 Aug;167(4):1721-37.

Genetic studies have revealed that segment determination in Drosophila melanogaster is based on hierarchical regulatory interactions among maternal coordinate and zygotic segmentation genes. The gap gene system constitutes the most upstream zygotic layer of this regulatory hierarchy, responsible for the initial interpretation of positional information encoded by maternal gradients. We present a detailed analysis of regulatory interactions involved in gap gene regulation based on gap gene circuits, which are mathematical gene network models used to infer regulatory interactions from quantitative gene expression data. Our models reproduce gap gene expression at high accuracy and temporal resolution. Regulatory interactions found in gap gene circuits provide consistent and sufficient mechanisms for gap gene expression, which largely agree with mechanisms previously inferred from qualitative studies of mutant gene expression patterns. Our models predict activation of Kr by Cad and clarify several other regulatory interactions. Our analysis suggests a central role for repressive feedback loops between complementary gap genes. We observe that repressive interactions among overlapping gap genes show anteroposterior asymmetry with posterior dominance. Finally, our models suggest a correlation between timing of gap domain boundary formation and regulatory contributions from the terminal maternal system

46 Sánchez L, Thieffry D. " A logical analysis of the Drosophila gap-gene system." J Theor Biol. 2001 Jul 21;211(2):115-41. See also erratum in: J Theor Biol 2001 Sep 7;212(1):127.

This manuscript focuses on the formal analysis of the gap-gene network involved in Drosophila segmentation. The gap genes are expressed in defined domains along the anterior-posterior axis of the embryo, as a response to asymmetric maternal information in the oocyte. Though many of the individual interactions among maternal and gap genes are reasonably well understood, we still lack a thorough understanding of the dynamic behavior of the system as a whole. Based on a generalized logical formalization, the present analysis leads to the delineation of: (1) the minimal number of distinct, qualitative, functional levels associated with each of the key regulatory factors (the three maternal Bcd, Hb and Cad products, and the four gap Gt, Hb, Kr and Kni products); (2) the most crucial interactions and regulatory circuits of the earliest stages of the segmentation process; (3) the ordering of different regulatory interactions governed by each of these products according to corresponding concentration scales; and (4) the role of gap-gene cross-interactions in the transformation of graded maternal information into discrete gap-gene expression domains. The proposed model allows not only the qualitative reproduction of the patterns of gene expression characterized experimentally, but also the simulation and prediction of single and multiple mutant phenotypes.

jobby said: In Drosophila, “Christiane Nüsslein-Volhard and Eric F. Wieschaus identified and classified 15 genes of key importance in determining the body plan and the formation of body segments of the fruit fly Drosophila melanogaster. Edward B. Lewis studied the next step - homeotic genes that govern the development of a larval segment into a specific body segment. “ This information can be easily accessed from Wikipedia. Only 15 genes, determine the body plan and body segmentation of the fruit fly. How could this possibly be? .... read more carefully 15 genes determine the body segments. not the actually details of those segments
Where in these processes do you see a lack of genetic information? If there were such gaps, how would you intend to explain this? 1) external inflow of information across fetal boundaries? 2) internal information redistributed 3) unknown processes yet to be determine? Share with us your thoughts as we work our way through how embryos develop. Perhaps you can provide us with an estimate of the amount of information the was used to reach this state and the amount of information actually needed to get to this stage? After all, you seem to suggest there exists a problem, it's time to identify said problem. It's easy to make negative claims, especially when based on ignorance, now let's take a scientific approach. After all, given your stated interest in such a route, I assume you are able and willing to take the challenge to its next level? Advise me also when you have your estimates of information content of the human body available. We are still waiting patiently
PvM said: The following website at the Max Planck Institute for developmental biology outlines the relevance. The basic model of patterning was predicted before the biochemical details were available and the data ended up largely supporting the original model, however the model itself generates additional requirements and predictions about how polarity is transmitted and more. Actually, somewhat ironically, the patterning of stripes is in this case not a Turing pattern. You remember Turing who pointed out that reaction diffusion models away from equilibrium can form patterns? The wave like patterns were indeed suggestive of such a model, which science found, in this case to be flawed. The site provides links to three pdf papers which outline the basics. Still with us?
David Stanton said: This just in, I have found the reference tht hand jobby keeps demanding: U. R. A. Dolt et al. (2008) Human genome size and human development. Journal of Metaphysics 1(6):660-666. From the Abstract: We performed in vitro fertilization under normal conditions as a control. We also perfored an identical experiment inside a stasis field specifically designed to prevent the entry of any information from any outside source, natural or supernatural. The developmental rates were identical between the two treatments and there was no statistically significant difference in mortality rates. We conclude that the amount of information in a diploid human genome is sufficient to generate a human individual without the need for any further information from any other source. From the Future Research section: We are planning to convert the information in the human genome into ASCII code and attempt to generate a human being using the information is this form. Preliminary results suggest that this approach will be unproductive.
Robin said:
jobby said: “MB” above refers to “Megabases” not “Megabytes”, beandip. dummie a megabase is roughly equivalent to a megabyte. look it up dummie.
False, beandip. Megabase From Wikipedia, the free encyclopedia Jump to: navigation, search A megabase (Mb) is a unit of length for DNA fragments, equal to 1 million nucleotides. In the human genome, one megabase is roughly equivalent to one centimorgan (cM) or 1 million base pairs (bps). When the Human Genome Project notes that: "One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space." They are talking about the computer storage space they need to store all the genetic information they have mapped out not the amount of information contained in the genome itself, beandip: "How big is the human genome? The human genome is made up of DNA, which has four different chemical building blocks. These are called bases and abbreviated A, T, C, and G. In the human genome, about 3 billion bases are arranged along the chromosomes in a particular order for each unique individual. To get an idea of the size of the human genome present in each of our cells, consider the following analogy: If the DNA sequence of the human genome were compiled in books, the equivalent of 200 volumes the size of a Manhattan telephone book (at 1000 pages each) would be needed to hold it all. It would take about 9.5 years to read out loud (without stopping) the 3 billion bases in a person's genome sequence. This is calculated on a reading rate of 10 bases per second, equaling 600 bases/minute, 36,000 bases/hour, 864,000 bases/day, 315,360,000 bases/year. Storing all this information is a great challenge to computer experts known as bioinformatics specialists. One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space. Since the human genome is 3 billion base pairs long, 3 gigabytes of computer data storage space are needed to store the entire genome. This includes nucleotide sequence data only and does not include data annotations and other information that can be associated with sequence data. As time goes on, more annotations will be entered as a result of laboratory findings, literature searches, data analyses, personal communications, automated data-analysis programs, and auto annotators. These annotations associated with the sequence data will likely dwarf the amount of storage space actually taken up by the initial 3 billion nucleotide sequence. Of course, that's not much of a surprise because the sequence is merely one starting point for much deeper biological understanding!" http://www.ornl.gov/sci/techresources/Human_Genome/faq/faqs1.shtml Once again, you are wrong beandip.
PvM said: Oh man, I underestimated you level of knowledge when I assumed a basic understanding of embryology. I apologize. Let me go back to the birds and the bees first...Sigh... The answer, in a few words is, that the cell really does not 'know' but rather that the pattern emerges to hierarchical cascades of modular events in which proteins are expressed, interact with other proteins, and are shaped by the laws of chemistry and physics. In the beginning all cells are totipotent (I guess omnipotent was too confusing a term) and they really do not know their future, and yet, especially in lower organisms, the fate map of every single cell can be determined and is predictable once established. The fate is determine through the unraveling of said hierarchical gene expressions, the interactions, feedbacks etc. Well, now I repeat myself. So how does cell 'x' knows to become a bone cell? Because his neighbor tells him so. How does the neighbor 'know', it all goes back to an unfolding of actions, leading to what is more commonly described by the term 'emergence'. Nothing mythical but much is determined by local gradients, local boundaries, local chemistry. There is no single DNA which necessarily tells a cell. You are destined to become 'x'. And yet when the cascades unfold, the outcome is quite predictable. Do you own any textbooks on embryology? What did you do with the links on bicoid and drosophila or c elegans and the vulva development? I could show you how science has unraveld the eye formation on drosophila, would that be educational and worth my effort? Note that much of this knowledge I have yet to acquire, although I have read the various review papers which have outlined this fascinating story of research, experiment, hypothesis forming. Would you be interested to explore such a concept together? What do you say...
jobby said: What I am showing here is how nails not only show a fascinating example of evolution, but also show how the genes involved are reused. In other words, your guestimates of information content, which are based on ‘storage requirements’ are flawed since they fail to incorporate 1. multiple splicing 2. multiple re-use of the same protein pathways. .... when a human sperm unites with a human egg how does that cell know to become a human??
Henry J said:

A better statement is that reptiles and humans share common ancestor not reptiles became humans.

The Tree-of-Life page http://tolweb.org/Amniota refers to the clade containing reptiles and mammals as amniota, and shows reptilia and synapsida (which includes mammals) as separate branches. So not everybody regards early amniotes as already being reptiles, though I suppose it's likely that some label them as such. Henry
David Stanton said: For anyone who is really interested in drosophila wing development, a quick google search turns up 187,000 references. The very first hit contains the following references: Aegerter-Wilmsen, T., Aegerter, C. M., Hafen, E. and Basler, K. (2007). Model for the regulation of size in the wing imaginal disc of Drosophila. Mech. Dev. 124(4): 318-26. PubMed citation: 17293093 Butler, M. J., et al. (2003). Discovery of genes with highly restricted expression patterns in the Drosophila wing disc using DNA oligonucleotide microarrays. Development 130: 659-670. 12505997 Campbell, G., Weaver, T. and Tomlinson, A. (1993). Axis specification in the developing Drosophila appendage: The role of wingless, decapentaplegtic and the homeobox gene aristaless. Cell 74: 1113-1123. 8104704 Cohen, B., Simcox, A.A. and Cohen, S.M. (1993). Allocation of the thoracic imaginal primordia in the Drosophila embryo. Development 117: 597-608. 8330530 Fuse, N., Hirose, S. and Hayashi, S. (1996). Determination of wing cell fate by the escargot and snail genes in Drosophila. Development 122: 1059-67 Kiger, J. A. Jr., Natzle, J. E., Kimbrell, D. A., Paddy, M. R., Kleinhesselink, K. and Green. M. M. (2007). Tissue remodeling during maturation of the Drosophila wing. Dev. Biol. 301(1): 178-91. Medline abstract: 16962574 Ren, N., Zhu, C., Lee, H. and Adler, P. N. (2005). Gene expression during Drosophila wing morphogenesis and differentiation. Genetics [Epub ahead of print]. 15998724 Sturtevant, M. A. and Bier, E. (1995). Analysis of the genetic hierarchy guiding wing vein development in Drosophila. Development 121: 785-801. 7720583 I know that hand jobby will be fascinated by these studies. I have FAITH that he will read all of these papers.
DaveH said:
jobby said: ... they do not know how it generates the shape of the wing
I think I get it now. PvM (I think, I'm not trawling back through all these posts!) hit the nail on the head. jobbie simply does not get emergence. At all. It seems to scare him, and he thinks only magic can explain it. Hence the above quote and "how does a zygote know to become a human". Also the fear of accepting computer simulations from a couple of threads back. "Simulating bird-flocking behaviour from a couple of simple rules? NOOOO! I refuse to grasp it! My special, secret invisible hand of information moves each bird to its individual place in the flock!" Try this jobbie: http://en.wikipedia.org/wiki/Emergence
The concept has been in use since at least the time of Aristotle.[1] John Stuart Mill[2] and Julian Huxley[3] are just some of the historic luminaries who have written on the concept.
Not scary, or freaky, honestly. DaveH
David Stanton said: Sorry hand jobby. I didn't mean to offend you. It's just that, if you use made up names and different made up names, then everyone is going to make fun of them. If you were not such a coward and used your real name, or if you at least chose to obey the rules and used just one name, then maybe people wouldn't make fun of you. Otherwise you are being disrespectful in your dealings with people here so you can't really expect them to treat you with respect now can you? As for your request, I recommend that you start with the Ren et. al. paper: Genetics (2005) 171(2):625-38 However, this is just one of over a million papers on this topic, If you expect to find all of the answers in just one paper then you are just fooling yourself. That is why you must become an expert in a field and become familiar with the literature before anyone is going to take any of your unsubstantiated claims seriously. Here, I'll help to get you started. From the abstract of the paper: The simple cellular composition and array of distally pointing hairs has made the Drosophila wing a favored system for studying planar polarity and the coordination of cellular and tissue level morphogenesis. We carried out a gene expression screen to identify candidate genes that functioned in wing and wing hair morphogenesis. Pupal wing RNA was isolated from tissue prior to, during, and after hair growth and used to probe Affymetrix Drosophila gene chips. We identified 435 genes whose expression changed at least fivefold during this period and 1335 whose expression changed at least twofold. As a functional validation we chose 10 genes where genetic reagents existed but where there was little or no evidence for a wing phenotype. New phenotypes were found for 9 of these genes, providing functional validation for the collection of identified genes. Among the phenotypes seen were a delay in hair initiation, defects in hair maturation, defects in cuticle formation and pigmentation, and abnormal wing hair polarity. The collection of identified genes should be a valuable data set for future studies on hair and bristle morphogenesis, cuticle synthesis, and planar polarity.
David Stanton said: Here is an oldy but a goody: Williams, Bell and Carroll (1991) Control of Drosophila wing and haltere development by the nuclear vestigial gene product. Genes and Development 5:2481-2495. After you are done reading the first eight papers I recommended you can move on to this one. I'm sure you will find a paper that convinces you that someone understands fruti fly development eventually. By the way, I warned you guys that this troll would argue both sides of an argument. Apparently it doesn't think that anyone will notice when it conradicts itself.
David Stanton said: Hand jobby wrote: "The problem is that those studies although in the right general direction really do not answer the question I asked. The opposition needs to state in their own words how those studies back up their positions. I have never seen them do that." Once again hand jobby, you have shown no evidence whatsoever that you have even attempted to actually read the paper, even though I supplied you with the entire abstract. You said you would read it. You said you wanted to discuss it. Well...? I told you that the answer would not be contained completely in one paper. But, if you won't read even one paper then how will you ever know if the answer is there or not? OK, in my own words. The papers show that cascades of gene expression are sufficient to produce the wing of a fruit fly. The references I cited come from a web site that describes most of the important proceeees involved: http://www.sdbonline.org/fly/aimorph/wing.htm The site lists over 200 proteins that are involved in wing morphogenesis and describes in detail how their expression is regulated. The point is that every one of the proteins is coded for in the fly genome and is regulated by other genes in the fly genome. There is no need for any other information at all, period. And before you start ranting that there would not be enough genes to make the rest of the fly, you must understand that many of these genes are also important in producing other structures as well. You see Bobby, (if that is your real name), proteins are not "merely bricks". They also regualte developmental pathways and catalyze chemical reactions. If you knew anything at all about biology you would understand this basic concept. Now you worthless sack of crap, one last time just to be fair, do you have any evidence that more information is required or not? If not, then demanding it of others is simply insane. Read the papers or not, no one really cares. But you can't claim that there is not evidence just because you are too stubborn to look at it or too stupid to understand it. When you are done whining about development, there is a stack of papers on the evolution of the immune system that you really should read. That was the original topic of this thread, 1200 comments ago.
PvM said: Now back to real science

Growth and patterning during fly wing development are mediated by signaling from the dorsoventral (DV) organizer. Interactions between dorsal and ventral cells of the wing pouch set up the organizer by activating Notch (N) at the DV boundary (Diaz-Benjumea and Cohen, 1993Go; Diaz-Benjumea and Cohen, 1995Go; Williams et al., 1994Go; Irvine and Wieschaus, 1994Go; Kim et al., 1995Go; de Celis et al., 1996bGo). N, in turn, activates Wingless (Wg), Cut (Ct) and Vestigial (Vg) at the DV boundary (Couso et al., 1995Go; Kim et al., 1995Go; Rulifson and Blair, 1995Go; Kim et al., 1996Go; Neumann and Cohen, 1996Go). Wg is known to diffuse to non-DV cells from the DV boundary to act as a morphogen (Zecca et al., 1996Go; Neumann and Cohen, 1997Go). High levels of Wg are required for activating Achaete (Ac), whereas moderate levels are sufficient to activate Distal-less (Dll) and low levels to activate Vg (Neumann and Cohen, 1997Go). Thus, Vg is expressed in both DV and non-DV cells. It has been shown that two different promoters regulate Vg expression in DV and non-DV cells (Kim et al., 1996Go). They are vg-boundary enhancer (vg-BE) and vg-quadrant enhancer (vg-QE).

and

The halteres and wings of Drosophila are homologous thoracic appendages, which share common positional information provided by signaling pathways. The activity in the haltere discs of the Ultrabithorax (Ubx) Hox gene establishes the differences between these structures, their different size being an obvious one. We show here that Ubx regulates the activity of the Decapentaplegic (Dpp) signaling pathway at different levels, and that this regulation is instrumental in establishing the size difference. Ubx downregulates dpp transcription and reduces Dpp diffusion by repressing the expression of master of thick veins and division abnormally delayed and by increasing the levels of thick veins, one of the Dpp receptors. Our results suggest that modulation in Dpp expression and spread accounts, in part, for the different size of halteres and wings.

Remind us again how ID explains these? Or Jobby? Or is his response going to be "I could not possibly imagine". Remember how he still owes us an estimate of the information content of humans. Another lost battle it seems...

Wayne Francis · 8 October 2008

Dale Husband said: Here are all the papers, concepts, and data that jobby has been ignoring and denying all this time. I'm putting them all together on one comment for everyone's convienence. Shall we go through them again? ...Removed for space saving...
Nice work Dale. Let me guess what Hand Jobby's response will be. Hell I'll use his own words.
jobby said: WOW!! How much time did you spend on constructing that post? I certainly would not waste that much time on it. Doing a quip here and there is enough for me. I have a lot more important things to do. Quote mining me really is a slimy tactic.
Hand Jobby has more important things to do then read things he's asked proof for. Then he'll turn around and claim he never asked for any of these papers. Hell I've even tried to make it easy for him and provided him links to video feeds to clear up his self induced ignorant rants. Going against the accepted dogma is fine IF you have evidence that the existing dogma is wrong. Hand Jobby's evidence is his personal incredulity.

Dale Husband · 8 October 2008

Thanks. It took me nearly an hour to track down all the references above, because I myself was wanting to have easy access to them all. I even suggested to PvM that he do it. I guess he didn't notice my advice, or thought the effort not worthwhile. Of course, jobby won't care, but those who are latecomers to this galaxy sized slugfest are entitled to see what the fuss is all about. Now they will know just how stupid jobby is.
Wayne Francis said:
Dale Husband said: Here are all the papers, concepts, and data that jobby has been ignoring and denying all this time. I'm putting them all together on one comment for everyone's convienence. Shall we go through them again? ...Removed for space saving...
Nice work Dale. Let me guess what Hand Jobby's response will be. Hell I'll use his own words.
jobby said: WOW!! How much time did you spend on constructing that post? I certainly would not waste that much time on it. Doing a quip here and there is enough for me. I have a lot more important things to do. Quote mining me really is a slimy tactic.
Hand Jobby has more important things to do then read things he's asked proof for. Then he'll turn around and claim he never asked for any of these papers. Hell I've even tried to make it easy for him and provided him links to video feeds to clear up his self induced ignorant rants. Going against the accepted dogma is fine IF you have evidence that the existing dogma is wrong. Hand Jobby's evidence is his personal incredulity.

jobby · 8 October 2008

Going against the accepted dogma is fine IF you have evidence that the existing dogma is wrong. Hand Jobby’s evidence is his personal incredulity.

... exactly what is the 'dogma' you are referring to?

jobby · 8 October 2008

Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”.

... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.

Robin · 8 October 2008

tresmal said:
Robin said:
Wayne Francis said: Our responses to his stupidity are for the benefit of the lurkers out there.
...or merely a fun and entertaining exercise in just articulating a sound answer in a debate/discussion forum. There's nothing wrong, at least in my mind, to answering some questions for the sheer exercise in trying to answer them, even if only for one's own satisfaction that such inanity can be answered rationally. ...of course, there's also the occasional satisfaction in just noting when someone is still being dense...
I agree. Jobby is a lost cause but good practice. He is very much like a toy I'm sure they don't make any more. It was basically an inflatable punching bag, usually with a clown painted on it, that was weighted on the bottom so that no matter how hard you hit it it would bounce right back up.
...just gotta know where to look :-) http://www.amazon.com/Rocket-USA-Bozo-Bop-Bag/dp/B00067TAWG/ref=pd_bbs_1?ie=UTF8&s=toys-and-games&qid=1223471682&sr=8-1

DS · 8 October 2008

And so, as the last unmoderated thread sinks slowly into the sunset, we bid a not so fond farewell to the troll of many names. Segregated from decent society, it foolishly tries to convince others that willful ignorance is the key to happiness. It sits alone at a library computer terminal, desperately trying to suppress it's deviant sexual urges, all the while ignoring the volumes of books and journals around it. In a vain attempt to appear coherent, it substitutes insults, personal attacks and impotent threats as for evidence and logic.

Of course no sane person would be fooled by the nonsensical and unsubstantiated claims of this raving lunatic. It's lack of social skills and it's almost pathological reliance on poor grammar, coupled with it's inability to understand even a single scientific reference, are all the evidence that anyone requires in order to conclude that it's delusional approach to reality is as hopeless as it is misguided. I guess it's truncated genome just didn't have enough information to form a fully functional brain.

Thanks to Dale for the compilation.

Wayne Francis · 8 October 2008

jobby said: Going against the accepted dogma is fine IF you have evidence that the existing dogma is wrong. Hand Jobby’s evidence is his personal incredulity. ... exactly what is the 'dogma' you are referring to?
Your dogma that DNA can't account for developmental process within an organism. You really aren't very bright are you. We stand against your dogma, your personal incredulity, your willful ignorancy.

Kevin B · 8 October 2008

tresmal said: I agree. Jobby is a lost cause but good practice. He is very much like a toy I'm sure they don't make any more. It was basically an inflatable punching bag, usually with a clown painted on it, that was weighted on the bottom so that no matter how hard you hit it it would bounce right back up.
I keep thinking of the "Eliza" AI program, which would respond to input sentences by parsing out a phrase and batting it back as a question.

Dale Husband · 8 October 2008

jobby said: Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”. ... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.
Why don't you dig a bit deeper, jobby? If you cannot read science papers that explain what you want to know, why are you here?

jobby · 8 October 2008

If you cannot read science papers that explain what you want to know, why are you here?

... it did not explain how the shapes are formed. Did YOU even read what you pasted here???

jobby · 8 October 2008

Your dogma that DNA can’t account for developmental process within an organism. You really aren’t very bright are you.

... never said it couldnt! Please read more carefully.

jobby · 8 October 2008

Well Dave Stanton, you are going to be in for some surprises soon!

jobby · 8 October 2008

Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”.

... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.

Henry J · 8 October 2008

of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed.

Another mystery is how somebody could type that without realizing that the first part of it is the answer to the implied question in the second part.

fnxtr · 8 October 2008

jobby said: Well Dave Stanton, you are going to be in for some surprises soon!
Yeah! Just wait until all the research from the Top Secret ID Sciency-Type-Stuff Bunker is released! Boy you're in trouble now!

DS · 8 October 2008

More impotent threats from our mentally challenged troll.

Take a good look ladies and gentlemen, these are the depths of moral depravity to which one can stoop. Completely unable to provide any evidence for his ludicrous claims, the trool of many names proceeds to threaten in a vain attempt to deflect attention away from the fact that absolutely no one has been fooled by his foolish posturing. Completely unable to compete in the realm of science, or even understand a simple article, it lashes out with blind hatred and rage. What a pathetic waste.

There really must be some moderator somewhere who can put a stop to this nonsense once and for all. Ban this fool on every thread and we won't have to put up with it's delusional crap ever again.

Dale Husband · 8 October 2008

DS said: More impotent threats from our mentally challenged troll. Take a good look ladies and gentlemen, these are the depths of moral depravity to which one can stoop. Completely unable to provide any evidence for his ludicrous claims, the trool of many names proceeds to threaten in a vain attempt to deflect attention away from the fact that absolutely no one has been fooled by his foolish posturing. Completely unable to compete in the realm of science, or even understand a simple article, it lashes out with blind hatred and rage. What a pathetic waste. There really must be some moderator somewhere who can put a stop to this nonsense once and for all. Ban this fool on every thread and we won't have to put up with it's delusional crap ever again.
I think jobby has been trapped on this thread by the moderators and we just come here now for the fun of punching him out when we feel like it. I'm amazed he keeps coming back for more. It serves us a good purpose to take out our aggressions on him. Sort of like that Lazerus character in one of the original Star Trek episodes that got trapped between universes. Good riddance, I say!

PvM · 8 October 2008

jobby said: Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”. ... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.
Indeed, it's called emergence where interactions between cells, neighboring cells, laws of physics and chemistry guide the building of cells. I discussed the eye formation as an example, have you read up on eye embryology yet?

jobby · 8 October 2008

Dale Husband said:
DS said: More impotent threats from our mentally challenged troll. Take a good look ladies and gentlemen, these are the depths of moral depravity to which one can stoop. Completely unable to provide any evidence for his ludicrous claims, the trool of many names proceeds to threaten in a vain attempt to deflect attention away from the fact that absolutely no one has been fooled by his foolish posturing. Completely unable to compete in the realm of science, or even understand a simple article, it lashes out with blind hatred and rage. What a pathetic waste. There really must be some moderator somewhere who can put a stop to this nonsense once and for all. Ban this fool on every thread and we won't have to put up with it's delusional crap ever again.
I think jobby has been trapped on this thread by the moderators and we just come here now for the fun of punching him out when we feel like it. I'm amazed he keeps coming back for more. It serves us a good purpose to take out our aggressions on him. Sort of like that Lazerus character in one of the original Star Trek episodes that got trapped between universes. Good riddance, I say!
I certainly have better things to do than to spend hours writing childish attempts at derision.

PvM · 8 October 2008

jobby said: Your dogma that DNA can’t account for developmental process within an organism. You really aren’t very bright are you. ... never said it couldnt! Please read more carefully.
A first step toward recovery is rejecting the original position. Good first step Bobby. So now DNA could very well account for the developmental processes and Bobby's argument has become "I, Bobby, do not understand how it happens".

PvM · 8 October 2008

I certainly have better things to do than to spend hours writing childish attempts at derision.

So why respond then? I thought you had better things to do. I agree, read up on eye morphology and embryology, it's a fascinating topic.

PvM · 8 October 2008

And I would ask everyone to be discouraged from using verbal abuse and name calling on this thread since I find it distracting, demeaning and undermining the argument. Of course, as a mere participant on this thread, that's all I can do.

PvM · 8 October 2008

Remember that bobby is hardly the only one who seems to 'foolish'. And while bobby's 'foolishness' revolve mostly around a lack of understanding or appreciation of science, others have used a more 'in your face' approach. Sometimes it's really hard to recognize who are the true fools here.
DS said: There really must be some moderator somewhere who can put a stop to this nonsense once and for all. Ban this fool on every thread and we won't have to put up with it's delusional crap ever again.

jobby · 8 October 2008

PvM said: Remember that bobby is hardly the only one who seems to 'foolish'. And while bobby's 'foolishness' revolve mostly around a lack of understanding or appreciation of science, others have used a more 'in your face' approach. Sometimes it's really hard to recognize who are the true fools here.
DS said: There really must be some moderator somewhere who can put a stop to this nonsense once and for all. Ban this fool on every thread and we won't have to put up with it's delusional crap ever again.
...You could simply not read it.

David Stanton · 8 October 2008

PvM,

If you think that it is appropriate for posters here to use libel, slander and personal threats, then perhaps you could tell us all the location of the library that the troll posts from.

I know that you don't approve of the tactics that this troll has been using. After all, you already banned it to the best of your ability. I will never respond to it again. Why anyone else would is beyond me.

PvM · 8 October 2008

Bobby is banned by me for the reason of using multiple aliases. If you cannot stand bobby why empower him, I never have understood this, although I do appreciate that others may consider by position of responding is foolish in itself. I have no problems with that either. Each their own style, each their own opinion.
David Stanton said: PvM, If you think that it is appropriate for posters here to use libel, slander and personal threats, then perhaps you could tell us all the location of the library that the troll posts from. I know that you don't approve of the tactics that this troll has been using. After all, you already banned it to the best of your ability. I will never respond to it again. Why anyone else would is beyond me.

PvM · 8 October 2008

an advice that ironically is appropriate for jobby as well. WWJD
jobby said:
PvM said: Remember that bobby is hardly the only one who seems to 'foolish'. And while bobby's 'foolishness' revolve mostly around a lack of understanding or appreciation of science, others have used a more 'in your face' approach. Sometimes it's really hard to recognize who are the true fools here.
DS said: There really must be some moderator somewhere who can put a stop to this nonsense once and for all. Ban this fool on every thread and we won't have to put up with it's delusional crap ever again.
...You could simply not read it.

DS · 8 October 2008

But what of Lazarus, what of Lazarus?

Dale Husband · 8 October 2008

Well, as long as jobby, or whatever name he cares to use, keeps giving non-answers to our questions and non-data in response to our data, he is no threat. I am quite satified with the outcome and will be moving on.

Goodbye, jobby.

Wayne Francis · 8 October 2008

jobby said: Your dogma that DNA can’t account for developmental process within an organism. You really aren’t very bright are you. ... never said it couldnt! Please read more carefully.
Did you forget Hand Jobby. I already did show that you said just that. Over a dozen times. Here is the link to my post that quotes you, directly saying just that. http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-168353 and your post DIRECTLY after http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-168360 claiming I quote mined you. But, again, quote mining is taking select phrases out of context. What I have done is fully quote you and let the reader see what meanings your words have. That was 19 pages ago. I probably could find a few more post of yours after that that has you claiming DNA can't account for developmental processes. Before you try to move the goal post Hand Jobby, the "shape" of a organ is a part of the developmental process. Hand Jobby can not grasp, with is tiny little mind, how gradients are used to to define the shape of an organ. When provided evidence he claims it doesn't, basically because it isn't written at the level of a kindergarten level if he even attempted to read at all. To him scientific papers contain no information because he can't understand them. No matter how many times you lie Blow Jobby it doesn't make what you are saying the truth. It just shows how to everyone how much you are willing to lie even with direct proof that you are lying.

Wayne Francis · 8 October 2008

jobby said: Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”. ... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.
For you Blow Jobby, just published.
The Molecular Basis of Skeletogenesis Book Series: Novartis Foundation Symposia Published Online: 7 Oct 2008 Editor(s): Gail Cardew, Jamie A. Goode Series Editor(s): Novartis Foundation Print ISBN: 9780471494331 Online ISBN: 9780470846650 DOI: 10.1002/0470846658 Copyright © 2001 John Wiley & Sons, Ltd
It explains just what you want to know. How known processes of biochemistry dictate the shape of bones. Time for you to move the goal post again.

tresmal · 8 October 2008

Wayne Francis said: It explains just what you want to know. How known processes of biochemistry dictate the shape of bones. Time for you to move the goal post again.
Jobby says: That book doesn't explain how known processes of biochemistry dictate the shape of bones. :)

jobby · 9 October 2008

It explains just what you want to know. How known processes of biochemistry dictate the shape of bones.

.... did YOU read it? Sorry but at this time the method by which bones take certain shapes is unknown. Yes they do know what starts and stops the processes but not how the actual shape is formed. Go ahead READ about it.

jobby · 9 October 2008

Wayne Francis said:
jobby said: Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”. ... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.
For you Blow Jobby, just published.
The Molecular Basis of Skeletogenesis Book Series: Novartis Foundation Symposia Published Online: 7 Oct 2008 Editor(s): Gail Cardew, Jamie A. Goode Series Editor(s): Novartis Foundation Print ISBN: 9780471494331 Online ISBN: 9780470846650 DOI: 10.1002/0470846658 Copyright © 2001 John Wiley & Sons, Ltd
It explains just what you want to know. How known processes of biochemistry dictate the shape of bones. Time for you to move the goal post again.
Dont you have anything better to do?

Dan · 9 October 2008

jobby said: It explains just what you want to know. How known processes of biochemistry dictate the shape of bones. .... did YOU read it? Sorry but at this time the method by which bones take certain shapes is unknown. Yes they do know what starts and stops the processes but not how the actual shape is formed. Go ahead READ about it.
Jobby has finally written an on-topic post. This thread is about Behe's claim: He said "evolution of the immune system is impossible". When shown evidence to the contrary he merely stated, without without examining it, that the evidence was "not good enough". Jobby has just done exactly the same thing.

Wayne Francis · 9 October 2008

jobby said:
Wayne Francis said:
jobby said: Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”. ... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.
For you Blow Jobby, just published.
The Molecular Basis of Skeletogenesis Book Series: Novartis Foundation Symposia Published Online: 7 Oct 2008 Editor(s): Gail Cardew, Jamie A. Goode Series Editor(s): Novartis Foundation Print ISBN: 9780471494331 Online ISBN: 9780470846650 DOI: 10.1002/0470846658 Copyright © 2001 John Wiley & Sons, Ltd
It explains just what you want to know. How known processes of biochemistry dictate the shape of bones. Time for you to move the goal post again.
Dont you have anything better to do?
What Blow Jobby? You keep asking how a bones know how to grow in the shapes they do. There is the book for you. Why don't you want to read it? Because you'll see how much of a ignorant ass you have been?

jobby · 9 October 2008

What Blow Jobby? You keep asking how a bones know how to grow in the shapes they do. There is the book for you. Why don’t you want to read it? Because you’ll see how much of a ignorant ass you have been?

... what a good example you are for kids who might be reading this site! what a vulgar mind you have! have YOU read the book????????????

jobby · 9 October 2008

What Blow Jobby? You keep asking how a bones know how to grow in the shapes they do. There is the book for you. Why don’t you want to read it? Because you’ll see how much of a ignorant ass you have been?

.... are you saying this book explains how the shapes are formed and not just how the signaling works to start and end the formation process???

phantomreader42 · 9 October 2008

jobby said: What Blow Jobby? You keep asking how a bones know how to grow in the shapes they do. There is the book for you. Why don’t you want to read it? Because you’ll see how much of a ignorant ass you have been? .... are you saying this book explains how the shapes are formed and not just how the signaling works to start and end the formation process???
If you were physically capable of READING anything, you'd be able to find out the answer to this yourself. Of course, we all know you've never been interested in answers to any of your asinine questions. You just want to babble and lie and make IDiotic demands for endless supplies of information, none of which you will ever even consider reading. Your sole purpose here is mental masturbation. You are a perfect illustration of the total intellectual and moral bankruptcy of creationism in all its forms. In conclusion, bobby the boob is a worthless lying sack of shit, and all his future comments should be immediately deleted as spam.

Henry J · 9 October 2008

Hey, now we're getting the "DNA is not sufficient" argument on another thread, from somebody who has a vocabulary.

Henry

Wayne Francis · 9 October 2008

jobby said: What Blow Jobby? You keep asking how a bones know how to grow in the shapes they do. There is the book for you. Why don’t you want to read it? Because you’ll see how much of a ignorant ass you have been? .... are you saying this book explains how the shapes are formed and not just how the signaling works to start and end the formation process???
Yes, and it explains why many skeletal defects occur. It isn't as easy to understand as looking at a blue print, their are some very serious interactions with the pathways and gradients. PvM has been trying to tell you this all along but you choose to ignore his explanations and the papers. The more we know about genetic disorders that alter normal bone growth the more we know about bone growth. For instance if I have a genetic mutation that causes me to have 15% more bone mass that could confer a survival advantage or disadvantage depending on the environment I'm in. Bone development is a important area of research. For instance how our jaws developed allowed our brains case to grow larger without impacting on our bite force and our muscles used for biting do not place any pressure on the brain. Bone development only ends with death also. Just like I can work out and enlarge my muscles by exercising them (damaging them causing muscle cells to produce signals that cause themselves and neighboring cells to divide more) I can do the same with my bones. Damage to bone matrix is sensed by osteoblasts and they respond by producing even more bone matrix. This is why when you break a bone after it heals it is stronger in that point then before. A better way to make bones stronger is just high impact workouts. You have to be careful not to over do it or you can cause more stress to the bone and cartilage then it can cope with repairing and strengthening.

tresmal · 9 October 2008

Wayne Francis for the win. Jobby that steaming charred piece of meat sitting on that silver platter in front of you is your own ass. Prepared and served for you by the friendly folks at The Panda's Thumb. You need to come up with a new raging non sequitur of an argument to dazzle us with.

jobby · 10 October 2008

tresmal said: Wayne Francis for the win. Jobby that steaming charred piece of meat sitting on that silver platter in front of you is your own ass. Prepared and served for you by the friendly folks at The Panda's Thumb. You need to come up with a new raging non sequitur of an argument to dazzle us with.
.... he showed me the study that explains how actual shape of the bones are formed? and the study that shows that 750 MB is enough to construct a human? and the study that complex body plans can result from NS?? where did you see that he did that?? ... and what is this junior high obsession with vulgarities?? you posters really should study more instead watching Beavis and Butthead.

Wayne Francis · 10 October 2008

jobby said:
tresmal said: Wayne Francis for the win. Jobby that steaming charred piece of meat sitting on that silver platter in front of you is your own ass. Prepared and served for you by the friendly folks at The Panda's Thumb. You need to come up with a new raging non sequitur of an argument to dazzle us with.
.... he showed me the study that explains how actual shape of the bones are formed? and the study that shows that 750 MB is enough to construct a human? and the study that complex body plans can result from NS?? where did you see that he did that?? ... and what is this junior high obsession with vulgarities?? you posters really should study more instead watching Beavis and Butthead.
Yup hand jobby, you've been provided evidence for all that and you've ignored it all. Stay in your own little ignorant world. No one cares. The lurkers have a clear understanding of your lying tactics. You are like J.A.D. Dave Scott, KingKong and a few others that have been through here. You'll be remembered by a few of us alright. I guess you might think it is better to be a known fool thant not known at all.

Science Avenger · 10 October 2008

44 pages, woohoo! Do I hear 45? Come on handjobby, I know you've got some gojo left.

Malcolm · 10 October 2008

The troll dribbled,
… he showed me the study that explains how actual shape of the bones are formed? and the study that shows that 750 MB is enough to construct a human?
Having waded through dozens of pages of ignorance like this, it occurs to me that one of the troll's biggest problems is that it sees DNA as some kind of book or blueprint. It seems to think that every process involved in the development of a human requires its own set of instructions. By that logic, most video games would be impossible too. Imagine the amount of memory required to program even a fairly simple game like Doom, if every imp and every bullet had to have its own set of instructions just for it. Of course that isn't how computer programs work. Sub-routines take care of repetitive actions. Living cells don't just use incredibly intricate nested sub-routines, the output of those sub-routines act as feedback loops. If the Jobby/Bobby thing knew any biochemistry, it would know that there is no need to posit some mysterious other source of information in the cell.

jobby · 11 October 2008

Of course that isn’t how computer programs work. Sub-routines take care of repetitive actions.

.... and even with carefully designed subroutines some operating systems require gigs. but according the to trolls here the human body can be constructed on 10MB of info. simply not logical. and even if arguable if it is science the hypothesis should be tested.

... and even tho we cannot track every molecule in a liter of water we DO know within a certain tolerance how much energy it will take to raise the temp 1 degree C.

... the trolls here are simply trolls. no science ability. just sad trolls.

Wayne Francis · 11 October 2008

jobby said: Of course that isn’t how computer programs work. Sub-routines take care of repetitive actions. .... and even with carefully designed subroutines some operating systems require gigs. but according the to trolls here the human body can be constructed on 10MB of info. simply not logical. and even if arguable if it is science the hypothesis should be tested. ... and even tho we cannot track every molecule in a liter of water we DO know within a certain tolerance how much energy it will take to raise the temp 1 degree C. ... the trolls here are simply trolls. no science ability. just sad trolls.
Hand Jobby, if both you and I write a program who do you think would write a smaller more efficient program? Now I'll tell you that I'm a Computer programmer by trade. I'm 38 and have made a career of computer programing for going on 20 years to include 6 years in the USMC. I started programming on a Timex Sinclair back in the early 80s. I'll bet I can write far more efficient code then you. Now no one expects you to write code as well as me and I know there are many programmers out there that would put me to shame. Now most OS's don't require many gigs. Actually most OS's don't require much at all. What you confuse for an OS is a OS with MANY different additional programs to go along with it. But even so how long do you think Vista has been in development? Even if you count things like the calculator that only had 1 rewrite since windows 3.1 in the 1992 it has only been worked on for 20 odd years. Now DNA has been around for over 3 BILLION years. How efficient do you think computer systems will be in 3,000,000,000 years Hand Jobby? Now I already know Hand Jobby's next comment will be something like code can only get so small. I mean if I want to write a program that adds 1 + 1 then yes it can only get so small but we are not talking about simple programs. We are talking about a system that has evolved over billions of years and the most complex think we know of in the universe....Life. If hand Jobby understood anything he would know that current computers are not very efficient. Not at all. They are very generic and thus the code that drives them needs to be more complex to do the job. Life is much better at doing what it does. The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today's programs run on has only been around for a few decades. Life is not like the crappy computers we use today. Again Life has been in development for over 3 billion years. Now this also ignores the fact that biochemistry is a LOT more complicated then any computer program. We can't even write code to predict protein folding yet that is a purely physical process. I don't know what your rant about the water is. Your the one that claims that model systems aren't any good not us. Now if DNA was computer code running on today's computers I would say what it does is pretty amazing. But it isn't. It is a biological molecule that has been around for over 3 billion years refining how it does what it does. You Blow Jobby have been the only troll in this whole thread. You ignore every answer to every question you ask and claim no one has ever answered you. You lie then in the face of your lie claim that you never lied. You are a troll, a lying and ignorant ass the does nothing but waste oxygen for no good reason.

jobby · 11 October 2008

I’m 38 and have made a career

... youre 38 and use terms like 'hand jobby' did you watch a lot of Beavis? why do you act so immature??

jobby · 11 October 2008

You are a troll, a lying and ignorant ass the does nothing but waste oxygen for no good reason.

.... do you realize you are getting angry at a persona on the internet? and you have spend a lot of time on it rather than usefule pursuits. do you think that is mentally healthy?

jobby · 11 October 2008

How efficient do you think computer systems will be in 3,000,000,000 years Hand Jobby?

.. probably would not have junk DNA in it

jobby · 11 October 2008

Now no one expects you to write code as well as me

.. what language do you program in?

.. your statement is completely illogical since you have no idea how well or badly i 'code' if at all.

jobby · 11 October 2008

The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades.

.. you claim to be an expert in 'coding'. give us a range for the amount of bytes needed to contruct a human body.

> 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!

Dave Lovell · 11 October 2008

Wayne Francis said: The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades.
and jobby replied: .. you claim to be an expert in 'coding'. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
Jobby, I've been away for just over a week and this thread has doubled in size, but you seemed to have learnt nothing. Wayne's expertise may enable him to make an educated guess how many bytes would be needed to unambiguously describe a human body, and how many bytes would be needed to unambiguously describe a human's DNA. There will be a huge difference between the two numbers because one is only the instructions to build the other. A developmental biologist may give you an educated guess of the number of base pairs in the functional part of the human genome, but would of course have neither the need nor the expertise to express this as a computer data equivalent.

Malcolm · 11 October 2008

The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in ‘coding’. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I'm beginning to think that this must be one very short troll. Another point has just sailed completely over its head. DNA can't be measured in bytes because it isn't in any way analogous to a computer program. And if Jobby had studied any biochemistry, or was capable of understanding any of the papers linked to, it would understand that the human genome not only contains enough bases to code for human development, it has a fair bit of redundancy built in too.

jobby · 12 October 2008

Malcolm said:
The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in ‘coding’. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I'm beginning to think that this must be one very short troll. Another point has just sailed completely over its head. DNA can't be measured in bytes because it isn't in any way analogous to a computer program. And if Jobby had studied any biochemistry, or was capable of understanding any of the papers linked to, it would understand that the human genome not only contains enough bases to code for human development, it has a fair bit of redundancy built in too.
I think you must be living in an alternate reality if you think that the DNA is not analagous to a computer programmer. Most of the scientific world disagrees with you. But your FAITH is strong so you can ignore that. from wiki: DNA: The main role of DNA molecules is the long-term storage of information. DNA is often compared to a set of blueprints or a recipe, or a code, since it contains the instructions needed to construct other components of cells, such as proteins and RNA molecules. The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. Computer program: Computer programs (also software programs, or just programs) are instructions for a computer.[1]. A computer requires programs to function. Moreover, a computer program does not run unless its instructions are executed by a central processor;[2] however, a program may communicate an algorithm to people without running. Computer programs are usually executable programs or the source code from which executable programs are derived (e.g., compiled).

jobby · 12 October 2008

jobby said:
Malcolm said:
The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in ‘coding’. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I'm beginning to think that this must be one very short troll. Another point has just sailed completely over its head. DNA can't be measured in bytes because it isn't in any way analogous to a computer program. And if Jobby had studied any biochemistry, or was capable of understanding any of the papers linked to, it would understand that the human genome not only contains enough bases to code for human development, it has a fair bit of redundancy built in too.
I think you must be living in an alternate reality if you think that the DNA is not analagous to a computer programmer. Most of the scientific world disagrees with you. But your FAITH is strong so you can ignore that. from wiki: DNA: The main role of DNA molecules is the long-term storage of information. DNA is often compared to a set of blueprints or a recipe, or a code, since it contains the instructions needed to construct other components of cells, such as proteins and RNA molecules. The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. Computer program: Computer programs (also software programs, or just programs) are instructions for a computer.[1]. A computer requires programs to function. Moreover, a computer program does not run unless its instructions are executed by a central processor;[2] however, a program may communicate an algorithm to people without running. Computer programs are usually executable programs or the source code from which executable programs are derived (e.g., compiled).
So you disagree with the below as put out by the Jackson Lab in Maine?? It is instructive to consider the size of the mammalian genome in terms of the amount of computer-based memory that it would occupy. Each basepair can have one of only four values (G, C, A, or T) and is thus equivalent to two bits of binary code information (with potential values of 00, 01, 10, 11). Computer information is usually measured in terms of bytes that typically contain 8 bits. Thus, each byte can record the information present in 4 bp. A simple calculation indicates that a complete haploid genome could be encoded within 750 megabytes of computer storage space. Incredibly, small lightweight storage devices with such a capacity are now available for desktop computers. Of course, the computer capacity required to actually interpret this information will be many orders of magnitude larger.

jobby · 12 October 2008

jobby said:
jobby said:
Malcolm said:
The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in ‘coding’. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I'm beginning to think that this must be one very short troll. Another point has just sailed completely over its head. DNA can't be measured in bytes because it isn't in any way analogous to a computer program. And if Jobby had studied any biochemistry, or was capable of understanding any of the papers linked to, it would understand that the human genome not only contains enough bases to code for human development, it has a fair bit of redundancy built in too.
I think you must be living in an alternate reality if you think that the DNA is not analagous to a computer programmer. Most of the scientific world disagrees with you. But your FAITH is strong so you can ignore that. from wiki: DNA: The main role of DNA molecules is the long-term storage of information. DNA is often compared to a set of blueprints or a recipe, or a code, since it contains the instructions needed to construct other components of cells, such as proteins and RNA molecules. The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. Computer program: Computer programs (also software programs, or just programs) are instructions for a computer.[1]. A computer requires programs to function. Moreover, a computer program does not run unless its instructions are executed by a central processor;[2] however, a program may communicate an algorithm to people without running. Computer programs are usually executable programs or the source code from which executable programs are derived (e.g., compiled).
So you disagree with the below as put out by the Jackson Lab in Maine?? It is instructive to consider the size of the mammalian genome in terms of the amount of computer-based memory that it would occupy. Each basepair can have one of only four values (G, C, A, or T) and is thus equivalent to two bits of binary code information (with potential values of 00, 01, 10, 11). Computer information is usually measured in terms of bytes that typically contain 8 bits. Thus, each byte can record the information present in 4 bp. A simple calculation indicates that a complete haploid genome could be encoded within 750 megabytes of computer storage space. Incredibly, small lightweight storage devices with such a capacity are now available for desktop computers. Of course, the computer capacity required to actually interpret this information will be many orders of magnitude larger.
Malcolm said:
The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in ‘coding’. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I'm beginning to think that this must be one very short troll. Another point has just sailed completely over its head. DNA can't be measured in bytes because it isn't in any way analogous to a computer program. And if Jobby had studied any biochemistry, or was capable of understanding any of the papers linked to, it would understand that the human genome not only contains enough bases to code for human development, it has a fair bit of redundancy built in too.
and you disagree with Richard Dawkins??: DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too, if we wish. DNA doesn't use a binary code, but a quaternary one. Whereas the unit of information in the computer is a 1 or a 0, the unit in DNA can be T, A, C or G. The total information capacity of the human genome is measured in gigabits. That of the common gut bacterium Escherichia coli is measured in megabits. We, like all other animals, are descended from an ancestor which, were it available for our study today, we'd classify as a bacterium. So perhaps, during the billions of years of evolution since that ancestor lived, the information capacity of our genome has gone up about three orders of magnitude (powers of ten) - about a thousandfold. This is satisfyingly plausible and comforting to human dignity. Should human dignity feel wounded, then, by the fact that the crested newt, Triturus cristatus, has a genome capacity estimated at 40 gigabits, an order of magnitude larger than the human genome?

Science Avenger · 12 October 2008

Jesus, now it's trolling itself. Are there no limits to how low it can go?

tresmal · 12 October 2008

Science Avenger said: Jesus, now it's trolling itself. Are there no limits to how low it can go?
Now Science Avenger, don't challenge him.:)

Wayne Francis · 12 October 2008

jobby said: I’m 38 and have made a career ... youre 38 and use terms like 'hand jobby' did you watch a lot of Beavis? why do you act so immature??
Yes I use terms like that. I treat people with the respect they deserve. You have shown yourself unworthy of respect Hand Jobby. You have shown yourself to be a liar many times so I feel no regret for calling you by any derogatory term.

Wayne Francis · 12 October 2008

jobby said: You are a troll, a lying and ignorant ass the does nothing but waste oxygen for no good reason. .... do you realize you are getting angry at a persona on the internet? and you have spend a lot of time on it rather than usefule pursuits. do you think that is mentally healthy?
Why do you think I'm getting angry at you? I can easily refer to a waste of life as a waste of life with almost no emotion at all. Your avoiding the topics Hand Jobby, care to admit that you are wrong and a lying ass? Oh and Hand Jobby lets not forget that you are the one that constantly resorts to internet yelling when you are shown to be wrong. I think you have a bit of a problem with projecting your own issues onto others. Perhaps you should take your meds.

Wayne Francis · 12 October 2008

jobby said: How efficient do you think computer systems will be in 3,000,000,000 years Hand Jobby? .. probably would not have junk DNA in it
not relevant hand jobby. There is hardware out there that has been designed by computers that have "junk" circuits. Same goes for code. Give me almost any piece of software and you'll find "junk" code in there. Hand Jobby tries to evad the question and once agian fails

Wayne Francis · 12 October 2008

jobby said: Now no one expects you to write code as well as me .. what language do you program in? .. your statement is completely illogical since you have no idea how well or badly i 'code' if at all.
You want my history of languages? I started out like most kid programming in Basic, I learn pascal in high school. I taught myself assembler on 650n CPUs primarily on CBM and an Atari 800. I also learn wrote a handful of assembler programs for a PDP-11. In 1988 I started programming in COBOL and had to learn JCL. 1991 I started programming in C/C++ along with RAD development using Visual Basic while still maintaining systems in CICS, Natural, COBOL with ADABAS and some PC systems written in ADA. I continued to code primarily in C++ with a short stint with power builder. After becoming a MCT/MCSD I continued to work with mostly Microsoft version of C++ with some of the more interesting systems I've been involved in to include the Royal Australian Navy's Sea-hawk Helicopter Simulator and a front end for the Australian Center for Remote Sensing digital catalogue of satellite imagery. I've dabbled in Java doing web sphere processes but I've been doing .NET development for the last 4 years for the most part. There are a handful of other languages I've done some also developed in like Pearl, PHP, etc but my preferred languages are C# for windows environments and C++ for Unix/Linux. As for your programming ability. Programming takes a bit of a logical mind and you have not shown very good problem solving skills in the last 44 pages of this thread. So it is VERY logical that I can make the statement with a high degree of certainty that you would not be a good coder.

Wayne Francis · 12 October 2008

jobby said: The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in 'coding'. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I've told you OVER and OVER Hand Jobby, making a comparison between DNA and computer code is useless. It isn't even comparing apples and oranges. It is comparing apples and a four course dinner. A computer can not replicate itself so it fails on that account too. Let me put it in simple terms for your simple mind Hand Jobby. It is stupid to compare DNA code to computer code. I can tell you that it most likely takes less then 1 billion base pairs though.

Wayne Francis · 12 October 2008

jobby said:
Malcolm said:
The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in ‘coding’. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I'm beginning to think that this must be one very short troll. Another point has just sailed completely over its head. DNA can't be measured in bytes because it isn't in any way analogous to a computer program. And if Jobby had studied any biochemistry, or was capable of understanding any of the papers linked to, it would understand that the human genome not only contains enough bases to code for human development, it has a fair bit of redundancy built in too.
I think you must be living in an alternate reality if you think that the DNA is not analagous to a computer programmer. Most of the scientific world disagrees with you. But your FAITH is strong so you can ignore that. from wiki: DNA: The main role of DNA molecules is the long-term storage of information. DNA is often compared to a set of blueprints or a recipe, or a code, since it contains the instructions needed to construct other components of cells, such as proteins and RNA molecules. The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. Computer program: Computer programs (also software programs, or just programs) are instructions for a computer.[1]. A computer requires programs to function. Moreover, a computer program does not run unless its instructions are executed by a central processor;[2] however, a program may communicate an algorithm to people without running. Computer programs are usually executable programs or the source code from which executable programs are derived (e.g., compiled).
Hand Jobby doesn't understand what an analogy is. Calling DNA a blueprint/program/recipe....is a way to convey a complex process across to those that don't have the technical knowledge of the given topic. DNA really isn't like a blueprint. A blue print is a picture of a product with dimensions of individual parts. A blueprint does does not react to the environment. A recipe doesn't cook the food. A blueprint doesn't build the house. A computer program doesn't cause chemical reactions to occur. None of these things are capable of self replication.

jobby · 12 October 2008

Wayne Francis said:
jobby said: The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in 'coding'. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I've told you OVER and OVER Hand Jobby, making a comparison between DNA and computer code is useless. It isn't even comparing apples and oranges. It is comparing apples and a four course dinner. A computer can not replicate itself so it fails on that account too. Let me put it in simple terms for your simple mind Hand Jobby. It is stupid to compare DNA code to computer code. I can tell you that it most likely takes less then 1 billion base pairs though.
It is stupid to compare DNA code to computer code. .... well I guess you and Richard Dawkins have an area of disagreement. You should write him.

jobby · 12 October 2008

So it is VERY logical that I can make the statement with a high degree of certainty that you would not be a good coder.

.... well RD disagrees with you. And I think it is illogical to waste so much time here as you do.

Wayne Francis · 12 October 2008

jobby said:
jobby said:
Malcolm said:
The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in ‘coding’. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I'm beginning to think that this must be one very short troll. Another point has just sailed completely over its head. DNA can't be measured in bytes because it isn't in any way analogous to a computer program. And if Jobby had studied any biochemistry, or was capable of understanding any of the papers linked to, it would understand that the human genome not only contains enough bases to code for human development, it has a fair bit of redundancy built in too.
I think you must be living in an alternate reality if you think that the DNA is not analagous to a computer programmer. Most of the scientific world disagrees with you. But your FAITH is strong so you can ignore that. from wiki: DNA: The main role of DNA molecules is the long-term storage of information. DNA is often compared to a set of blueprints or a recipe, or a code, since it contains the instructions needed to construct other components of cells, such as proteins and RNA molecules. The DNA segments that carry this genetic information are called genes, but other DNA sequences have structural purposes, or are involved in regulating the use of this genetic information. Computer program: Computer programs (also software programs, or just programs) are instructions for a computer.[1]. A computer requires programs to function. Moreover, a computer program does not run unless its instructions are executed by a central processor;[2] however, a program may communicate an algorithm to people without running. Computer programs are usually executable programs or the source code from which executable programs are derived (e.g., compiled).
So you disagree with the below as put out by the Jackson Lab in Maine?? It is instructive to consider the size of the mammalian genome in terms of the amount of computer-based memory that it would occupy. Each basepair can have one of only four values (G, C, A, or T) and is thus equivalent to two bits of binary code information (with potential values of 00, 01, 10, 11). Computer information is usually measured in terms of bytes that typically contain 8 bits. Thus, each byte can record the information present in 4 bp. A simple calculation indicates that a complete haploid genome could be encoded within 750 megabytes of computer storage space. Incredibly, small lightweight storage devices with such a capacity are now available for desktop computers. Of course, the computer capacity required to actually interpret this information will be many orders of magnitude larger.
Hand Jobby, that is just like saying
instructive to consider the size of the mammalian genome in terms of the amount of pieces of paper it would occupy.
This is a storage mechanism used for easy reading by humans. It has nothing to do with executing computer code. Saying the human genome can fit on a CD is just like saying it can fit on about 1.5 million pieces of A4 paper. You try to push it further and say it is like computer code which it is not. Let me ask you Hand Jobby. How many pieces of paper would you need to construct a human? Doesn't matter how many pieces you have you'll never do it. Just like you'll never get a computer program creating human.

jobby · 12 October 2008

....Are you saying DNA does not store information??

....Do feel that Richard Dawkins and the Jackson Lab in Maine are in error and are poor scientists and illogical thinkers??

jobby · 12 October 2008

jobby said:
Wayne Francis said:
jobby said: The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades. .. you claim to be an expert in 'coding'. give us a range for the amount of bytes needed to contruct a human body. > 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
I've told you OVER and OVER Hand Jobby, making a comparison between DNA and computer code is useless. It isn't even comparing apples and oranges. It is comparing apples and a four course dinner. A computer can not replicate itself so it fails on that account too. Let me put it in simple terms for your simple mind Hand Jobby. It is stupid to compare DNA code to computer code. I can tell you that it most likely takes less then 1 billion base pairs though.
It is stupid to compare DNA code to computer code. .... well I guess you and Richard Dawkins have an area of disagreement. You should write him.
... Do you feel that making fun of someone's handle makes your case stronger??

Wayne Francis · 12 October 2008

Hand Jobby says and you disagree with Richard Dawkins??: DNA carries information in a very computer-like way, and we can measure the genome’s capacity in bits too, if we wish. DNA doesn’t use a binary code, but a quaternary one. Whereas the unit of information in the computer is a 1 or a 0, the unit in DNA can be T, A, C or G. The total information capacity of the human genome is measured in gigabits. That of the common gut bacterium Escherichia coli is measured in megabits. We, like all other animals, are descended from an ancestor which, were it available for our study today, we’d classify as a bacterium. So perhaps, during the billions of years of evolution since that ancestor lived, the information capacity of our genome has gone up about three orders of magnitude (powers of ten) - about a thousandfold. This is satisfyingly plausible and comforting to human dignity. Should human dignity feel wounded, then, by the fact that the crested newt, Triturus cristatus, has a genome capacity estimated at 40 gigabits, an order of magnitude larger than the human genome?
This is why I know I'm a better programmer then you hand Jobby. Everyone you quote talks about storing DNA sequences as computer data, not computer code. Yes DNA can be analogous to computer code but when we talk about the human genome fitting on a CD that is data, not code. That 750 meg does not include all the biochemistry that is involved. You can't grasp that a string of binary digits to represent the human genome has nothing to do with computer code.

jobby · 12 October 2008

This is why I know I’m a better programmer then you hand Jobby. Everyone you quote talks about storing DNA sequences as computer data, not computer code. Yes DNA can be analogous to computer code but when we talk about the human genome fitting on a CD that is data, not code. That 750 meg does not include all the biochemistry that is involved. You can’t grasp that a string of binary digits to represent the human genome has nothing to do with computer code.

...Code is not data??

Wayne Francis · 12 October 2008

jobby said: So it is VERY logical that I can make the statement with a high degree of certainty that you would not be a good coder. .... well RD disagrees with you. And I think it is illogical to waste so much time here as you do.
No Hand Jobby, you don't understand what he is saying. Storing the human genome has nothing to do with the execution of said DNA. It is being stored as data. To use your analogy, Blow Jobby, we would need an operating system that knows how to read and process that data. But here is the rub. That data in the environment of the cell is the OS. When it is on a compact disk it is nothing more then if it was a 600+ foot tall stack of paper filled with the letters A,C,G,T

jobby · 12 October 2008

Storing the human genome has nothing to do with the execution of said DNA. It is being stored as data.

then WHERE are the instructions stored??

jobby · 12 October 2008

... Does the DNA contain information???

Wayne Francis · 12 October 2008

jobby said: This is why I know I’m a better programmer then you hand Jobby. Everyone you quote talks about storing DNA sequences as computer data, not computer code. Yes DNA can be analogous to computer code but when we talk about the human genome fitting on a CD that is data, not code. That 750 meg does not include all the biochemistry that is involved. You can’t grasp that a string of binary digits to represent the human genome has nothing to do with computer code. ...Code is not data??
Look Jobby, until we come up with a emulator for biochemistry the 750meg CD is nothing more then storage with no chance of ever getting executed. Just like you reading off the entire genomen verbally won't make a human pop into exsistance. Look, goto wikipedia.
wikipedia In computer science, data is any information in a form suitable for use with a computer. Data is often distinguished from programs. A program is a set of instructions that detail a task for the computer to perform. In this sense, data is thus everything that is not program code.
DNA in its natural environment can be concided both code and data. DNA on a CD is nothing but data.

jobby · 12 October 2008

That data in the environment of the cell is the OS.

....???? So where is the OS that constructs the human body stored??

Wayne Francis · 12 October 2008

jobby said: ... Do you feel that making fun of someone's handle makes your case stronger??
Never said it does, but it lets other out there understand that I have no respect for you. So if you ever make a claim that I agree with you lurkers will see that you are just a lying troll. I know this is hard for you to understand Blow Jobby but after you've repeatedly lied, ignored all responces to your questions and continually tell people they are wrong without anything but your personal incredulity to support your statements, no one here will probably treat you with any amount of respect. When you first started posting I gave you the benifit of the doubt. After I saw you both lie and deny that you had been lying, you lost my respect. I feel no need or responciblity to be polite with people like you and I'm happy for all the lurkers out there to understand that.

jobby · 12 October 2008

jobby said: That data in the environment of the cell is the OS. ....???? So where is the OS that constructs the human body stored??
Wayne Francis said:
jobby said: So it is VERY logical that I can make the statement with a high degree of certainty that you would not be a good coder. .... well RD disagrees with you. And I think it is illogical to waste so much time here as you do.
No Hand Jobby, you don't understand what he is saying. Storing the human genome has nothing to do with the execution of said DNA. It is being stored as data. To use your analogy, Blow Jobby, we would need an operating system that knows how to read and process that data. But here is the rub. That data in the environment of the cell is the OS. When it is on a compact disk it is nothing more then if it was a 600+ foot tall stack of paper filled with the letters A,C,G,T
.... I think you have obfuscated this discussion. I said that the capacity of the DNA can be measured in bytes and several posters disagreed with this. Do YOU disagree???

Wayne Francis · 12 October 2008

jobby said: That data in the environment of the cell is the OS. ....???? So where is the OS that constructs the human body stored??
The OS is the cell and the DNA. Hand Jobby, if I write a computer program down on paper will it execute? No. If I write a DNA "program" on a CD will it execute? No. Can your little brain understand that analogy?

Wayne Francis · 12 October 2008

jobby said:
jobby said: That data in the environment of the cell is the OS. ....???? So where is the OS that constructs the human body stored??
Wayne Francis said:
jobby said: So it is VERY logical that I can make the statement with a high degree of certainty that you would not be a good coder. .... well RD disagrees with you. And I think it is illogical to waste so much time here as you do.
No Hand Jobby, you don't understand what he is saying. Storing the human genome has nothing to do with the execution of said DNA. It is being stored as data. To use your analogy, Blow Jobby, we would need an operating system that knows how to read and process that data. But here is the rub. That data in the environment of the cell is the OS. When it is on a compact disk it is nothing more then if it was a 600+ foot tall stack of paper filled with the letters A,C,G,T
.... I think you have obfuscated this discussion. I said that the capacity of the DNA can be measured in bytes and several posters disagreed with this. Do YOU disagree???
They way you are implying it? Yes I disagree. Yes the human genome can be represented in ~750Megabytes. Can the "information" in the human genome be represented in ~750Megabytes? No. They are 2 different things. Like I've pointed out before we can have a gene that can be represented in less then 128bytes. The "information" on what that 525bp does takes much more then 128bytes to describe. The human language does not convey the "information" of genetics very well. Even if you encode it in binary it still does not convey the real "information". A cell is very efficient in "reading" DNA. We are not.

Malcolm · 12 October 2008

Lets try that again.
Jobby,
Since you still seem to think that DNA is some kind of computer program, what is the spliceosome analogous to? or even the ribosome? If that's what you think of as the CPU, then that is one powerful super computer.

What about g-protein coupled receptors? I've put together a number of computers in my time, and I've never seen anything like that in there.

If I put 2 computers together, will they breed?

Its not that DNA can't be measured in bytes, its that doing so is meaningless. DNA is not analogous to a computer program because cells are not computers.

The fact that you keep on about this just shows that you have absolutely no understanding of biology, which in turn shows that your statement that you have looked at the evidence for evolution and found it lacking is a lie.

Henry J · 12 October 2008

If I put 2 computers together, will they breed?

Why do you think some plugs are referred to as "male", and others as "female"? :p Henry

jobby · 13 October 2008

Malcolm said: Lets try that again. Jobby, Since you still seem to think that DNA is some kind of computer program, what is the spliceosome analogous to? or even the ribosome? If that's what you think of as the CPU, then that is one powerful super computer. What about g-protein coupled receptors? I've put together a number of computers in my time, and I've never seen anything like that in there. If I put 2 computers together, will they breed? Its not that DNA can't be measured in bytes, its that doing so is meaningless. DNA is not analogous to a computer program because cells are not computers. The fact that you keep on about this just shows that you have absolutely no understanding of biology, which in turn shows that your statement that you have looked at the evidence for evolution and found it lacking is a lie.
... Does the DNA contain instructions?

jobby · 13 October 2008

ou have looked at the evidence for evolution and found it lacking is a lie.

... evolution is a fact: it has been observed and happens daily. I never said that evolution does not exist etc.

jobby · 13 October 2008

RD:

DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too, if we wish.

Wayne Francis · 13 October 2008

jobby said:
Malcolm said: Lets try that again. Jobby, Since you still seem to think that DNA is some kind of computer program, what is the spliceosome analogous to? or even the ribosome? If that's what you think of as the CPU, then that is one powerful super computer. What about g-protein coupled receptors? I've put together a number of computers in my time, and I've never seen anything like that in there. If I put 2 computers together, will they breed? Its not that DNA can't be measured in bytes, its that doing so is meaningless. DNA is not analogous to a computer program because cells are not computers. The fact that you keep on about this just shows that you have absolutely no understanding of biology, which in turn shows that your statement that you have looked at the evidence for evolution and found it lacking is a lie.
... Does the DNA contain instructions?
Nothing like computer instructions. Nothing even close. Wait let me explain. Computer instructions are very simple. Much of what DNA does is FAR more complex. Before you try to quote mine that statement let me make it clear that the processes a gene is involved in has no relationship to the number of base pairs that gene contains. IE you can have one gene with ~500bp that is involve with/responsible for more biological processes then a gene with 20,000bp.

Wayne Francis · 13 October 2008

jobby said: RD: DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too, if we wish.
Yes, Richard Dawkins did say that. It is an analogy. It is a way to get someone with no understanding of genetic a slightly better understanding of it. The analogy breaks down when you look closely at it as all analogies ultimately do. In computers there are not a whole lot of instructions. The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. Genetics is not as limited. Biochemical processes are far more complex. Dawkins knows this but it doesn't mean he shouldn't use the analogy when talking to they lay person. He doesn't talk this way to someone like Ken Miller. So please don't quote mine Hand Jobby.

jobby · 13 October 2008

Wayne Francis said:
jobby said: RD: DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too, if we wish.
Yes, Richard Dawkins did say that. It is an analogy. It is a way to get someone with no understanding of genetic a slightly better understanding of it. The analogy breaks down when you look closely at it as all analogies ultimately do. In computers there are not a whole lot of instructions. The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. Genetics is not as limited. Biochemical processes are far more complex. Dawkins knows this but it doesn't mean he shouldn't use the analogy when talking to they lay person. He doesn't talk this way to someone like Ken Miller. So please don't quote mine Hand Jobby.
He doesn't talk this way to someone like Ken Miller. ... you are privy to their private conversations??

jobby · 13 October 2008

The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code.

... you are forgetting about robotics.

jobby · 13 October 2008

So please don’t quote mine

... there was not quotemining. just because a quote does not agree with you does not mean it is mining. RD views the DNA as computer-like. I do not think that an out of context quote. quit bullshitting

SWT · 13 October 2008

jobby said: So please don’t quote mine ... there was not quotemining. just because a quote does not agree with you does not mean it is mining. RD views the DNA as computer-like. I do not think that an out of context quote. quit bullshitting
I am shocked, simply shocked, that you would stoop to such vulgarity ... you've expressed such outrage about it before ...

fnxtr · 13 October 2008

jobby said: The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. ... you are forgetting about robotics.
The stupid, it burns. The CPU in a robot works exactly the same way as any other. "Move the contents of register A to I/O device 1" (say a relay or solenoid) is no different from internal movement of data. You really are clueless, aren't you.

jobby · 13 October 2008

SWT said:
jobby said: So please don’t quote mine ... there was not quotemining. just because a quote does not agree with you does not mean it is mining. RD views the DNA as computer-like. I do not think that an out of context quote. quit bullshitting
I am shocked, simply shocked, that you would stoop to such vulgarity ... you've expressed such outrage about it before ...
... there really is no intellectual thought here is there??

jobby · 13 October 2008

fnxtr said:
jobby said: The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. ... you are forgetting about robotics.
The stupid, it burns. The CPU in a robot works exactly the same way as any other. "Move the contents of register A to I/O device 1" (say a relay or solenoid) is no different from internal movement of data. You really are clueless, aren't you.
... and DUMMY then something happens in the really world. you really dont read very well do you??

jobby · 13 October 2008

This is really nothing but a troll fest. Very little intelligent responses.

PvM · 13 October 2008

I am glad you recognize and acknowledge the nature of your own postings my dear confused friend. Have you found a measure for complexity of the human body already or have you given up? Have you familiarized yourself with the science of embryology? Let me know when you are ready
jobby said: This is really nothing but a troll fest. Very little intelligent responses.

jobby · 13 October 2008

PvM said: I am glad you recognize and acknowledge the nature of your own postings my dear confused friend. Have you found a measure for complexity of the human body already or have you given up? Have you familiarized yourself with the science of embryology? Let me know when you are ready
jobby said: This is really nothing but a troll fest. Very little intelligent responses.
.. why do you troll on me here when you do not want me in your threads. pretty weird!!

PvM · 13 October 2008

Sorry Jobby, you and I have the same right to be here, I even more than you since you have chosen to violate the rules of this board. I am not 'trolling on you', I am merely reminding you of your past failures which you seem intent on repeating. How sad.
jobby said:
PvM said: I am glad you recognize and acknowledge the nature of your own postings my dear confused friend. Have you found a measure for complexity of the human body already or have you given up? Have you familiarized yourself with the science of embryology? Let me know when you are ready
jobby said: This is really nothing but a troll fest. Very little intelligent responses.
.. why do you troll on me here when you do not want me in your threads. pretty weird!!

Jobby · 13 October 2008

PvM said: Sorry Jobby, you and I have the same right to be here, I even more than you since you have chosen to violate the rules of this board. I am not 'trolling on you', I am merely reminding you of your past failures which you seem intent on repeating. How sad.
jobby said:
PvM said: I am glad you recognize and acknowledge the nature of your own postings my dear confused friend. Have you found a measure for complexity of the human body already or have you given up? Have you familiarized yourself with the science of embryology? Let me know when you are ready
jobby said: This is really nothing but a troll fest. Very little intelligent responses.
.. why do you troll on me here when you do not want me in your threads. pretty weird!!
Well this site is one of the best arguments against Darwinism. Any neutral person reading it would be appalled by the language and dislogic of the Darwinists. And the hate that the Darwinists spew out is incredible Are all of you like this?

Henry J · 13 October 2008

Being appalled by people's language is not an argument against the position those people support.

Malcolm · 13 October 2008

One more time Jobby, If DNA is analogous to a computer program, what is the spliceosome analogous to? I'll give you a clue; it isn't analogous to anything, because the cell isn't a computer. Not only have you shown you know nothing about biology,
…Code is not data??
You obviously know nothing about computer programming either. No, in a computer code is not data. Code is a set of instruction. Data is what those instruction act upon. You claimed to have found the evidence that natural selection was responsible for the evolution of complex structures to be insufficient (or some such crap). You lied. You haven't looked at the evidence for anything, or if you have, you don't understand it. You have demonstrated a complete lack of understanding of not just biology, but of the scientific method in general. That you call others trolls is truely hilarious.

Science Avenger · 13 October 2008

Jobby said: Well this site is one of the best arguments against Darwinism. Any neutral person reading it would be appalled by the language and dislogic of the Darwinists. And the hate that the Darwinists spew out is incredible Are all of you like this?
A prime example of cultlike thinking. Simply assert that the "others" are illogical haters, speculate that neutral observers would agree with you, and carry on your clueless way.

Science Avenger · 13 October 2008

Malcolm said:
…Code is not data??
You obviously know nothing about computer programming either. No, in a computer code is not data. Code is a set of instruction. Data is what those instruction act upon.
That's really an amazing mistake for someone to make who presumes to lecture others on a topic. It's the equivalent of a football critic not understanding the concepts of "offense" and "defense".

PvM · 13 October 2008

Poor Jobby, instead of addressing the many scientific objections, Jobby is upset that some people called him names. Is it so hard to address these issues that you have to resort to making yourself a victim when most of the damage has been self inflicted. And little of this is about hate, it is about frustration with Jobby's inabilities to support his claims with logic and fact. So let's not pretend that Jobby is a reliable source when it comes to what a neutral person would believe. A neutral person may very well be amazed by the continued trolling...

Well this site is one of the best arguments against Darwinism. Any neutral person reading it would be appalled by the language and dislogic of the Darwinists. And the hate that the Darwinists spew out is incredible Are all of you like this?

— Jobby

Jobby · 13 October 2008

you are again looking at things too simplisticly. 'code' is a subset of 'data' and 'data is also a subset of 'data'

just as man is a subset of man.

yes in most computers the data and the program are seperated but not always.

(why am i wasting my time. this is obviously above what this person can understand. i taught this to underclass freshmen and they got it. but here the level is just so, so low)

just as a byte is USUALLY 8 bits but that is arbitrary. just as our number base 10 is aribitrary ( i probably lost them there)

( is this a place where learning disability people congregate?0

WIKI:

Some special forms of data are distinguished. A computer program is a collection of data, which can be interpreted as instructions. Most computer languages make a distinction between programs and the other data on which programs operate, but in some languages, notably Lisp and similar languages, programs are essentially indistinguishable from other data

Jobby · 13 October 2008

Science Avenger said:
Jobby said: Well this site is one of the best arguments against Darwinism. Any neutral person reading it would be appalled by the language and dislogic of the Darwinists. And the hate that the Darwinists spew out is incredible Are all of you like this?
A prime example of cultlike thinking. Simply assert that the "others" are illogical haters, speculate that neutral observers would agree with you, and carry on your clueless way.
... i believe in the scientific method. i feel sorry for you for feeling that is 'cultlike' you should try to get out of the middle ages.

Jobby · 13 October 2008

You claimed to have found the evidence that natural selection was responsible for the evolution of complex structures to be insufficient (or some such crap). You lied.

... where did i say that??? you are lying. asshole

Jobby · 13 October 2008

You obviously know nothing about computer programming either. No, in a computer code is not data. Code is a set of instruction. Data is what those instruction act upon.

... simplistic thinking! (well what else to expect from a simpleton!)

PvM · 13 October 2008

Funny how Jobby is upset about others using ad hominems. Of course since Jobby does not even remember his own arguments, what are we but to conclude?
Jobby said: You claimed to have found the evidence that natural selection was responsible for the evolution of complex structures to be insufficient (or some such crap). You lied. ... where did i say that??? you are lying. asshole

PvM · 13 October 2008

Jobby said:is just so, so low) just as a byte is USUALLY 8 bits but that is arbitrary. just as our number base 10 is aribitrary ( i probably lost them there)
A byte is 8 bits, did you not know? And it is hardly arbitrary either. Similarly our base 10 system is again hardly arbitrary, as anyone with two hands understands.

jobby · 13 October 2008

A byte is 8 bits, did you not know? And it is hardly arbitrary either. Similarly our base 10 system is again hardly arbitrary, as anyone with two hands understands

... are you REALLY saying that no computers use bytes other than 8 bit bytes and are you REALLY saying that all human civilizations use the base 10 numbering system?? (can he really be that stupid? lets see how he responds!)

jobby · 13 October 2008

PvM said: Funny how Jobby is upset about others using ad hominems. Of course since Jobby does not even remember his own arguments, what are we but to conclude?
Jobby said: You claimed to have found the evidence that natural selection was responsible for the evolution of complex structures to be insufficient (or some such crap). You lied. ... where did i say that??? you are lying. asshole
... well I am in a gutter mind environment here. just want you to see how it feels to be subject to vulgarities asswipe

Wayne Francis · 13 October 2008

jobby said:
Wayne Francis said:
jobby said: RD: DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too, if we wish.
Yes, Richard Dawkins did say that. It is an analogy. It is a way to get someone with no understanding of genetic a slightly better understanding of it. The analogy breaks down when you look closely at it as all analogies ultimately do. In computers there are not a whole lot of instructions. The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. Genetics is not as limited. Biochemical processes are far more complex. Dawkins knows this but it doesn't mean he shouldn't use the analogy when talking to they lay person. He doesn't talk this way to someone like Ken Miller. So please don't quote mine Hand Jobby.
He doesn't talk this way to someone like Ken Miller. ... you are privy to their private conversations??
I've seen him talk with biologist before yes. That is where the "someone like" comes in. Remember Richard Dawkins is a popularizer of science. When talking to the general public he talks much differently then he does to the scientific community. It is necessary. He would not be a popularizer of science if he talked over the heads of his audience. Even in his books he doesn't go into that much depth. He uses a lot of metaphors. Something you have a difficult time in grasping. The more I think about it that makes sense. You are either a biblical literalist or afflicted with the same metal condition that they are. Unable to read anything and not read it as either completely true or completely false.

Wayne Francis · 13 October 2008

jobby said: The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. ... you are forgetting about robotics.
Ok Hand Jobby, you once again have shown how stupid you are. We where talking about computer instructions. Even if you talk about computers that control robots they still only do those basic functions. They are just arranged, aka a program, to perform what ever operations is needed. a robot is just a mechanical device. It used to refer to devices that resembles a living creature. The line is now blurred as many robots don't resemble living creatures. Robots don't need any electronics either. Theo Jansen essentially builds wooden robots that are powered by the wind and able to walk down the beach. Not only that but they are able to avoid walking to far into the water. These "robots" have no computer code. So Blow Jobby, what is your complaint about my description of what computer code can do?

PvM · 13 October 2008

Ah, the 'they made me do it' defense. WWJD Jobby? Sure, I disapprove of vulgarities and ad hominems and attempt to enforce some civility on the threads I control but others neither have the time nor the inclination to police their threads but surely you could focus on those who respond with scientific arguments rather than focus on those who seem to resort to vulgarities and ad hominems? Give it a try, ignore the namecalling and focus on the arguments. Of course, that's for more than one reason, not as easy as it sounds. But you have wasted so much energy and effort on name calling, imagine how much more useful that energy could have been when invested in self education, better scientific arguments and reduction in levels of ignorance. Hint: Do not blame others for your own actions and words, unless you are willing to grant them control over how you behave, and what you say.
jobby said: ... well I am in a gutter mind environment here. just want you to see how it feels to be subject to vulgarities asswipe

Wayne Francis · 13 October 2008

sorry hit submit to fast.

Hand Jobby's comment about robotics is a non sequitur. Robotics have no impact on the basic functions of a computer.

PvM · 13 October 2008

jobby said: A byte is 8 bits, did you not know? And it is hardly arbitrary either. Similarly our base 10 system is again hardly arbitrary, as anyone with two hands understands ... are you REALLY saying that no computers use bytes other than 8 bit bytes and are you REALLY saying that all human civilizations use the base 10 numbering system?? (can he really be that stupid? lets see how he responds!)
How hard is it to read AND comprehend what I say. Sure, there are some computers that used 'word sizes' that were different than '8 bytes' but in today's parlance, a byte is 8 bits. As to your question about human civilizations all using base 10, I never made that claim, I addressed your claim of 'arbitrarily' which ignores the logic for both base systems. In fact, none of the other base systems are arbitrary either.

PvM · 13 October 2008

On and Jobby, calling someone stupid makes your whining about how others treat you sound a little... well you know...
PvM said:
jobby said: A byte is 8 bits, did you not know? And it is hardly arbitrary either. Similarly our base 10 system is again hardly arbitrary, as anyone with two hands understands ... are you REALLY saying that no computers use bytes other than 8 bit bytes and are you REALLY saying that all human civilizations use the base 10 numbering system?? (can he really be that stupid? lets see how he responds!)
How hard is it to read AND comprehend what I say. Sure, there are some computers that used 'word sizes' that were different than '8 bytes' but in today's parlance, a byte is 8 bits. As to your question about human civilizations all using base 10, I never made that claim, I addressed your claim of 'arbitrarily' which ignores the logic for both base systems. In fact, none of the other base systems are arbitrary either.

jobby · 13 October 2008

Wayne Francis said:
jobby said: The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. ... you are forgetting about robotics.
Ok Hand Jobby, you once again have shown how stupid you are. We where talking about computer instructions. Even if you talk about computers that control robots they still only do those basic functions. They are just arranged, aka a program, to perform what ever operations is needed. a robot is just a mechanical device. It used to refer to devices that resembles a living creature. The line is now blurred as many robots don't resemble living creatures. Robots don't need any electronics either. Theo Jansen essentially builds wooden robots that are powered by the wind and able to walk down the beach. Not only that but they are able to avoid walking to far into the water. These "robots" have no computer code. So Blow Jobby, what is your complaint about my description of what computer code can do?
These "robots" have no computer code. .... what a moron. they all have stored instructions. now they are programming in DNA. (this guy is a complete idiot. acutally I thought Australians were a little more sophisticated. very unlike the British.)

jobby · 13 October 2008

a robot is just a mechanical device. It used to refer to devices that resembles a living creature.

... what a moron! I think he is thinking about robby the robot on TV.

... no dummy a robot does not 'resemble a living creature' ever been to a factory??

... you are astoudingly stupid

Wayne Francis · 13 October 2008

jobby said: So please don’t quote mine ... there was not quotemining. just because a quote does not agree with you does not mean it is mining. RD views the DNA as computer-like. I do not think that an out of context quote. quit bullshitting
This is coming from our "teacher" of Junior High School and college! Learn some grammar, learn to proofread. FFS learn to read. We have plenty of examples of you taking peoples words out of context, a.k.a. quote mining. Now you might not look at it as quote mining and you are probably taking peoples comments as absolute truth. We certainly know analogies and metaphors are lost on you. For the lurkers out there it would be telling someone that "beetles can fly because they have wings like birds" Hand Jobby takes this to the Nth degree and would say that the above comment says that the aerodynamics of a beetle's wing is the same as a birds wing. Hell the way he talk's it would be like saying that a beetles wings has feathers too. Blow Jobby doesn't know when to stop following an analogy. Where analogy and metaphor is a very useful teaching tool for most people it actually makes the situation worse with Hand Jobby.

PvM · 13 October 2008

Nice name calling and painting with a broad brush Jobby. If you have nothing to contribute then why respond? And why respond the way you do? Amazing WWJD
jobby said: .... what a moron. they all have stored instructions. now they are programming in DNA. (this guy is a complete idiot. acutally I thought Australians were a little more sophisticated. very unlike the British.)

jobby · 13 October 2008

I addressed your claim of ‘arbitrarily’ which ignores the logic for both base systems.

.... DDDDDDDDDDDUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHH!!!!!!!!!

.... an arbitrary choice can still be logical: like deciding every one should drive on the right side of the road. or that Greenwich is time = 0

( really whats the use. this is just getting cruel he is obviously mentally disabled)

PvM · 13 October 2008

For Jobby's education, which has almost become a full time job for me: Arbitraryis a term given to choices and actions which are considered to be done not by means of any underlying principle or logic, but by whim or some decidedly illogical formula. also 3 a: based on or determined by individual preference or convenience rather than by necessity or the intrinsic nature of something arbitrary standard> any arbitrary positive number> division of historical studies into watertight compartments — A. J. Toynbee> b: existing or coming about seemingly at random or by chance or as a capricious and unreasonable act of will a task is not seen in a meaningful context it is experienced as being arbitrary — Nehemiah Jordan> So why is jobby using ad hominems? Anyone willing to guess?
jobby said: I addressed your claim of ‘arbitrarily’ which ignores the logic for both base systems. .... DDDDDDDDDDDUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHH!!!!!!!!! .... an arbitrary choice can still be logical: like deciding every one should drive on the right side of the road. or that Greenwich is time = 0 ( really whats the use. this is just getting cruel he is obviously mentally disabled)

Wayne Francis · 13 October 2008

Jobby said:
PvM said: Sorry Jobby, you and I have the same right to be here, I even more than you since you have chosen to violate the rules of this board. I am not 'trolling on you', I am merely reminding you of your past failures which you seem intent on repeating. How sad.
jobby said:
PvM said: I am glad you recognize and acknowledge the nature of your own postings my dear confused friend. Have you found a measure for complexity of the human body already or have you given up? Have you familiarized yourself with the science of embryology? Let me know when you are ready
jobby said: This is really nothing but a troll fest. Very little intelligent responses.
.. why do you troll on me here when you do not want me in your threads. pretty weird!!
Well this site is one of the best arguments against Darwinism. Any neutral person reading it would be appalled by the language and dislogic of the Darwinists. And the hate that the Darwinists spew out is incredible Are all of you like this?
From our JHS/College teacher....a new word! Also calling you a troll has nothing to do with evolution. Evolution happens regardless of your trollish behavior
jobby said:
fnxtr said:
jobby said: The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. ... you are forgetting about robotics.
The stupid, it burns. The CPU in a robot works exactly the same way as any other. "Move the contents of register A to I/O device 1" (say a relay or solenoid) is no different from internal movement of data. You really are clueless, aren't you.
... and DUMMY then something happens in the really world. you really dont read very well do you??
Dear dear blow jobby!!! *shake's his head* do we read very well? Yes we read just fine. You don't but we do. You project far to much. Your huge post consisted of "...you are forgetting about robotics" it is like butting into a conversation about the latest football game and yelling "you are forgetting about the apple" and walking away. It no bearing on the conversation at hand. Even if you look at it from the standpoint that many robot have computers in them the instruction set they ultimately use is no different. This is because the basic instruction set of computers false straight out of the basic electronic components. Until quantum computers are more widely available don't expect that instruction set to get any bigger. fnxtr is completely right. The computers in robots are no different from the computer in front of me. Computers make things happen in the real world or as you put it the "really world". If you are talking about mechanics then look no further then your DVD drive. I'm still laughing at Blow Jobby the "JHS/College" teacher saying "really world". It sounds like something my friends 2 year old would say. She told me the other day that Santa is bringing her a "Castleine" she couldn't remember the word "trampoline". It is cute when she says it but just sad when someone like Blow Jobby writes like this.

Wayne Francis · 13 October 2008

Science Avenger said:
Malcolm said:
…Code is not data??
You obviously know nothing about computer programming either. No, in a computer code is not data. Code is a set of instruction. Data is what those instruction act upon.
That's really an amazing mistake for someone to make who presumes to lecture others on a topic. It's the equivalent of a football critic not understanding the concepts of "offense" and "defense".
good analogy Science Avenger, I can't wait to see if Blow Jobby comments on this and if he does how it totally misses the analogy.

Wayne Francis · 13 October 2008

jobby said:
Wayne Francis said:
jobby said: The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. ... you are forgetting about robotics.
Ok Hand Jobby, you once again have shown how stupid you are. We where talking about computer instructions. Even if you talk about computers that control robots they still only do those basic functions. They are just arranged, aka a program, to perform what ever operations is needed. a robot is just a mechanical device. It used to refer to devices that resembles a living creature. The line is now blurred as many robots don't resemble living creatures. Robots don't need any electronics either. Theo Jansen essentially builds wooden robots that are powered by the wind and able to walk down the beach. Not only that but they are able to avoid walking to far into the water. These "robots" have no computer code. So Blow Jobby, what is your complaint about my description of what computer code can do?
These "robots" have no computer code. .... what a moron. they all have stored instructions. now they are programming in DNA. (this guy is a complete idiot. acutally I thought Australians were a little more sophisticated. very unlike the British.)
Oh me oh my, Blow Jobby called me a name. Oh well. Let me address his actual post, something he is not capable of doing. Your grammar leaves a lot to be desired so I'll try to understand what you are saying.
blow jobby said: "These "robots" have no computer code. .... what a moron. they all have stored instructions."
I have to assume you are talking about the "robots" I was referring to that are made out of wood. http://myninjaplease.com/wp-content/uploads/2006/11/theo-jansen-animaris-percipiere-1.jpg warning the image is 3.5meg Please, tell me where the "Instructions" are in this robot.
hand jobby said: now they are programming in DNA.
Ok...not sure what this left field comment is about. What is the "they" you are talking about? Normally in a sentence like this the "they" would refer to something in the previous sentence. Seeing you used the word "they" in the previous sentence I again have to jump back to the previous sentence, which was a quote from me talking about the wooden robots. I'm really confused. Do you think the DNA in the wood has anything to do with the function of these types of robots in there movement, beyond of the fact that the DNA allowed the wood to grow from a seed in the first place that is. Finally I live in Australia, I'm an American born and bred. Served 6 years (1988-1994) in the USMC before coming to Australia. All of which has absolutely nothing to do with the fact that all my arguments against your stupidity are fully explained and in context where your arguments sound like they are coming from someone talking in their sleep.

Wayne Francis · 13 October 2008

jobby said: a robot is just a mechanical device. It used to refer to devices that resembles a living creature. ... what a moron! I think he is thinking about robby the robot on TV. ... no dummy a robot does not 'resemble a living creature' ever been to a factory?? ... you are astoudingly stupid
hmmmm let us look at some dictonaries
Websters says Robot [roh-buht] 1. a machine that resembles a human and does mechanical, routine tasks on command. 2. a person who acts and responds in a mechanical, routine manner, usually subject to another's will; automaton. 3. any machine or mechanical device that operates automatically with human like skill.
Oxford English Dictionary robot /robot/ • noun a machine capable of carrying out a complex series of actions automatically.
Please show me where you think my definition of a robot is incorrect. I specifically pointed out that in today's day and age robots are not limited by the way they look and are more defined by the fact that it is usually a mechanical device that can work automatically. The wooden robots above are mechanical devices and they do work automatically. Oh wait, I forgot I should not address the actual content of your post but just get hung up on the fact that you called me "astoundingly stupid" with absolutely no proof. Hand Jobby you are a troll that doesn't even read properly.

Science Avenger · 13 October 2008

Jobby said: you are again looking at things too simplisticly. 'code' is a subset of 'data' and 'data is also a subset of 'data'
Not even close. You are too ignorant to even be a good troll. Code is code and data is data. That's why in basic you have your code, and then you have a line that says "data". You are a moron, and worse yet, you are totally clueless that you are a moron.

Wayne Francis · 13 October 2008

jobby said: I addressed your claim of ‘arbitrarily’ which ignores the logic for both base systems. .... DDDDDDDDDDDUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHH!!!!!!!!! .... an arbitrary choice can still be logical: like deciding every one should drive on the right side of the road. or that Greenwich is time = 0 ( really whats the use. this is just getting cruel he is obviously mentally disabled)
First, what makes you think these things where "arbitrary"? Second...look up arbitrary in a a thesaurus
arbitrary (adj) Synonyms: random, chance, subjective, uninformed, illogical, capricious, indiscriminate, haphazard Antonym: systematic
Is English not your 1st language? You seem to not have a very good grasp on grammar, spelling, definitions....hell you don't have a very good grasp on any part of the English language. Perhaps you should write in your native tongue and we'll deal with the translation ourselves.

Science Avenger · 13 October 2008

Jobby said: ... i believe in the scientific method. i feel sorry for you for feeling that is 'cultlike' you should try to get out of the middle ages.
No you don't. You believe in speculation that pretends to be data, and that's when you aren't just asking ignorant questions. Your claim that code and data are the same thing seals the deal. You are an ignorant fuck who doesn't know shit from shinola.

fnxtr · 13 October 2008

jobby said:
fnxtr said:
jobby said: The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code. ... you are forgetting about robotics.
The stupid, it burns. The CPU in a robot works exactly the same way as any other. "Move the contents of register A to I/O device 1" (say a relay or solenoid) is no different from internal movement of data. You really are clueless, aren't you.
... and DUMMY then something happens in the really world. you really dont read very well do you??
Here's the complete paragraph as written by Wayne Francis:
In computers there are not a whole lot of instructions. The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code.
Then Yobbo went off on his tangent about robotics. The point was, the instructions are the same, whether you're managing payroll, drawing a window, or moving a printhead, it's all just bit manipulation. Biological chemistry is considerably more complicated, as everyone here has been taking great pains to try to explain. Let go of the orange, monkey.

Henry J · 13 October 2008

To a compiler, the source program being compiled is data, and the object code being output is treated as output data by the compiler itself, since it doesn't execute it.

To an interpreter, the code it interprets is in a sense the input data to the interpreter.

As for LISP, well, let's just treat that parenthetically for now.

Henry

fnxtr · 13 October 2008

Sorry, I skipped some posts so now that horse is really dead.

Wayne Francis · 13 October 2008

fnxtr said: ...removed to save space.... Then Yobbo went off on his tangent about robotics. The point was, the instructions are the same, whether you're managing payroll, drawing a window, or moving a printhead, it's all just bit manipulation. Biological chemistry is considerably more complicated, as everyone here has been taking great pains to try to explain. Let go of the orange, monkey.
I just have a mental image of Homer Simpson with his arm stuck up a soda machine with a rescue crew around him.
Rescuer #1 Homer, this...this is never easy to say. I'm going to have to saw your arms off. [raises up a buzz saw] Homer [plaintive] They'll grow back, right? Rescuer #1 Oh, er, yeah. Homer Whew! Rescuer #1 [just about to cut off Homer's arm] Rescuer #2 Are you just holding on to the can? Homer Your point being?
Not only does Hand Jobby not have enough brains to let the "can" go but he doesn't even get it when it is explained to him why.

Malcolm · 13 October 2008

Lets go through this one step at a time:

Jobby,

Do you believe that cells are analogous to computers, yes or no?

If yes, Please provide analogies for cellular organelles and processes.

If no, what the hell is your argument?

jobby · 14 October 2008

I have to assume you are talking about the “robots” I was referring to that are made out of wood. http://myninjaplease.com/wp-content[…]ipiere-1.jpg warning the image is 3.5meg

Please, tell me where the “Instructions” are in this robot.

.... are you REALLY saying a robot does not have store instructions?????

jobby · 14 October 2008

Do you believe that cells are analogous to computers, yes or no?

... no. Did you think I said that?? do you have reading problems??

jobby · 14 October 2008

Monkeys jump!!!

Dave Lovell · 14 October 2008

jobby said: Do you believe that cells are analogous to computers, yes or no? ... no. Did you think I said that?? do you have reading problems??
No, you probably never actualy said that, but you seem to have been arguing for weeks that DNA code executed by a cell is analogous to program code executed by a computer

jobby · 14 October 2008

No, you probably never actualy said that, but you seem to have been arguing for weeks that DNA code executed by a cell is analogous to program code executed by a computer

... probably never said that?? I NEVER said that. very poor reading skills here.

... and yes the DNA has many similarities to a computer code. I think most scientists would agree with that.

you do not think that the DNA stores instructions???

Science Avenger · 14 October 2008

Forty Seven!

Dave Lovell · 14 October 2008

jobby said: No, you probably never actualy said that, but you seem to have been arguing for weeks that DNA code executed by a cell is analogous to program code executed by a computer ... probably never said that?? I NEVER said that. very poor reading skills here. ... and yes the DNA has many similarities to a computer code. I think most scientists would agree with that. you do not think that the DNA stores instructions???
Okay, I'll rephrase that. I haven't got time to carefully re-read through forty-seven pages, but no, you probably never actualy said that. However, you seem to have been arguing for weeks that DNA code executed by a cell is analogous to program code executed by a computer. Of course DNA must carry "instructions", but they are more of the form "type www.pandasthumb.org into the first box in your browser window", than a the detailed sequence of tens of millions of simple machine opcodes required to achieve that task.

Wayne Francis · 14 October 2008

jobby said: I have to assume you are talking about the “robots” I was referring to that are made out of wood. http://myninjaplease.com/wp-content[…]ipiere-1.jpg warning the image is 3.5meg Please, tell me where the “Instructions” are in this robot. .... are you REALLY saying a robot does not have store instructions?????
You didn't even look at the robot did you. You don't know the definition of a robot and when someone tries to explain it to you all you do is ignore everything and spit out one liners that, if you actually paid attention, would have answered your questions to begin with. Hand Jobby you are not only a liar but you are an willfully ignorant liar.

fnxtr · 14 October 2008

jobby said: No, you probably never actualy said that, but you seem to have been arguing for weeks that DNA code executed by a cell is analogous to program code executed by a computer ... probably never said that?? I NEVER said that. very poor reading skills here. ... and yes the DNA has many similarities to a computer code. I think most scientists would agree with that. you do not think that the DNA stores instructions???
Yobbo has proven time and time again that it lacks the courage to say anything with any clarity, in case it is wrong. You can call it 'instructions' if you want to. It's also a physical template with regulatory areas. If we called it a cabinetmaker's jig to cut patterns on a lathe, you'd still take the analogy too far. It is what it is.

Wayne Francis · 14 October 2008

jobby said: No, you probably never actualy said that, but you seem to have been arguing for weeks that DNA code executed by a cell is analogous to program code executed by a computer ... probably never said that?? I NEVER said that. very poor reading skills here. ... and yes the DNA has many similarities to a computer code. I think most scientists would agree with that. you do not think that the DNA stores instructions???
Not in the way a computer does. DNA stores much more complex and intricate. You keep saying that other people have reading problems yet you have shown you don't even read replies to your questions fully. You seem to read one or 2 lines in and then reply with stupid ramblings. You are the last person that should be complaining about someone else not reading and understanding posts. You are a troll that thinks that a decision can be logical and arbitrary at the same time. Granted you probably don't know the definition of the former word. You have not shown any logical thinking in 46 pages of posts. A steam engine has similarities to a computer. Most scientist would agree to that on a superficial level also. Doesn't mean that it holds to the level you try to take it. So Blow Jobby, take a look at that wooden robot and you tell me where the "instructions" are held. I'll tell you again...there are no instructions. It is a mechanical robot....oh wait...maybe the robot gets the invisible "instructions" to operate, that no one but you seems to think it needs, from the same place as cells do to develop into what ever species they come from. For your tiny little brain Blow Jobby I'll tell you that I was just being sarcastic. Hand Jobby you are a willfully ignorant lying troll that can't grasp the concepts of analogies and metaphors. With each post you just show the entire world what an ass you are. You've been making the same statements for about a month now and have been told, in at least a hundred different ways, how and why your statements are logically faulty and you still don't get it. You can lead Blow Jobby to the truth but you can't make him understand it.

jobby · 14 October 2008

you do not think that the DNA stores instructions???

... so it DOES store instructions! well you admitted that. and that is the main point!

...JUMP MONKEYS!!!

jobby · 14 October 2008

So Blow Jobby, take a look at that wooden robot and you tell me where the “instructions” are.

.... what functions does this 'robot' do??

JUMP MONKEYS!!

Wayne Francis · 14 October 2008

fnxtr said:
jobby said: No, you probably never actualy said that, but you seem to have been arguing for weeks that DNA code executed by a cell is analogous to program code executed by a computer ... probably never said that?? I NEVER said that. very poor reading skills here. ... and yes the DNA has many similarities to a computer code. I think most scientists would agree with that. you do not think that the DNA stores instructions???
Yobbo has proven time and time again that it lacks the courage to say anything with any clarity, in case it is wrong. You can call it 'instructions' if you want to. It's also a physical template with regulatory areas. If we called it a cabinetmaker's jig to cut patterns on a lathe, you'd still take the analogy too far. It is what it is.
Blow Jobby sticks his foot in his mouth enough with his one liners. He has shown more then once that he doesn't even understand that 2 antonyms can't be used to describe the same thing. Thankfully the lurkers get to see how religious nut jobs like blow jobby are not capable of ever admitting that they are wrong. No matter what the evidence is. They are so extreme in their ignorance and denial that they'll deny their own statements that are often only a few posts away. So there is some good that comes out of Hand Jobby's posts. Most lurkers probably either skip Hand Jobby's post full stop or they read them for the comedic value. Perhaps we should feel sorry for someone as willfully ignorant as Hand Jobby but his stupidity still makes me chuckle a bit.

Wayne Francis · 14 October 2008

jobby said: you do not think that the DNA stores instructions??? ... so it DOES store instructions! well you admitted that. and that is the main point! ...JUMP MONKEYS!!!
Man you got the same disorder that JAD has. It has been explained to you that that "instructions" are several orders of magnitude different. Comparing the 2 is like comparing Doris Lessing to a 5 year old writing a story. They are no way near the same level. We are all happy to point out your stupidity over and over.

Wayne Francis · 14 October 2008

jobby said: So Blow Jobby, take a look at that wooden robot and you tell me where the “instructions” are. .... what functions does this 'robot' do?? JUMP MONKEYS!!
Well if you spent a few seconds and read my posts you would know already. I thought you had great reading skills Blow Jobby? Oh wait you think
jobby said: ... an arbitrary choice can still be logical...
Blow Jobby fails again.

Dave Lovell · 14 October 2008

jobby said: you do not think that the DNA stores instructions??? ... so it DOES store instructions! well you admitted that. and that is the main point! ...JUMP MONKEYS!!!
Forgive me (I was without Internet access for a week and a half in the middle of this thread), but I thought the main point was that you didn't think the 6Gbits (i.e 750 Megabytes) required to store the description of the Genome on a computer were sufficient to encode all the instructions required to build a human, and therefore a fertilised human egg could not grow into a human without some additional unspecified assistance. Perhaps you should plan to commemorate hitting fifty pages on this thread by giving us a concise statement of what you actually think about whatever you have been going on about for so long

jobby · 14 October 2008

...Why does R. Dawkins say

'DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too' ???

JUMP MONKEYS!!

jobby · 14 October 2008

Forgive me (I was without Internet access for a week and a half in the middle of this thread),

... well you know Mom was going to eventually take it away from you if you kept up with your bad behavior!

JUMP MONKEYS!

Wayne Francis · 14 October 2008

jobby said: ...Why does R. Dawkins say 'DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too' ??? JUMP MONKEYS!!
Blow Jobby, the one that complains that everyone else can't read forgets I answered this question in the following post http://pandasthumb.org/archives/2008/09/luskin-and-the- 2.html#comment-169899 Must be sad to be Hand Jobby and not be able to remember something from just over 24 hours ago. It explains a lot but still a bit sad for him.

Wayne Francis · 14 October 2008

http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-169899

jobby · 14 October 2008

Wayne Francis said:
jobby said: ...Why does R. Dawkins say 'DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too' ??? JUMP MONKEYS!!
Blow Jobby, the one that complains that everyone else can't read forgets I answered this question in the following post http://pandasthumb.org/archives/2008/09/luskin-and-the- 2.html#comment-169899 Must be sad to be Hand Jobby and not be able to remember something from just over 24 hours ago. It explains a lot but still a bit sad for him.
... you didnt address the issue! JUMP MONKEYS!

Wayne Francis · 14 October 2008

jobby said:
Wayne Francis said:
jobby said: ...Why does R. Dawkins say 'DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too' ??? JUMP MONKEYS!!
Blow Jobby, the one that complains that everyone else can't read forgets I answered this question in the following post http://pandasthumb.org/archives/2008/09/luskin-and-the- 2.html#comment-169899 Must be sad to be Hand Jobby and not be able to remember something from just over 24 hours ago. It explains a lot but still a bit sad for him.
... you didnt address the issue! JUMP MONKEYS!
Blow Jobby can't even comprend his own question. Question:
...Why does R. Dawkins say 'DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too' ???
Answer:
Yes, Richard Dawkins did say that. It is an analogy. It is a way to get someone with no understanding of genetic a slightly better understanding of it.
That did address the issue. Blow Jobby, the willfully ignorant lying troll, fails again.

Dave Lovell · 14 October 2008

jobby was asked politely: Forgive me (I was without Internet access for a week and a half in the middle of this thread), but I thought the main point was that you didn't think the 6Gbits (i.e 750 Megabytes) required to store the description of the Genome on a computer were sufficient to encode all the instructions required to build a human, and therefore a fertilised human egg could not grow into a human without some additional unspecified assistance. Perhaps you should plan to commemorate hitting fifty pages on this thread by giving us a concise statement of what you actually think about whatever you have been going on about for so long
and he replied: … well you know Mom was going to eventually take it away from you if you kept up with your bad behavior!
Well jobby, when your career as a Scientist begins to wane, a second glittering career as a comedian clearly awaits. Then, within three minutes, he accuses Wayne Francis thus: … you didnt address the issue!

Dave Lovell · 14 October 2008

Wayne Francis said: Answer:
Yes, Richard Dawkins did say that. It is an analogy. It is a way to get someone with no understanding of genetics a slightly better understanding of it.
WRONG! WRONG! WRONG! Wayne, and Jobby is the living breathing proof.

Wayne Francis · 14 October 2008

Dave Lovell said:
Wayne Francis said: Answer:
Yes, Richard Dawkins did say that. It is an analogy. It is a way to get someone with no understanding of genetics a slightly better understanding of it.
WRONG! WRONG! WRONG! Wayne, and Jobby is the living breathing proof.
To true, but I do it for 2 reasons. 1 to show to any late coming lurkers that he is a troll and 2 to make myself look smarter. Much like standing next to someone that is ugly makes you look better. :)

Robin · 14 October 2008

jobby said: .... an arbitrary choice can still be logical: like deciding every one should drive on the right side of the road. or that Greenwich is time = 0
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!! That has to be the funniest contradiction and examples that do not support the premise I've read in a long time! Thanks for the great chuckle Jobo!

Henry J · 14 October 2008

If driving on the right is logical, what about the British?

The choice of Greenwich wasn't arbitrary; they wanted the 180 degree line to cross as little land as possible, and that criteria put the 0 degree line through England.

http://www.worldtimezone.com/

Robin · 14 October 2008

Henry J said: If driving on the right is logical, what about the British?
No no...driving in a car is arbitrary, but everyone being in gridlock at the same time of the day (because they are all driving the same direction on the same side of the road) is logical...

jobby · 14 October 2008

... Conventions can be Arbitrary!!

JUMP MONKEYS!!!!

PvM · 14 October 2008

Sigh... Still unable to apply logic and knowledge.
jobby said: ... Conventions can be Arbitrary!! JUMP MONKEYS!!!!

PvM · 14 October 2008

Yes, Jobby's 'arguments' are seldomly free from contradiction. Such is the position of someone who seems unable to acquire knowledge and apply it.
Robin said:
jobby said: .... an arbitrary choice can still be logical: like deciding every one should drive on the right side of the road. or that Greenwich is time = 0
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!! That has to be the funniest contradiction and examples that do not support the premise I've read in a long time! Thanks for the great chuckle Jobo!

jobby · 14 October 2008

Yes, Jobby’s ‘arguments’ are seldomly free from contradiction. Such is the position of someone who seems unable to acquire knowledge and apply it.

.... PvM is the most consistent monkey but Wayne jumps quicker.

JUMP MONKEYS!!!

PvM · 14 October 2008

How funny, how sad, notice lurkers to what Jobby has been reduced just because one has asked him to support his claims. WWJD
jobby said: Yes, Jobby’s ‘arguments’ are seldomly free from contradiction. Such is the position of someone who seems unable to acquire knowledge and apply it. .... PvM is the most consistent monkey but Wayne jumps quicker. JUMP MONKEYS!!!

jobby · 14 October 2008

How funny, how sad, notice lurkers to what Jobby has been reduced just because one has asked him to support his claims.

...PvM, my best trained, has NEVER supported his claims.

JUMP MONKEYS!!

PvM · 14 October 2008

Now Jobby is misrepresenting fact as well, how much lower can we expect Jobby to go? WWJD Jobby?
jobby said: How funny, how sad, notice lurkers to what Jobby has been reduced just because one has asked him to support his claims. ...PvM, my best trained, has NEVER supported his claims. JUMP MONKEYS!!

jobby · 14 October 2008

A steam engine has similarities to a computer.

... actually you are wrong. very few similarites. now DNA and computer code are very similar

JUMP MONKEYS!!!

Henry J · 14 October 2008

Re "DNA and computer code are very similar"

What's the DNA equivalent of

int f(int arr[],int size){int i,sum;for(i=0;i<size;i++){sum+=arr[i]);return sum;}

?

jobby · 14 October 2008

Henry J said: Re "DNA and computer code are very similar" What's the DNA equivalent of int f(int arr[],int size){int i,sum;for(i=0;i<size;i++){sum+=arr[i]);return sum;} ?
010010100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 01010001010100101010010100100010100101010111010100101010 10100100010101001010100101001000101001010101110101001010 10101001000101010010101001010010001010010101011101010010 10101010010001010100101010010100100010100101010111010100 1010101010 JUMP MONKEYS!!

PvM · 14 October 2008

Another content free posting from our dear confused friend Jobby.

Remind us again J. what is the information content of the human body.

Take your time.

Looking forward to your response.

Christian Monkey

fnxtr · 14 October 2008

(Michael Palin looming over Jonathan Pryce): "We've lost him."

jobby · 14 October 2008

what is the information content of the human body.

Take your time.

... first YOU tell me the information content of human DNA!

JUMP MONKEYS!!

PvM · 14 October 2008

I have no idea. I thought you had an argument, I guess you have as usual nothing much to offer other than a confused claim about home many bytes are needed to store human DNA. Based on this you make the foolish assertion that somehow the information is insufficient. Sigh.
jobby said: what is the information content of the human body. Take your time. ... first YOU tell me the information content of human DNA! JUMP MONKEYS!!

Stanton · 14 October 2008

Is this how you teach your classes, jobby/bobby/jacob/hamstrung/goff? By demanding that they tell you what they know of the subject, then dismissing what they said so you can insult them?
jobby said: what is the information content of the human body. Take your time. ... first YOU tell me the information content of human DNA! JUMP MONKEYS!!

Dave Lovell · 14 October 2008

jobby said: 010010100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 01010001010100101010010100100010100101010111010100101010 10100100010101001010100101001000101001010101110101001010 10101001000101010010101001010010001010010101011101010010 10101010010001010100101010010100100010100101010111010100 1010101010 JUMP MONKEYS!!
As the say in my business, there are only 10 types of people in this world; those who understand binary and those who don't. Which group are you in?

jobby · 14 October 2008

Based on this you make the foolish assertion that somehow the information is insufficient.

.... did not say that! said data insufficient either way

... you are my best trained monkey. go get yourself a bannana

Where are the other monkeys??

JUMP MONKEYS!!

jobby · 14 October 2008

Which group are you in?

... hex is best.

JUMP MONKEYS!!

Stanton · 14 October 2008

So do you also call your students "trained monkeys," too? Wouldn't your principal and or dean, not to mention the students' parents and legal guardians, strongly object to such behavior?
jobby said: Based on this you make the foolish assertion that somehow the information is insufficient. .... did not say that! said data insufficient either way ... you are my best trained monkey. go get yourself a bannana Where are the other monkeys?? JUMP MONKEYS!!

jobby · 14 October 2008

s this how you teach your classes, jobby/bobby/jacob/hamstrung/goff?

By demanding that they tell you what they know of the subject, then dismissing what they said so you can insult them?

... class control is important!!

JUMP MONKEYS!!

Henry J · 14 October 2008

Where are all the monkeys that are supposed to be jumping?

jobby · 14 October 2008

Henry J said: Where are all the monkeys that are supposed to be jumping?
..good monkey. you jumped. but a little late. only 1/2 bananana for you! JUMP MONKEYS!!

Stanton · 14 October 2008

How is insulting students by calling them "monkeys" a form of class control? Wouldn't people be suing you and your superiors for child abuse? Last I checked, in any educational setting, insulting students for whatever reasons is an offense punishable by immediate termination.
jobby said: s this how you teach your classes, jobby/bobby/jacob/hamstrung/goff? By demanding that they tell you what they know of the subject, then dismissing what they said so you can insult them? ... class control is important!! JUMP MONKEYS!!

jobby · 14 October 2008

How is insulting students by calling them “monkeys” a form of class control?

...good monkey. but try to be quicker next time. no banana!

JUMP MONKEYS!!

Stanton · 14 October 2008

So, in other words, everything you've ever said about anything, from being an alleged teacher/college professor, to accepting the scientific method is just pure bullshit.
jobby said: How is insulting students by calling them “monkeys” a form of class control? ...good monkey. but try to be quicker next time. no banana! JUMP MONKEYS!!

Science Avenger · 14 October 2008

48 pages entertaining the mentally ill. Do I hear 49?

PvM · 14 October 2008

Working on it... 49 pages... here we come.

Note that a large proportion are the usual content free contributions by Jobby, avoiding dealing with any evidence presented to him.

Children and monkeys, this is your brain on Intelligent Design, you have been warned ;-)

Henry J · 14 October 2008

Hey, monkeys aren't a monophyletic group. See http://www.tolweb.org/primates/15963

Wayne Francis · 14 October 2008

jobby said:
Henry J said: Re "DNA and computer code are very similar" What's the DNA equivalent of int f(int arr[],int size){int i,sum;for(i=0;i<size;i++){sum+=arr[i]);return sum;} ?
010010100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 0100010101001010100101001000101001010101110101001010101010 01010001010100101010010100100010100101010111010100101010 10100100010101001010100101001000101001010101110101001010 10101001000101010010101001010010001010010101011101010010 10101010010001010100101010010100100010100101010111010100 1010101010 JUMP MONKEYS!!
You do realise that we don't care about your "Jump Monkeys" comments right?!?!?! We don't respond to you for your benifit. We respond to your stupid post to make it clear to lurkers just how stupid you are. Just like your response shows your total lack of understanding on any level. You did not answer the question in any logical manner 1st DNA isn't binary. 2nd your binary means nothing in the context of the question For the lurkers there is no DNA equivalent to that piece of code. The code is very simple. Given an array of size n it returns the sum of all the elements in that array. DNA doesn't naturally add up n number of integers any more then computer code can regulate down stream genes to give you a thumb where a thumb normally develops. That is the responsibility of SHH not any operation that can be done on registers within a computer. The binary gibberish Hand Jobby puts on the screen in the hopes of fooling only himself, because he knows no one will let him get away with lying, is just 765bits of nothing. It means nothing in relation to the question and in all likely hood means nothing more then Hand Jobby randomly tapping on 2 different keys 765 times. Funny enough it has exactly the same "information" content as all of Jobby's other posts if you took them seriously...zero, nothing, nada, zilch, нищо, res, 无, ništa, nic, ingenting, niets, wala, ei mitään, rien, כלום, 何もない, nichts, ничего Blow Jobby fails to even understand the question again but that doesn't stop him because he is a willfully ignorant lying troll.

jobby · 14 October 2008

Note that a large proportion are the usual content free contributions by Jobby, avoiding dealing with any evidence presented to him.

... actually very little is from me. Mostly my monkeys jumping up and down that are taking most of the space here. But they are MY well trained monkeys.

MONKEYS JUMP!!

jobby · 14 October 2008

1st DNA isn’t binary.

.. no one said it was. but information can be represented as binary for analysis purposes!

JUMP MONKEYS JUMP!!

jobby · 14 October 2008

765bits of nothing

... where is that??

jobby · 14 October 2008

jobby said: 765bits of nothing ... where is that??
Guess I really dont have to command JUMP!. My well trained monkeys know what to do!

Science Avenger · 14 October 2008

My god, he's sunk to the "I knew you were going to do that" level.

And yet it continues.

Wayne Francis · 14 October 2008

jobby said: Based on this you make the foolish assertion that somehow the information is insufficient. .... did not say that! said data insufficient either way ... you are my best trained monkey. go get yourself a bannana Where are the other monkeys?? JUMP MONKEYS!!
Man Blow Jobby's pea brain strikes again. We've gone over this a few times before. Here is a post from me back on page 23 that shows him saying just that over a dozen times. http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-168353 And I know he at least saw it because the very next post http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-168360 he replies claiming that I was quote mining him by quoting his posts in full context only bold facing the text where he made the claims that DNA isn't enough. Blow Jobby thinks by making comments like "JUMP MONKEYS" that we'll stop calling him on his lies. Just because we reply to your post Blow Jobby doesn't mean the world revolves around you. It might take me 12 hours to respond to your idiotic posts but I do have a life unlike you. To everyone else, I'm off to Melbourne for the International Tap Festival in about 16 hours so have fun with the willfully ignorant lying troll named Jobby.

tresmal · 14 October 2008

"JUMP MONKEYS" said the feces throwing macaque.

Wayne Francis · 14 October 2008

jobby said: 765bits of nothing ... where is that??
Note once again Blow Jobby doesn't even remember what he posted himself just a few hours earlier while claiming others have a reading problem. For those that are having a problem following Hand Jobby's posts, the one I've replied to in this post is in reference to my post found at http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170119 where I used "reply" on one of his posts. So Blow Jobby just proves that he typed in 765 random bits because he doesn't even recognize that how many bits he typed it even though my his post is staring him in the face. Once again hand jobby proves he is a willfully ignorant lying troll.

Wayne Francis · 14 October 2008

Science Avenger said: My god, he's sunk to the "I knew you were going to do that" level. And yet it continues.
Well I can teach a worm to always turn left too. He was bound to finally figure out that every time he lies that he'll be called on it. He is really struggling now as even his one liners are weak.

Henry J · 14 October 2008

Besides, no matter how many bananas he gives to the alleged monkeys, his claims are still fruitless.

Henry

Dale Husband · 15 October 2008

Wow, is this still going on? I've heard of beating a dead horse, but this one is already reduced to a skeleton.

Here is all the evidence that jobby has been persistently ignoring:

http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-169391

jobby · 15 October 2008

So Blow Jobby just proves that he typed in 765 random bits because he doesn’t even recognize that how many bits he typed

... you counted them??? hahahahah! you dont have anything better to do than to count 1s and 0s. wow.

hey tell me how many are here:

1001010100010101010010010101011110101010101010100100
1001010100010101010010010101011110101010101010100111
10010101000101010100100101010111101010101010101001100101010001010101001001010101111010101010101010011001010100010101010010010101011110101010101010100110010101000101010100100101010111101010101010101001
10010101000101010100100101010111101010101010101001

GOOD MONKEY!!

jobby · 15 October 2008

It might take me 12 hours to respond to your idiotic posts but I do have a life unlike you.

.... you'll be back!! GOOD MONKEY!

jobby · 15 October 2008

Here is all the evidence that jobby has been persistently ignoring:

http://pandasthumb.org/archives/200[…]mment-169391

... you actually search thru old posts and then cut an paste the URL??

jeez I have better things to do

but you do entertain me!

GOOD MONKEY!!

Wayne Francis · 15 October 2008

jobby said: So Blow Jobby just proves that he typed in 765 random bits because he doesn’t even recognize that how many bits he typed ... you counted them??? hahahahah! you dont have anything better to do than to count 1s and 0s. wow. hey tell me how many are here: 1001010100010101010010010101011110101010101010100100 1001010100010101010010010101011110101010101010100111 10010101000101010100100101010111101010101010101001100101010001010101001001010101111010101010101010011001010100010101010010010101011110101010101010100110010101000101010100100101010111101010101010101001 10010101000101010100100101010111101010101010101001 GOOD MONKEY!!
No Hand Jobby I didn't count them. A program counted them. Hell I don't even read these post. My computer reads them to me. Personally I like Neospeech's Paul voice but if I'm doing listenning to anything in french then I have the french spoken to me using AT&T Lab's Arnaud voice before having the text translated in to English and then I use the Neospeech Paul voice. Thank you for your concern that I am spending to much time on your posts but it doesn't take long point out how stupid your posts actually are you lying ignorant troll. You spent longer randomly tapping 1's and 0's then I did dictating my reply. I still think it is funny that it took you this long to figure out what I was talking about though. A 5 year old just learning to read wouldn't have had that much trouble. Do you take medication for your delusions of being a JHS/College teacher?

jobby · 15 October 2008

No Hand Jobby I didn’t count them.

...GOOD MONKEY!!

... Do you believe in Darwinism??

Dan · 15 October 2008

This thread is about "Luskin and the ID movement on immunology: immune to evidence". "jobby" thinks that his comment
jobby said: ... you counted them??? hahahahah! you dont have anything better to do than to count 1s and 0s. wow. hey tell me how many are here: 1001010100010101010010010101011110101010101010100100 1001010100010101010010010101011110101010101010100111 10010101000101010100100101010111101010101010101001100101010001010101001001010101111010101010101010011001010100010101010010010101011110101010101010100110010101000101010100100101010111101010101010101001 10010101000101010100100101010111101010101010101001 GOOD MONKEY!!
is related to this thread's topic.

jobby · 15 October 2008

No Hand Jobby I didn’t count them. A program counted them. Hell I don’t even read these post. My computer reads them to me. Personally I like Neospeech’s Paul voice but if I’m doing listenning to anything in french then I have the french spoken to me using AT&T Lab’s Arnaud voice before having the text translated in to English and then I use the Neospeech Paul voice.

... is this comment related to the thread??

JUMP MONKEY!!

Wayne Francis · 15 October 2008

Have fun with the troll everyone. I'm off for 5 days to Melbourne for a International Tap Festival. I can see the willfully ignorant lying troll named Hand Jobby still ignores everything pointed out to him. I'm sure I'll have some laughs when I catch up on threads when I get back.

bientôt

jobby · 15 October 2008

Wayne Francis said: Have fun with the troll everyone. I'm off for 5 days to Melbourne for a International Tap Festival. I can see the willfully ignorant lying troll named Hand Jobby still ignores everything pointed out to him. I'm sure I'll have some laughs when I catch up on threads when I get back. bientôt
... the hotels should have internet so you can check in. be a GOOD MONKEY!

fnxtr · 15 October 2008

Okay, now it doesn't even care that it's wrong, it just wants attention. You broke it, guys.

phantomreader42 · 15 October 2008

Stanton said: So, in other words, everything you've ever said about anything, from being an alleged teacher/college professor, to accepting the scientific method is just pure bullshit.
jobby said: How is insulting students by calling them “monkeys” a form of class control? ...good monkey. but try to be quicker next time. no banana! JUMP MONKEYS!!
Hasn't this been obvious for months? Everyone knows this asshat is here for one reason and one reason only: Mental masturbation. He's the intellectual equivalent of a drunken bum jerking off on a street corner. Wearing the obligatory tinfoil hat, of course. There has never been any substance to anything he says, and there never will be. And he doesn't CARE. It's nothing but incoherent babbling. In conclusion, Bobby the boob is a worthless lying sack of shit and all his future comments should be automatically deleted as spam.

fnxtr · 15 October 2008

... or just ignored like the old gum wrapper on the sidewalk.

Henry J · 15 October 2008

The sad thing here is that the chemical gradient thing mentioned earlier could have made an interesting discussion, if the environment in this thread had permitted it.

Henry

Malcolm · 15 October 2008

jobby said: Do you believe that cells are analogous to computers, yes or no? ... no. Did you think I said that?? do you have reading problems??
The troll forgot to answer the next question; If no, what is your point?

Cobby · 15 October 2008

Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey.

I pulled the rug from under their beliefs systems which threw them into a terrible tizzy and then came the dirty language. You can always tell when they have not logical repsonses that is when they start the primitive vulgarities.

Henry J · 15 October 2008

I see the train wreck has fallen off the front page. Will that slow it down, or has everybody bookmarked it?

iml8 · 15 October 2008

I propose to beat this record by insisting that the
Moon is made of green cheese and going to at least a
HUNDRED pages blowing off all attempts to convince me
otherwise.

White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

Malcolm · 15 October 2008

Cobby said: Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey. I pulled the rug from under their beliefs systems which threw them into a terrible tizzy and then came the dirty language. You can always tell when they have not logical responses that is when they start the primitive vulgarities.
So you basically asked for a course in basic biology, and then got upset when no one provided you with one. I would suggest that you read a first year biology, biochemistry or genetics textbook. You'll usually find all of those points covered in within the first 10 or so chapters. Until you have actually shown that you have any understanding of the subject, STFU.

PvM · 15 October 2008

Jobby is now plainly not telling the truth. Why is that? You be the judge.
Malcolm said:
Cobby said: Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey. I pulled the rug from under their beliefs systems which threw them into a terrible tizzy and then came the dirty language. You can always tell when they have not logical responses that is when they start the primitive vulgarities.
So you basically asked for a course in basic biology, and then got upset when no one provided you with one. I would suggest that you read a first year biology, biochemistry or genetics textbook. You'll usually find all of those points covered in within the first 10 or so chapters. Until you have actually shown that you have any understanding of the subject, STFU.

Henry J · 15 October 2008

I propose to beat this record by insisting that the Moon is made of green cheese and going to at least a HUNDRED pages blowing off all attempts to convince me otherwise.

Nonsense. If it's cheese, it's obvious Swiss cheese - the craters are where the surface collapsed into the holes!!1111!!eleven!! Henry

Stanton · 15 October 2008

Actually, Malcolm, people did offer sockpuppet numerous examples, both to satisfy sockpuppet's inane, yet imperious demands, and to point out how moronic sockpuppet's arrogant claims are/were. However, sockpuppet refused to acknowledge that his demands were met, and that his claims were stupid. In fact, one time when I asked him to present the evidence that the human genome was informationally insufficient, he responded by accusing me of being a liar. sockpuppet is too dim to notice or care that he has not once provided any evidence to counter Evolutionary Biology, nor does he care that degenerating into a lapse of shouting nothing but "JUMP MONKEY" does not constitute "pulling the rug out of under (our) belief system," nor does he care or realize that we provided him with countless examples of Evolutionary Biology.
Malcolm said:
Cobby/jobby/bobby/jacob/hamstrung/balanced/goff lied: Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey. I pulled the rug from under their beliefs systems which threw them into a terrible tizzy and then came the dirty language. You can always tell when they have not logical responses that is when they start the primitive vulgarities.
So you basically asked for a course in basic biology, and then got upset when no one provided you with one. I would suggest that you read a first year biology, biochemistry or genetics textbook. You'll usually find all of those points covered in within the first 10 or so chapters. Until you have actually shown that you have any understanding of the subject, STFU.

Stanton · 15 October 2008

Because he's a troll out to aggravate people, even though he winds up looking like a gibbering idiot in the process?
PvM said: Jobby is now plainly not telling the truth. Why is that? You be the judge.

Dave Lovell · 16 October 2008

Cobby said: .... studies showing that there is enough info in the DNA to contruct a human body. None of these were produced.
How about several live human births every second of every day. Seems pretty convincing proof that at the very least a single fertilised human egg contains enough information to build a human. The DNA information could be a pointer used to address the complete instruction manual through a wormhole into a parallel universe, but this seems a bit unlikely. So do you think that a single fertilised cell stores all the information required somehow? There is simply nowhere to store significantly more information in the cell without a major breakthough in particle physics, unless you are proposing the DNA actually spirals around the real source of most of the information, a very fine hair from the mane of the Invisible Pink Unicorn. Investigating how the information in the DNA controls development is currently yielding very beneficial knowledge, and if it ever ceases to, the gaps in understanding that remain will indicate the direction of future research. Until then you are free to pursue your researches in that direction without having to worry that someone else will beat you to the Nobel Prize. If, at some point in the future, a genetic engineer offers to create the genome that specifies your ideal partner, and grows it from a single cell before your eyes, would you consider this proof, or still claim the result was the product of an intelligent designer?. (i.e. the genetic engineer, not you, in case that is not clear)

cobby · 16 October 2008

If, at some point in the future, a genetic engineer offers to create the genome that specifies your ideal partner, and grows it from a single cell before your eyes, would you consider this proof, or still claim the result was the product of an intelligent designer?.

... that would be proof. And why do you feel any doubting of Darwinism means a person infers an intelligent designer? Seems like you are thinking too simplistically. Could a third or nth alternative.

... but there as some big, big problems in the present theory and to just close your eyes and say 'Darwin-did-it' and not doubt your FAITH simply is not science.

cobby · 16 October 2008

I would suggest that you read a first year biology, biochemistry or genetics textbook. You'll usually find all of those points covered in within the first 10 or so chapters.
Until you have actually shown that you have any understanding of the subject, STFU.

... well cut and paste where these concepts are brought up or tell us in YOUR own words. Seems like you never must have taken any of these courses or else you would be aware of what the syllabi consist of.

PvM · 16 October 2008

Good thing that scientists do not act according to the stereotype of Jobby, who seems to be projecting.
cobby said: If, at some point in the future, a genetic engineer offers to create the genome that specifies your ideal partner, and grows it from a single cell before your eyes, would you consider this proof, or still claim the result was the product of an intelligent designer?. ... that would be proof. And why do you feel any doubting of Darwinism means a person infers an intelligent designer? Seems like you are thinking too simplistically. Could a third or nth alternative. ... but there as some big, big problems in the present theory and to just close your eyes and say 'Darwin-did-it' and not doubt your FAITH simply is not science.

PvM · 16 October 2008

Bobby's ignorance of biology has been well demonstrated. What more to do?..
cobby said: I would suggest that you read a first year biology, biochemistry or genetics textbook. You'll usually find all of those points covered in within the first 10 or so chapters. Until you have actually shown that you have any understanding of the subject, STFU. ... well cut and paste where these concepts are brought up or tell us in YOUR own words. Seems like you never must have taken any of these courses or else you would be aware of what the syllabi consist of.

cobby · 16 October 2008

Bobby’s ignorance of biology has been well demonstrated. What more to do?..

...actually PvM has demonstrated HIS ignorance. he is unable to read a simple text and paraphrase. he can only regurgitate!

GOOD MONKEY!!

cobby · 16 October 2008

Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey

... the monkeys simply cannot produce validation for the above. Then they get upset and start spitting and pounding. Just watch!

Dave Lovell · 16 October 2008

I asked cobby: If, at some point in the future, a genetic engineer offers to create the genome that specifies your ideal partner, and grows it from a single cell before your eyes, would you consider this proof, or still claim the result was the product of an intelligent designer?.
and cobby replied: ... that would be proof. And why do you feel any doubting of Darwinism means a person infers an intelligent designer? Seems like you are thinking too simplistically. Could a third or nth alternative.
But I have never mentioned Darwin. His opinion on whether there is enough information in the Human Genome would be no more informed than Isaac Newton's opinion on whether Windows Vista could be distributed on a single CD. I mentioned the intelligent designer only because of a previous response by your friend jobby. I tried illustrate that precise specification was not needed to build a limb of a specific length, as muscle, skin, bone would ajust themselves according to their local environment To this end I asked jobby:
Are you aware that some people have their limb length corrected by breaking bones and slowly jacking the ends apart as the bone grows? Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely?
and on September 29, 2008 at 6:21 jobby replied:
.….….DDDDDDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHH!!!!!!!!!! that lengthening is done by ID. The amount of bits of information used by the humans doing that is enormous. You really dont get all of this do you?
; So do you think there is sufficient information in a fertilised human egg cell to build a human, regardless of how the information was generated? I have never expressed an opinion on how that information was generated, only that it must be there somewhere. The man or woman who finds a much larger source of information in the cell is destined for scientific immorality

Dave Lovell · 16 October 2008

Dave Lovell said: ...is destined for scientific immorality
It should of course have read "is destined for scientific immortality"

cobby · 16 October 2008

So do you think there is sufficient information in a fertilised human egg cell to build a human, regardless of how the information was generated?

... could be. I really do not know. Neither does anyone. That is my point. To assume it is all in there without measuring or experimenting is FAITH not science.

cobby · 16 October 2008

Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely?

... this lengthening is being controlled by an intelligence and the instructions are not completely in the DNA

s1mplex · 16 October 2008

Cobby:
… this lengthening is being controlled by an intelligence and the instructions are not completely in the DNA
Why does god hate midgets? :(

cobby · 16 October 2008

s1mplex said: Cobby:
… this lengthening is being controlled by an intelligence and the instructions are not completely in the DNA
Why does god hate midgets? :(
... you believe in God??

PvM · 16 October 2008

How is your reading on embryology going? Any updates? Your ignorance should not be a constraint on science, and thank God it isn't.
cobby said: So do you think there is sufficient information in a fertilised human egg cell to build a human, regardless of how the information was generated? ... could be. I really do not know. Neither does anyone. That is my point. To assume it is all in there without measuring or experimenting is FAITH not science.

PvM · 16 October 2008

ROTFL...
cobby said: Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely? ... this lengthening is being controlled by an intelligence and the instructions are not completely in the DNA

Robin · 16 October 2008

cobby said: Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely? ... this lengthening is being controlled by an intelligence and the instructions are not completely in the DNA
Are you proposing a hypothesis concerning some as yet undetectable information stream and as yet undetectable information broadcast mechanism that comes from this as yet undetected intelligence and feeds your presumed insufficient information in the DNA? Could invisible pink unicorns or Keebler elves be ferrying this information for bone shape and size from this supposed intelligent source to the genes? Or some other mechanism? If so, how do you propose to test for this as yet undetectable (and dare I say completely unnecessary) process? If you are not proposing such a hypothesis and test than your last 50 pages worth of ranting amounts to (scientifically speaking): who cares?

Saddlebred · 16 October 2008

Wow.

Jump Monkeys Jump.

Just wow.

How do ya like them apples?

Henry J · 16 October 2008

But monkeys like bananas!11!one!

phantomreader42 · 16 October 2008

No, we all know this isn't true. You demanded studies that you never had any intention of reading. When they were provided, you lied about reading them. You declared, on the basis of no evidence whatsoever, that there wasn't enough info in DNA to construct a human body, and when called on this you denied ever making the claim, even with the quotes right in front of you. You have been polluting this site with your incoherent babbling and baldfaced lies for months. You keep whining that no one is meeting your idiotic demands, but we all know you aren't making those demands in good faith. Every single time a reference has been provided to you, you have proven that you never had any intention of even reading it. You won't even bother keeping your lies consistent. You keep denying everything you've ever said, then repeating the same bullshit again. YOU are the one spitting and pounding and flinging your own feces in every direction. It's all you've ever been able to do, all you ever will be able to do. You are a worthless lying sack of shit. This is creationism in a nutshell, folks. Endless lying, frantic mental masturbation, mindless shit-flinging, total immunity to evidence. If this overindulged troll had ever had the slightest speck of evidence for any of his asinine claims, he could have just posted it. Yet not once, in all the months he has been babbling here, has he ever even ATTEMPTED to do so. Countless times, his demands for evidence have been answered, and every single time, he has rejected the facts without even looking at them. He doesn't even pretend to read anything anymore. He just hides out in his tiny little bubble of delusion, wallowing in his own filth, flinging shit at everyone who dares live in the real world. The very idea of evidence terrifies him. And he will say anything, no matter how ridiculous, to avoid having to listen to reality. Time to put this pitiful, pathetic shell of a man out of his misery. Junk his worthless spam from now on, and let this thread stand as a final monument to his worship of ignorance.
cobby the lying sack of shit said: Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey ... the monkeys simply cannot produce validation for the above. Then they get upset and start spitting and pounding. Just watch!

Malcolm · 16 October 2008

cobby said: I would suggest that you read a first year biology, biochemistry or genetics textbook. You'll usually find all of those points covered in within the first 10 or so chapters. Until you have actually shown that you have any understanding of the subject, STFU. ... well cut and paste where these concepts are brought up or tell us in YOUR own words. Seems like you never must have taken any of these courses or else you would be aware of what the syllabi consist of.
Part of the problem here, troll, is that it isn't some small piece of information that you are missing. You seem to think that science comes in sound bites. One of the reasons no one on this site will simplify anything for you (that's what you are asking them to do when you ask for their own words), is because science doesn't work that way. All that jargon that you don't understand is required to precisely convey meaning. No one here can teach you developmental biology in a quote in the comments on a web site. You actually have to go out and do the work yourself. Or you could just STFU. P.s. If this troll really is a JHS teacher (I suspect it is more likely a JHS student), you Americans really need to do something about the state of your education system.

Stanton · 16 October 2008

Malcolm said: P.s. If this troll really is a JHS teacher (I suspect it is more likely a JHS student), you Americans really need to do something about the state of your education system.
If cobby/jobby/bobby/jacob/balanced/hamstrung/goff really was a Junior High School teacher, and taught and or treated his students in a manner even remotely similar to the way he treats us here, or even demonstrated the level of ignorance he shows us here in his classroom, there would be a statewide riot over who would get the privilege of spitting him alive over an open fire.

Dale Husband · 16 October 2008

Forgive me, folks, but I'm dying of laughter here! Jobby, you MURDERER!!!!

Carry on, folks!

Dave Lovell · 17 October 2008

when asked: So do you think there is sufficient information in a fertilised human egg cell to build a human, regardless of how the information was generated? cobby replied: ... could be. I really do not know. Neither does anyone. That is my point. To assume it is all in there without measuring or experimenting is FAITH not science.
Would you care to give us your suggestions as to how to perform these measurements and experiments? Think of it as the first draft of your research grant application to the Discovery Institute. Your experiments will obviously need to be designed to attempt to keep any other information out of the developing embryo, and then examine the defects in the resulting humans. These sort of experiments tend to give scientists a bad press, and as sucessful research program might result in the birth of a person from whom you had managed to exclude a soul, I recommend a substantial PR budget.

cobby · 17 October 2008

http://rosellaband.com/
phantomreader42 said: No, we all know this isn't true. You demanded studies that you never had any intention of reading. When they were provided, you lied about reading them. You declared, on the basis of no evidence whatsoever, that there wasn't enough info in DNA to construct a human body, and when called on this you denied ever making the claim, even with the quotes right in front of you. You have been polluting this site with your incoherent babbling and baldfaced lies for months. You keep whining that no one is meeting your idiotic demands, but we all know you aren't making those demands in good faith. Every single time a reference has been provided to you, you have proven that you never had any intention of even reading it. You won't even bother keeping your lies consistent. You keep denying everything you've ever said, then repeating the same bullshit again. YOU are the one spitting and pounding and flinging your own feces in every direction. It's all you've ever been able to do, all you ever will be able to do. You are a worthless lying sack of shit. This is creationism in a nutshell, folks. Endless lying, frantic mental masturbation, mindless shit-flinging, total immunity to evidence. If this overindulged troll had ever had the slightest speck of evidence for any of his asinine claims, he could have just posted it. Yet not once, in all the months he has been babbling here, has he ever even ATTEMPTED to do so. Countless times, his demands for evidence have been answered, and every single time, he has rejected the facts without even looking at them. He doesn't even pretend to read anything anymore. He just hides out in his tiny little bubble of delusion, wallowing in his own filth, flinging shit at everyone who dares live in the real world. The very idea of evidence terrifies him. And he will say anything, no matter how ridiculous, to avoid having to listen to reality. Time to put this pitiful, pathetic shell of a man out of his misery. Junk his worthless spam from now on, and let this thread stand as a final monument to his worship of ignorance.
cobby the lying sack of shit said: Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey ... the monkeys simply cannot produce validation for the above. Then they get upset and start spitting and pounding. Just watch!
... now that was a RANT! I would not waste my time going on and on like that. but you ARE a very GOOD MONKEY! you spat and pounded your chest and made funny monkey noises just like I wanted you to.
phantomreader42 said: No, we all know this isn't true. You demanded studies that you never had any intention of reading. When they were provided, you lied about reading them. You declared, on the basis of no evidence whatsoever, that there wasn't enough info in DNA to construct a human body, and when called on this you denied ever making the claim, even with the quotes right in front of you. You have been polluting this site with your incoherent babbling and baldfaced lies for months. You keep whining that no one is meeting your idiotic demands, but we all know you aren't making those demands in good faith. Every single time a reference has been provided to you, you have proven that you never had any intention of even reading it. You won't even bother keeping your lies consistent. You keep denying everything you've ever said, then repeating the same bullshit again. YOU are the one spitting and pounding and flinging your own feces in every direction. It's all you've ever been able to do, all you ever will be able to do. You are a worthless lying sack of shit. This is creationism in a nutshell, folks. Endless lying, frantic mental masturbation, mindless shit-flinging, total immunity to evidence. If this overindulged troll had ever had the slightest speck of evidence for any of his asinine claims, he could have just posted it. Yet not once, in all the months he has been babbling here, has he ever even ATTEMPTED to do so. Countless times, his demands for evidence have been answered, and every single time, he has rejected the facts without even looking at them. He doesn't even pretend to read anything anymore. He just hides out in his tiny little bubble of delusion, wallowing in his own filth, flinging shit at everyone who dares live in the real world. The very idea of evidence terrifies him. And he will say anything, no matter how ridiculous, to avoid having to listen to reality. Time to put this pitiful, pathetic shell of a man out of his misery. Junk his worthless spam from now on, and let this thread stand as a final monument to his worship of ignorance.
cobby the lying sack of shit said: Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey ... the monkeys simply cannot produce validation for the above. Then they get upset and start spitting and pounding. Just watch!
...Now THAT was a rant! You get a gold star, my monkey! How much of you life did you waste on writing that?

cobby · 17 October 2008

Would you care to give us your suggestions as to how to perform these measurements and experiments?

... it seems like you are saying it is unnecessary to do these experiments etc to validate the assertion that the DNA contains enough info.

Dave Lovell · 17 October 2008

cobby said: Would you care to give us your suggestions as to how to perform these measurements and experiments? ... it seems like you are saying it is unnecessary to do these experiments etc to validate the assertion that the DNA contains enough info.
No, without even expressing an opinion as to their necessity, I'm saying I have absolutely no idea of what "these experiments" would be, and was hoping you could enlighten me.

cobby · 17 October 2008

Dave Lovell said:
cobby said: Would you care to give us your suggestions as to how to perform these measurements and experiments? ... it seems like you are saying it is unnecessary to do these experiments etc to validate the assertion that the DNA contains enough info.
No, without even expressing an opinion as to their necessity, I'm saying I have absolutely no idea of what "these experiments" would be, and was hoping you could enlighten me.
... well, I do not think it is fair that you requirement to answer your queries and you do not have to address the main issue. ... I think the main point is: do we reasonable know that DNA has enough info? The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.

phantomreader42 · 17 October 2008

cobby the lying sack of shit said:
Dave Lovell said:
cobby the lying sack of shit said: Would you care to give us your suggestions as to how to perform these measurements and experiments? ... it seems like you are saying it is unnecessary to do these experiments etc to validate the assertion that the DNA contains enough info.
No, without even expressing an opinion as to their necessity, I'm saying I have absolutely no idea of what "these experiments" would be, and was hoping you could enlighten me.
... well, I do not think it is fair that you requirement to answer your queries and you do not have to address the main issue. ... I think the main point is: do we reasonable know that DNA has enough info? The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.
So, back to spamming again? Dirty little monkey, flinging your shit everywhere. So, to recap: You do not have any evidence at all to support any of your IDiotic claims. You have no interest whatsoever in looking for such evidence. You have no idea where or how such evidence might be found. You would not even have a wild guess what such evidence would look like if it were found. In short, everything you've ever said is totally devoid of merit. You are a worthless waste of skin. Just a drunken bum sitting in a puddle of his own feces, jerking off with one hand and using the other to fling shit at everyone in sight.

cobby · 17 October 2008

phantomreader42 said:
cobby the lying sack of shit said:
Dave Lovell said:
cobby the lying sack of shit said: Would you care to give us your suggestions as to how to perform these measurements and experiments? ... it seems like you are saying it is unnecessary to do these experiments etc to validate the assertion that the DNA contains enough info.
No, without even expressing an opinion as to their necessity, I'm saying I have absolutely no idea of what "these experiments" would be, and was hoping you could enlighten me.
... well, I do not think it is fair that you requirement to answer your queries and you do not have to address the main issue. ... I think the main point is: do we reasonable know that DNA has enough info? The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.
So, back to spamming again? Dirty little monkey, flinging your shit everywhere. So, to recap: You do not have any evidence at all to support any of your IDiotic claims. You have no interest whatsoever in looking for such evidence. You have no idea where or how such evidence might be found. You would not even have a wild guess what such evidence would look like if it were found. In short, everything you've ever said is totally devoid of merit. You are a worthless waste of skin. Just a drunken bum sitting in a puddle of his own feces, jerking off with one hand and using the other to fling shit at everyone in sight.
... what a vivid imagination!

Stanton · 17 October 2008

cobby/jobby/bobby/jacob/hamstrung/balanced/goff said: ... I think the main point is: do we reasonable know that DNA has enough info? The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.
When I had asked cobby/jobby/bobby/jacob/hamstrung/balanced/goff what evidence you had to explain why you suggest that DNA is informationally insufficient, despite the fact that gene products are heavily dependent on DNA, what with changes in DNA being documented to drastically change the gene product, he claimed that I was a liar. Of course, a lie is a false statement, a request/question is not a statement, and by claiming that a request to support one's claim is a false statement demonstrates that cobby/jobby/bobby/jacob/hamstrung/balanced/goff is impervious to logic, inside and out. That, and changing his name again will not change the fact that he's shown the world that his idea of "challenging a belief system" is to conflate a belief system with a repeatedly verified science while ignoring all presented evidence to the contrary, hypocritically accusing others of being trolls, and shouting "jump monkey" over and over again. Plus, the troll is also too lazy and too arrogantly stupid to realize that scientists have already begun studying post-translational modifications of RNA and other gene products, in a new science called "Epigenetics"

Stanton · 17 October 2008

cobby said: ... what a vivid imagination!
So then please explain to us how shouting "jump monkey" over and over again like an idiot or a victim of Tourette's Syndrome is evidence that supports your claim that the genome is informationally insufficient, or even supports your claim that there is no evidence for "Darwinism"?

phantomreader42 · 17 October 2008

Stanton said:
cobby said: ... what a vivid imagination!
So then please explain to us how shouting "jump monkey" over and over again like an idiot or a victim of Tourette's Syndrome is evidence that supports your claim that the genome is informationally insufficient, or even supports your claim that there is no evidence for "Darwinism"?
What, you're STILL asking it for evidence? It's been obvious for months that it lacks the capacity to even understand the concept of evidence!

Henry J · 17 October 2008

Yeah, if it wasn't sufficient, all one would have to do is show proteins that couldn't be traced back to the DNA, or body parts for which the length and width weren't determined by on/off switches in regulatory DNA combined with signal chemicals from other cells (i.e., the gradients mentioned in previous replies).

Henry

Malcolm · 17 October 2008

Henry J said: Yeah, if it wasn't sufficient, all one would have to do is show proteins that couldn't be traced back to the DNA, or body parts for which the length and width weren't determined by on/off switches in regulatory DNA combined with signal chemicals from other cells (i.e., the gradients mentioned in previous replies). Henry
I think that part of the problem is that the troll has absolutely no idea how chemical signaling works. In its extreme arrogance it can not imagine anyone being more knowledgeable than itself, therefore it assumes that no one understands it. Trying to educate the troll is like trying to teach a 4-year-old to do calculus. And then the 4-year-old stating that LaPlace must have been wrong, so God is required to move the planets.

Dave Lovell · 18 October 2008

cobby said:
Dave Lovell said:
cobby said: Would you care to give us your suggestions as to how to perform these measurements and experiments? ... it seems like you are saying it is unnecessary to do these experiments etc to validate the assertion that the DNA contains enough info.
No, without even expressing an opinion as to their necessity, I'm saying I have absolutely no idea of what "these experiments" would be, and was hoping you could enlighten me.
... well, I do not think it is fair that you requirement to answer your queries and you do not have to address the main issue. ... I think the main point is: do we reasonable know that DNA has enough info? The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.
When I asked "So do you think there is sufficient information in a fertilised human egg cell to build a human", I was careful to avoid mentioning DNA. However bizarre I may find your argument on DNA, it at least maintains the pretence of being about how the information is stored. If you are seriously postulating that huge amounts of "something" from an outside agency has to be added to a fertilised egg cell, either at he beginning of, or continuously during, development to allow it to become a human then you are truly "immune to evidence". Hundreds of thousands of experiments (i.e. human births) are performed every single day, and a single cell removed from a very early embryo will grow into a mono zygotic twin. Science does not get any better than that. So, precisely, do you think there is sufficient information in a fertilised human egg cell to build a human?

cobby · 18 October 2008

I think it is fair that you should answer MY queries:

I think the main point is: do we reasonable know that DNA has enough info?

The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.

cobby · 18 October 2008

I think that part of the problem is that the troll has absolutely no idea how chemical signaling works. In its extreme arrogance it can not imagine anyone being more knowledgeable than itself, therefore it assumes that no one understands it. Trying to educate the troll is like trying to teach a 4-year-old to do calculus. And then the 4-year-old stating that LaPlace must have been wrong, so God is required to move the planets.

....MONKEY: Of course I am aware of the signalling. Please stop the trolling and please grow up.

JUMP MONKEYS!!

cobby · 18 October 2008

Henry J said: Yeah, if it wasn't sufficient, all one would have to do is show proteins that couldn't be traced back to the DNA, or body parts for which the length and width weren't determined by on/off switches in regulatory DNA combined with signal chemicals from other cells (i.e., the gradients mentioned in previous replies). Henry
... how are the shapes determined?? How do the switches know when to turn on and off? How are the coordinates for the structure of the pelvis stored in the DNA and how does it know when that structure has been developed into the proper size, shape and form? Where is the feedback system that tells the switches when the proper length and width has been reacehed? And where is the experiment that shows that NS can make a complex body plan??

DS · 18 October 2008

Henry,

Two weeks (and one thousand posts) ago a link was provided to a web site that lists over two hundred proteins involved in Drosophila wing morphogenesis. The site described in detail the interactions between the proteins in the signaling pathways and how wing shape was determined, as well as the effect that various mutations had on wing shape.

Unfortunately the microcephalic chimpanzee of many names was too busy flinging his feces around to read the article or any of the references contained therein. It also failed to identify even one protein that was not coded for in the fly genome. Now I have a hypothesis as to why this might be. I think that it believes that photons from the sun are processed in the earth's magnetic field and that this provides the information required for development. Now where on earth could it have gotten such a ridiculous idea?

cobby · 18 October 2008

The site described in detail the interactions between the proteins in the signaling pathways and how wing shape was determined, as well as the effect that various mutations had on wing shape.

... sorry charlie. there was no description on how the shape of the wings were formed. did you even read part of it?

go ahead paraphrase where this was described.

(what a liar!)

Science Avenger · 18 October 2008

And this is the subape's other tactic: pretending to have read articles he hasn't (which was proven when he claimed to have read a paper that another poster made up), and demanding that everyone else not only read them for him, but summarize them, and in 3rd grade vocabulary so he can understand. Then he claims he didn't say what he said.

And so it goes...get me 52 pages my little presimian imp.

cobby · 18 October 2008

Science Avenger said: And this is the subape's other tactic: pretending to have read articles he hasn't (which was proven when he claimed to have read a paper that another poster made up), and demanding that everyone else not only read them for him, but summarize them, and in 3rd grade vocabulary so he can understand. Then he claims he didn't say what he said. And so it goes...get me 52 pages my little presimian imp.
... well pick one of these studies and YOU read it and tell us how it supports your position. OK you cant. I forgot.
DS said: Henry, Two weeks (and one thousand posts) ago a link was provided to a web site that lists over two hundred proteins involved in Drosophila wing morphogenesis. The site described in detail the interactions between the proteins in the signaling pathways and how wing shape was determined, as well as the effect that various mutations had on wing shape. Unfortunately the microcephalic chimpanzee of many names was too busy flinging his feces around to read the article or any of the references contained therein. It also failed to identify even one protein that was not coded for in the fly genome. Now I have a hypothesis as to why this might be. I think that it believes that photons from the sun are processed in the earth's magnetic field and that this provides the information required for development. Now where on earth could it have gotten such a ridiculous idea?

Malcolm · 18 October 2008

cobby said: I think that part of the problem is that the troll has absolutely no idea how chemical signaling works. In its extreme arrogance it can not imagine anyone being more knowledgeable than itself, therefore it assumes that no one understands it. Trying to educate the troll is like trying to teach a 4-year-old to do calculus. And then the 4-year-old stating that LaPlace must have been wrong, so God is required to move the planets. ....MONKEY: Of course I am aware of the signalling. Please stop the trolling and please grow up. JUMP MONKEYS!!
I didn't say that you weren't aware of cell signalling, just that you have no idea how it works. You then went on to prove my point here;
… how are the shapes determined?? How do the switches know when to turn on and off? How are the coordinates for the structure of the pelvis stored in the DNA and how does it know when that structure has been developed into the proper size, shape and form? Where is the feedback system that tells the switches when the proper length and width has been reacehed?
Troll, the shapes are determined by the gradients. You'd know that if you had looked at any of the papers linked to earlier. The coordinates of the pelvis aren't necessary. If I tell you to plot the function x2 + y2 = 1, do I need to tell you the shape of the curve? Before you ask for papers to back that up, go and read the ones you already have. If you still don't get it after that, you need to study some biology. Remember, just because you have no idea how the feedback systems in cell signalling work, that doesn't mean that other people don't.

PvM · 18 October 2008

cobby said: ... so the info is stored in formulas in the DNA? still the problem is the feedback mechanism that tells the formala when the propre widths lengths are reached. How does THAT happen?? ... Please show me the studies.
Any study on embryology will show you. In fact, I showed you several studies. Have you heard of feedback, surpressor genes, activation genes? How familiar are you with genetic networks? It's all an interaction between genes, genetic networks and the environmental conditions. Until you show some attempts to familiarize yourself with embryology, you are doomed to repeat your ignorance.

Science Avenger · 18 October 2008

cobby said: ... well pick one of these studies and YOU read it and tell us how it supports your position. OK you cant. I forgot.
You forget I've taken no position in this debate, other than to point out the flaws in your arguments, because I don't consider myself qualified to judge the evidence. I simply point out, again, that for you to be right, there would have to be some massive conspiracy, or group insanity, or an immensely unlikely group error, on the part of the scientific community, and you've given us zero evidence for any of those things.

Malcolm · 18 October 2008

cobby said:
Malcolm said:
cobby said: I think that part of the problem is that the troll has absolutely no idea how chemical signaling works. In its extreme arrogance it can not imagine anyone being more knowledgeable than itself, therefore it assumes that no one understands it. Trying to educate the troll is like trying to teach a 4-year-old to do calculus. And then the 4-year-old stating that LaPlace must have been wrong, so God is required to move the planets. ....MONKEY: Of course I am aware of the signalling. Please stop the trolling and please grow up. JUMP MONKEYS!!
I didn't say that you weren't aware of cell signalling, just that you have no idea how it works. You then went on to prove my point here;
… how are the shapes determined?? How do the switches know when to turn on and off? How are the coordinates for the structure of the pelvis stored in the DNA and how does it know when that structure has been developed into the proper size, shape and form? Where is the feedback system that tells the switches when the proper length and width has been reacehed?
Troll, the shapes are determined by the gradients. You'd know that if you had looked at any of the papers linked to earlier. The coordinates of the pelvis aren't necessary. If I tell you to plot the function x2 + y2 = 1, do I need to tell you the shape of the curve? Before you ask for papers to back that up, go and read the ones you already have. If you still don't get it after that, you need to study some biology. Remember, just because you have no idea how the feedback systems in cell signalling work, that doesn't mean that other people don't.
... so the info is stored in formulas in the DNA? still the problem is the feedback mechanism that tells the formala when the propre widths lengths are reached. How does THAT happen?? ... Please show me the studies.
I should have known that that analogy would go straight over your head. No, the info isn't stored in formulae. The info isn't necessary. Just as you don't need any additional information to plot the curve above, the cells don't need a measurement. They continue doing what they do until a feedback loop shuts them off, or they are degraded. Its just basic biochemistry. The feedback mechanisms are well known and understood, something that you would know if you read some of those studies.

DaveH · 19 October 2008

cobby said: ... there must a signal from the environment that feeds back when the proper shape is achieved
Completely ass forwards.

somebody · 19 October 2008

DaveH said:
cobby said: ... there must a signal from the environment that feeds back when the proper shape is achieved
Completely ass forwards.
... you do not understand the mechanism involved. study harder

somebody · 19 October 2008

until a feedback loop shuts them off,

.... so what feedback tells the cells that the pelvis is the correct shape??

PvM · 19 October 2008

Somebody, is aka bobby, jobby and other aliases violating once again this forums rules. In addition, Somebody still seems to be totally unfamiliar with how body plans arise.
somebody said: until a feedback loop shuts them off, .... so what feedback tells the cells that the pelvis is the correct shape??

PvM · 19 October 2008

If Bobby spent even a fraction of the time he wastes exposing his ignorance on these threads, on actually familiarizing himself with embryology, he would not continue to embarass himself with foolish questions.
somebody said:
DaveH said:
cobby said: ... there must a signal from the environment that feeds back when the proper shape is achieved
Completely ass forwards.
... you do not understand the mechanism involved. study harder

somebody · 19 October 2008

PvM said: If Bobby spent even a fraction of the time he wastes exposing his ignorance on these threads, on actually familiarizing himself with embryology, he would not continue to embarass himself with foolish questions.
somebody said:
DaveH said:
... well if you know so much show me the study. but sorry dummy if YOU had read ANY of the literature YOU would know that morphogenesis is still 98% as much a mystery as dark energy and gravity for that matter. jeez do some reading! cobby said: ... there must a signal from the environment that feeds back when the proper shape is achieved
Completely ass forwards.
... you do not understand the mechanism involved. study harder

somebody · 19 October 2008

In addition, Somebody still seems to be totally unfamiliar with how body plans arise.

... dummy: do you also think a chijuajua and a great dane have dissimilar body plans??

... dummy wont answer i am sure

DaveH · 19 October 2008

How does a developing embryo KNOW when its left femur is the right shape? That's about the level of the sockpuppet's discourse. It seems to think that there is some magic external referee that decides that the leg is long enough. If the troll had the slightest understanding of emergence and had read the papers provided for it instead of scanning the titles and rejecting the papers, it would have caught on to the fact that there is no need for an external observer who keeps things right. Cells divide when they receive signals of a certain strength. They stop when the signal falls below that strength, or when the molecules that they pump out reach a certain threshold which switches off the original signal. It's almost as if troll-face had asked "Why is the sky blue?" and people had provided lots of papers about refraction and the troll came back with: "That's just a mechanistic explanation of why it IS blue. How does the sky KNOW to be blue?"

Malcolm · 19 October 2008

somebody said: until a feedback loop shuts them off, .... so what feedback tells the cells that the pelvis is the correct shape??
The Troll demonstrates that it isn't even trying. You can lead a troll to knowledge, but you can not make it think.

Wayne Francis · 19 October 2008

Cobby said: Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed
which you got many replies to to include one from me http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-169489 that gave you the info for "The Molecular Basis of Skeletogenesis" which describes just that
and also studies showing that there is enough info in the DNA to contruct a human body.
which multiple people have address. It is like saying no one has done any studies showing that natural processes are enough to account for weather patterns we see.
None of these were produced.
The first was produced multiple times and the second is like asking if gravity can completely account for bodies attracting each other in space-time.
And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey.
You went mental because you kept getting proven wrong and a liar. Ignoring every thing presented to you does not make it go away. It just makes you a willfully ignorant troll.
I pulled the rug from under their beliefs systems which threw them into a terrible tizzy and then came the dirty language.
You continued to waffle on about nothing ignoring every thing and continually lied and we all called you on it at every turn and you freaked out about it by lying even more.
You can always tell when they have not logical responses that is when they start the primitive vulgarities.
Says the troll that never answers questions presented to him. Never read anything he asks for while calling other people names and Internet shouting they are wrong and often replies with poorly constructed sentences with made up words that actually have nothing to do with the post he is replying to. Blow Jobby is a willfully ignorant lying troll that we all have not issue showing we have no respect for.

Wayne Francis · 19 October 2008

cobby said: I think it is fair that you should answer MY queries: I think the main point is: do we reasonable know that DNA has enough info? The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.
Maybe the first time but as your questions got answered over and over and you repeatedly refused to read the papers provided to you then we don't owe you anything. At that point we just call you on your shit when you open your mouth and spew it out hand jobby. For the lurkers, Yes we reasonably know that DNA holds enough "information" to account for heritable traits within any given species because we have not found any developmental or heritable trait that isn't accountable by DNA or the genetic environment. IE we have not found any situation where "extra" information is needed from some unknown source that can't even be within the cell because we can account for the entire contents of cells.

Wayne Francis · 19 October 2008

cobby said: I think that part of the problem is that the troll has absolutely no idea how chemical signaling works. In its extreme arrogance it can not imagine anyone being more knowledgeable than itself, therefore it assumes that no one understands it. Trying to educate the troll is like trying to teach a 4-year-old to do calculus. And then the 4-year-old stating that LaPlace must have been wrong, so God is required to move the planets. ....MONKEY: Of course I am aware of the signalling. Please stop the trolling and please grow up. JUMP MONKEYS!!
Blow Jobby blindly states that he understands something but has not once proven he understand anything that he talks abouts. This is the same person that thinks something can be arbitrary and logical at the same time.

Wayne Francis · 19 October 2008

cobby said:
Henry J said: Yeah, if it wasn't sufficient, all one would have to do is show proteins that couldn't be traced back to the DNA, or body parts for which the length and width weren't determined by on/off switches in regulatory DNA combined with signal chemicals from other cells (i.e., the gradients mentioned in previous replies). Henry
... how are the shapes determined?? How do the switches know when to turn on and off? How are the coordinates for the structure of the pelvis stored in the DNA and how does it know when that structure has been developed into the proper size, shape and form? Where is the feedback system that tells the switches when the proper length and width has been reacehed? And where is the experiment that shows that NS can make a complex body plan??
Blow Jobby, blows it. We've told you there isn't a "blue print" that has some 3d coordinate mesh of the shape of a bone. I provided blow jobby info on a book that explains how the shapes of bones are formed back in post http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-169489 and as normal he ignores all information provided to him then repeatedly states that nothing has been provided to him and no information exists. He claims to understand signalling in the previous post but in this post he asks "How do the switches know when to turn on and off?" Once again his posts aren't even self consistent.

Wayne Francis · 19 October 2008

cobby said: The site described in detail the interactions between the proteins in the signaling pathways and how wing shape was determined, as well as the effect that various mutations had on wing shape. ... sorry charlie. there was no description on how the shape of the wings were formed. did you even read part of it? go ahead paraphrase where this was described. (what a liar!)
Once again Blow Jobby proves he doesn't read information he has asked for and just turns around and accuses those that provide him with the information that it doesn't say exactly what they do say and that the person providing the information has not read it. This is the same as him putting his fingers in his ears and yelling "LA LA LA NOT LISTENING"

Dave Luckett · 20 October 2008

My father, who was occasionally wise, remarked that there is simple ignorance, which is curable unless it is compounded by intractible foolishness; and intractible foolishness comes in two kinds. The first kind is the fool who doesn't know, and doesn't want to know. The second kind is the fool who doesn't know, but who thinks he does. Jobby is both.

Dave Lovell · 20 October 2008

cobby said: I think it is fair that you should answer MY queries: I think the main point is: do we reasonable know that DNA has enough info? The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.
A refreshed Wayne seems to already have posted most of what I would wish to say here, but YES we do reasonably know that DNA has enough info. A shepherd can reasonably put his Ram to his ewes and expect to get lambs {unless he plans to use the "But my Lord, the ewes really need something extra" defence) Is it not "fair" that you should now answer MY query? So, precisely, do you think there is sufficient information in a fertilised human egg cell to build a human? It might be a hard notion for you to grasp, but scientists tend to do their best work in fields where they have exceptional knowledge and understanding. Just as Faraday, presented with a laptop, could not give a meaningful answer to the question "Does it have enough Electricity in it to boot up Windows". a developmental biologist can not give a meaningful opinion on the amount of information, but must work to understand HOW the information available produces the human. If, once the function of every base pair is understood, something is still missing, then we would need to look elsewhere. Until then I have any idea how to carry out your "exploration of methods of validating", or how to find (and pay for) a scientist prepared to do it. If you have, you are not prepared to reveal it to us.
somebody/cobby also said: … dummy: do you also think a chijuajua and a great dane have dissimilar body plans??
I am a little confused as to what prompted this comment, but it does suggest a way to address your information problem in more manageable chunks, based on the following observations: 1) They are the same species, so their genomes are quite similar 2) Dog breeds are very inbred, so there is very little variation in individuals across the breed 3) There is a massive difference in the size of all their bones, and the shape and proportions of most of them Do you think there are sufficient differences between the information in a fertilised Great Dane egg cell and a fertilised Chijuajua egg cell to account for the huge differences in the size and shape of their bones and bodies? And to preempt part of your answer, how the information got into the cell, whether by human selection, God, the FSM, or Darwin's ghost having a laugh, has no bearing whatsoever on the answer

cobby · 20 October 2008

dummy: do you also think a chijuajua and a great dane have dissimilar body plans??

... still no answer

cobby · 20 October 2008

Wayne Francis said:
cobby said: The site described in detail the interactions between the proteins in the signaling pathways and how wing shape was determined, as well as the effect that various mutations had on wing shape. ... sorry charlie. there was no description on how the shape of the wings were formed. did you even read part of it? go ahead paraphrase where this was described. (what a liar!)
Once again Blow Jobby proves he doesn't read information he has asked for and just turns around and accuses those that provide him with the information that it doesn't say exactly what they do say and that the person providing the information has not read it. This is the same as him putting his fingers in his ears and yelling "LA LA LA NOT LISTENING"
... do you read any of the studies??

cobby · 20 October 2008

YES we do reasonably know that DNA has enough info.

.... how have you determined that??

cobby · 20 October 2008

Creationists don’t care about this world/universe, and virtually none of them care about studying this world/universe.

... what is the difference between a creationist and someone who believes God created life and the universe? Or are they the same?

cobby · 20 October 2008

“So why hasn’t natural selection selected for easier birth?”

Because selection pressure for greater intelligence is stronger. There are a number of drawbacks to larger brain size - energy needs, cooling problems, difficult birth (though this is at least partially also attributable to bipedalism) and very long dependent infancy and childhood. But a larger brain makes up for them.

... and how do we know that the pressure for intelligence is stronger??

Science Avenger · 20 October 2008

cobby said: ... what is the difference between a creationist and someone who believes God created life and the universe? Or are they the same?
A creationist ignores scientific evidence in lieu of his creation myth (spontaneous creation of macroscopic life, a 6,000 year old earth, etc.), whatever it may be. Since we don't know how the universe or the first life came to be, one can give one's god credit for these (for the moment) without running afoul of science, and thus without earning the creationist label.

cobby · 20 October 2008

Science Avenger said:
cobby said: ... what is the difference between a creationist and someone who believes God created life and the universe? Or are they the same?
A creationist ignores scientific evidence in lieu of his creation myth (spontaneous creation of macroscopic life, a 6,000 year old earth, etc.), whatever it may be. Since we don't know how the universe or the first life came to be, one can give one's god credit for these (for the moment) without running afoul of science, and thus without earning the creationist label.
.... if a person believes God started the big bang and the universe is billions of years old would he be a creationist?

Saddlebred · 20 October 2008

cobby said: .... if a person believes God started the big bang and the universe is billions of years old would he be a creationist?
American Heritage Dictionary - Cite This Source - Share This cre·a·tion·ism (krē-ā'shə-nĭz'əm) Pronunciation Key n. Belief in the literal interpretation of the account of the creation of the universe and of all living things related in the Bible. cre·a'tion·ist adj. & n. Dictionary.com Unabridged (v 1.1) - Cite This Source - Share This cre·a·tion·ism /kriˈeɪʃəˌnɪzəm/ Pronunciation Key - Show Spelled Pronunciation[kree-ey-shuh-niz-uhm] Pronunciation Key - Show IPA Pronunciation –noun 1. the doctrine that matter and all things were created, substantially as they now exist, by an omnipotent Creator, and not gradually evolved or developed. 2. (sometimes initial capital letter) the doctrine that the true story of the creation of the universe is as it is recounted in the Bible, esp. in the first chapter of Genesis. 3. the doctrine that God immediately creates out of nothing a new human soul for each individual born. How about NO...i r can uz internet resource liek this kthx!

Wayne Francis · 21 October 2008

cobby said: dummy: do you also think a chijuajua and a great dane have dissimilar body plans?? ... still no answer
No they don't. There is Hand Jobby/Cobby's answer. Now for the explanation of why, that he'll surely misquote someone and mangle the meaning of "body plan" because it doesn't mean what he thinks it means. Since "body plans" directly relate to the phylum of of an organism. A chihuahua & great dane (Canis lupus), humans (homo sapien), and blue fin tuna (Thunnus orientalis) have the same "Body Plan" because they are all "Chordata" Since it is at the phylum level everything below it have the same body plan. Wolves and Humans are both of the class Mammal but since body plans is actually defined one level higher they automatically have the same "Body Plan"
cobby said:
Wayne Francis said:
cobby said: The site described in detail the interactions between the proteins in the signaling pathways and how wing shape was determined, as well as the effect that various mutations had on wing shape. ... sorry charlie. there was no description on how the shape of the wings were formed. did you even read part of it? go ahead paraphrase where this was described. (what a liar!)
Once again Blow Jobby proves he doesn't read information he has asked for and just turns around and accuses those that provide him with the information that it doesn't say exactly what they do say and that the person providing the information has not read it. This is the same as him putting his fingers in his ears and yelling "LA LA LA NOT LISTENING"
... do you read any of the studies??
Yes I have, you obviously haven't because you've said you will not read them until someone spoon feeds them to you. I read many papers, especially if they are available freely on the net. I will not understand all the ins and outs of the papers but then I'm not a scientist in the relevant field, but that isn't needed. By the fact that they are peer reviewed, I can be assured that, there are no gaping holes in the concepts being put forth in the papers. There might be some legitimate controversy over certain aspects and conclusions but that often becomes apparent when looking at the number of citations that any given paper receives after it is published. It doesn't really even matter if anyone fully has read the paper if it addresses what you asked. If you disagree with a paper then it is up to you to site how said paper doesn't address the topic you are referring to. The last paper I read was "Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster" by Kenneth Weber, Nancy Johnson, David Champlin, and April Patty from Genetics Society of America Another good one is "A Database of Wing Diversity in the Hawaiian Drosophila" by Kevin A. Edwards, Linden T. Doescher, Kenneth Y. Kaneshiro, and Daisuke Yamamoto that describes not only how the wing shape develops but how the vein patterns and the pigment color/patterns develop. You can wave your hands around and yell "The sky is not blue" all you want but it doesn't make it so.
cobby said: YES we do reasonably know that DNA has enough info. .... how have you determined that??
We don't have any studies that say there isn't any unicorns either. By the same logic we have not seen any additional information that is needed in any developmental process so why write a paper on something that there is no evidence of. Unlike Cosmology which points to "missing mater" and astronomers inventing a term of "dark mater" to describe this, yet not found, "matter" to make the equations of gravity work when looking at galaxies and galaxy clusters there has yet to be any thing found to be missing in DNA. The more we look the more we find that DNA is quite capable of producing life. More and more of the "Junk DNA" is being found to have regulatory functions in the form of Regulatory RNA. I'd make another analogy but you would just fully not understand it or mangle it beyond recognition.
cobby said: Creationists don’t care about this world/universe, and virtually none of them care about studying this world/universe. ... what is the difference between a creationist and someone who believes God created life and the universe? Or are they the same?
a creationist is commonly understood to be someone that believes in a literal reading of the bible. That "God" created life as it is read in the bible. That each species was created individually and there are some boundaries that species can not cross, even over long scales of time. For instance a species lizard can not develop adaptations that allow that species to glide from tree to tree unless "God" intervened. That an organism that has light sensitive cells can not, over millions of years, acquire many small changes that change that patch of light sensitive cells into an organ like the mammalian eye, even though there is an obvious series of steps that provide an increasing amount of benefit to the sensory system of said organism. "someone who believes God created life and the universe?" is actually more in line with the Roman Catholic Church. The belief in a "Prime Creator" which may intervene in the course of history but is outside of space and time and so "intervene" is a inappropriate/inadequate term to use. A deist is a person that believes if there is a "God" that the "God" for what ever reason created the universe and let it develop on its own without any further intervention. This would mean that "God" didn't just "create" everything but created a system that could, in it self, create. A deist "God" in most respects is more powerful then a "creationist God" as the deist "God" builds into the original plan the ability for complexity to emerge from simplicity without its intervention at any stage. So no they are not the same and they are by far not the only possible answers. It isn't one or the other and most likely is neither.
cobby said: “So why hasn’t natural selection selected for easier birth?” Because selection pressure for greater intelligence is stronger. There are a number of drawbacks to larger brain size - energy needs, cooling problems, difficult birth (though this is at least partially also attributable to bipedalism) and very long dependent infancy and childhood. But a larger brain makes up for them. ... and how do we know that the pressure for intelligence is stronger??
Because we see that, despite the fact that bigger brains cost more in energy, development and birthing problems, larger brains have been selected as a trait over smaller brains in the homo line over the last few million years. If it wasn't a stronger pressure we would not be here asking these questions. In other words we know that a baby human is more vulnerable then a baby chimp. The environment that a human baby is brought up in is much different then they baby chimp. This environment allows more time for the brain to grow and form then the chimps. We know the bigger brain allows human babies to learn most tasks pertinent to being a successful human adult better then baby chimps. Thus having the larger brain combined with the environment where the human babies grow up in makes it more successful over all. The "pressure" is very complex and involves diet, social order, gestation time, etc. It isn't trait A give benefit B end of paper. Here is an analogy that will be lost on Hand Jobby/Cobby I'm sure. The design of cars is changing. For a very long time cars where developed with speed and power in mind. They did this even though they had drawbacks like using more petrol, producing more pollution. Lately cars have become more efficient and more environmentally friendly in different ways but with other drawbacks. These drawbacks include a more limited range, more expensive car, less power. The "environment" in which these cars are being "sold" is changing. In some "environments" the older style cars are still popular/successful (aka Hummers being sold in the USA to Joe six pack) and in other "environments" the newer, more environmentally friendly cars are taking hold even though they are more expensive the "environment" is more conducive to them being sold (aka people that care about the environment are willing to buy more expensive cars that have less negative impact on the environment).
cobby said:
Science Avenger said:
cobby said: ... what is the difference between a creationist and someone who believes God created life and the universe? Or are they the same?
A creationist ignores scientific evidence in lieu of his creation myth (spontaneous creation of macroscopic life, a 6,000 year old earth, etc.), whatever it may be. Since we don't know how the universe or the first life came to be, one can give one's god credit for these (for the moment) without running afoul of science, and thus without earning the creationist label.
.... if a person believes God started the big bang and the universe is billions of years old would he be a creationist?
Not in the common usage of the term "creationist" and it is more in line with a "theistic evolutionist" unless you mean that "God" set off the "Big Bang" then at some point in the past jump started life beyond the first primitive life. Most people would also lump abiogenesis in with evolution but technically it doesn't need to be. The naturalist would say that "life" most likely formed from "non life" in a natural process. This does not exclude "God" as the ultimate "prime creator" but rather says that life and the appearance of life can be explained by natural processes.

cobby · 21 October 2008

Not in the common usage of the term “creationist” and it is more in line with a “theistic evolutionist” unless you mean that “God” set off the “Big Bang” then at some point in the past jump started life beyond the first primitive life.

... I think a better term would be 'bible literalist' I feel that someone who believes that God created life and the universe is a 'creationist'. I think this is a purposeful misuse of terms for political reasons.

cobby · 21 October 2008

Because we see that, despite the fact that bigger brains cost more in energy, development and birthing problems, larger brains have been selected as a trait over smaller brains in the homo line over the last few million years. If it wasn’t a stronger pressure we would not be here asking these questions.

.... you are saying that the evidence that bigger brains are more adaptive than easier birth is because we see have progessively seen more of them in homo?

cobby · 21 October 2008

We don’t have any studies that say there isn’t any unicorns either.

... well we have a great deal of observations that show that tho probability of existence of unicorns is very low.

... to say like you are that since we have no evidence that DNA is not sufficient therefore it is sufficient is not SCIENCE. please review scientific method.

cobby · 21 October 2008

but rather says that life and the appearance of life can be explained by natural processes.

.... any studies that show that to be the case?

Wayne Francis · 21 October 2008

cobby said: Not in the common usage of the term “creationist” and it is more in line with a “theistic evolutionist” unless you mean that “God” set off the “Big Bang” then at some point in the past jump started life beyond the first primitive life. ... I think a better term would be 'bible literalist' I feel that someone who believes that God created life and the universe is a 'creationist'. I think this is a purposeful misuse of terms for political reasons.
Well it doesn't matter what you think. Just like you think something can be "arbitrary" and "logical" at the same time despite the 2 words being antonyms. What matters is what most of the rest of the world thinks about the definition of a word. See language isn't like science. In science you can be the only one to understand something and it can be right but you need proof. In linguistics the majority really does rule. Your problem is that in science you have nothing to prove you are right and in linguistics you have been shown to not understand the meanings of words as determined by the majority usage of said words. Creationist are self labeled. You can argue with them over the use of the term. The "Creation Science" movement adopted the label in the early 90's. But you are probably right. They probably adopted the label for political reasons, the same reason they do everything. Nothing they do is for anything but political reasons. You can say that people that believe in the divinity of Christ are not Christians too but that doesn't mean your understanding of the English language is worth squat. In fact you've proven that your understanding of the meanings of words is marginal at best.

Wayne Francis · 21 October 2008

cobby said: We don’t have any studies that say there isn’t any unicorns either. ... well we have a great deal of observations that show that tho probability of existence of unicorns is very low.
And we have a great deal of observations that show that the need for extra information beyond DNA is extremely low. So why write a paper on either?
cobby said: ... to say like you are that since we have no evidence that DNA is not sufficient therefore it is sufficient is not SCIENCE. please review scientific method.
Please review English grammar. What I say is science looks for answers to questions via naturalist means. So far there hasn't been a need for a question of "Is DNA is sufficient?". If we ever find a protein that is not coded for in an organism's DNA that is found in that organism, or another organism that is symbiotic with said organism, then we will look for your pink unicorn. That is science. So far all developmental traits can be ultimately explained by the DNA of the organism, or symbiotic organism of that organism. Blow Jobby fails to grasp the scientific method again.

Wayne Francis · 21 October 2008

cobby said: but rather says that life and the appearance of life can be explained by natural processes. .... any studies that show that to be the case?
Yes, it is a whole field of science called abiogenesis. Spend a few minutes with google. I see you ignored the following bits of my post answering your previous spouts of shit you spewed out while I was in Melbourne. No response about "Body Plans"? Did you finally realise that "Body Plans" doesn't mean what you thought it meant? Do you also understand that "arbitrary" and "logical" are polar opposites? Do you understand that your meaning of "Creationist" isn't the meaning anyone else, including said Creationist, have? No responses to the fact that I do read many of the papers pointed to by others on this blog and more importantly that the papers explain exactly what you say they don't? You know it ignorance and hubris to declare that a paper doesn't say something when you haven't even read it. You also are silent about your misunderstanding of environmental pressures and how they actually works. Which goes a long way to explaining why you have such a hard time understanding the basics of evolution let alone how evolution can effect genetics and the effects of genetic alterations on morphology.

cobby · 21 October 2008

ust like you think something can be “arbitrary” and “logical” at the same time despite the 2 words being antonyms.

... sorry charlie. sometimes arbitrary decision are the most logical thing to do:

wiki:

Arbitrary decisions are not necessarily the same as random decisions. For instance, during the 1973 oil crisis, Americans were only allowed to purchase gasoline on odd-numbered days if their license plate was odd, and on even-numbered days if their license plate was even. The system was well-defined and not random in its restrictions; however, since license plate numbers have nothing to do with a person's fitness to purchase gasoline, it is still an arbitrary division of people. Similarly, schoolchildren are often organized by their surname in alphabetical order, a non-random yet still arbitrary method, at least in most cases where surnames are irrelevant.

cobby · 21 October 2008

Did you finally realise that “Body Plans” doesn’t mean what you thought it meant?

.... what do YOU think it means??

cobby · 21 October 2008

Yes, it is a whole field of science called abiogenesis. Spend a few minutes with google.

... google ME the STUDIES that prove it. of course the term exists. that does not mean it is a proven concept

cobby · 21 October 2008

No responses to the fact that I do read many of the papers pointed to by others on this blog and more importantly that the papers explain exactly what you say they don’t?

.... pick one you have read and lets discuss it!

cobby · 21 October 2008

reationist are self labeled. You can argue with them over the use of the term. The “Creation Science” movement adopted the label in the early 90’s

...creation science <> creationism. study harder

cobby · 21 October 2008

Do you understand that your meaning of “Creationist” isn’t the meaning anyone else, including said Creationist, have?

.... sorry charlie, wiki agrees with ME not YOU:

Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution as an explanation of origins.[2]

Such beliefs include young Earth creationism, proponents of which believe that the earth is thousands rather than billions of years old. They believe the days in Genesis Chapter 1 are 24 hours in length, while Old Earth creationism accepts geological findings and other methods of dating the earth and believes that these findings do not contradict the Genesis account, but reject evolution. The term theistic evolution has been coined to refer to beliefs in creation which are more compatible with the scientific view of evolution and the age of the Earth. Alternately, there are other religious people who support creation, but in terms of allegorical interpretations of Genesis.

cobby · 21 October 2008

So far there hasn’t been a need for a question of “Is DNA is sufficient?”.

... DUHHHH!!! I think if you believe in the sci method you have to prove things whether you feel there is a 'need' or not

... have you seen anything that shows that pink unicorns do not exist? you are saying as long as we do not see any evidence that DNA is not sufficient it is sufficient? sorry charlie, thats not SCIENCE!

Dave Luckett · 21 October 2008

Cobby again demonstrates that he can't read and doesn't want to try.

Cobby, you were told "The naturalist would say that “life” most likely formed from “non life” in a natural process."

Note the term "the naturalist". You were being told what naturalists think. It doesn't have to be what you think. Note also the qualifier "most likely". This was not some kind of revelation, but a cautious statement of the implication of a general principle disprovable in specific instances by evidence.

This principle is that the supernatural should not be assumed without the clearest necessity for it. It arises from Occam's Razor: "entities should not be unnecessarily multiplied". There is no clear necessity for supernatural means to explain the appearance of life. On the contrary, natural means have been proposed and are being investigated. Since there is no compelling need to assume a supernatural cause, the naturalist does not assume one.

Your boot is therefore on the wrong foot. The naturalist need not prove that supernatural means are not necessary. It is for those who assume such means to prove that they *are* necessary. This they have not done. No good evidence has ever been offered for that proposition. Nothing but arid philosophising has ever resulted from it, while on the other hand investigating the natural world by assuming natural means - a pursuit otherwise known as "science" - has produced enormous gains and benefits for all humanity.

Assume whatever you want, Cobby. You're never going to make any contribution to knowledge, anyway. Me, I'm going with the winners, because I'm not a fool.

Wayne Francis · 21 October 2008

cobby said: Did you finally realise that “Body Plans” doesn’t mean what you thought it meant? .... what do YOU think it means??
I defined what it means already...oh yea you have "selective reading" ability. You only read what you want to. Just because you found 1 wiki entry that is confused, you could have made that wiki entry for all we know, doesn't mean that that is the definition of "arbitrary" I'll use the definition supplied by reputable English dictionaries.

Wayne Francis · 21 October 2008

cobby said: Yes, it is a whole field of science called abiogenesis. Spend a few minutes with google. ... google ME the STUDIES that prove it. of course the term exists. that does not mean it is a proven concept
You have no clue what science is and your comment show it. Not only does the term exist but many scientist are actively studying how it could have happened. We hand you papers all the time. You don't pay attention to any of them. Why should we continue to provide you with references to papers that you will not even look at? "Abiogenesis" is more of a science then "string theory". There have been many hypothesises made that have to do with abiogenesis and many shown that they are plausible. It is not my responsibility to spoon feed you everything. Until you show us that you actually read the stuff we point you to don't expect us to do all the leg work for you. But here is just one paper of many on the topic "Peptide nucleic acids rather than RNA may have been the first genetic molecule." See science doesn't "prove" anything but provides the best currently fitting answer to a issue. You can't "prove" that the earth will continue spinning on its axis and thus cause the sun to rise tomorrow morning. We can provide data to support that it will.

Wayne Francis · 21 October 2008

cobby said: No responses to the fact that I do read many of the papers pointed to by others on this blog and more importantly that the papers explain exactly what you say they don’t? .... pick one you have read and lets discuss it!
I gave you 2. Lets go with the second one. “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” by Kenneth Weber, Nancy Johnson, David Champlin, and April Patty from Genetics Society of America read it and tell me what problems you have with it.

Wayne Francis · 21 October 2008

cobby said: reationist are self labeled. You can argue with them over the use of the term. The “Creation Science” movement adopted the label in the early 90’s ...creation science <> creationism. study harder
Creation Scientist adopted the term "Creationism". Read their books. It isn't that scientist labeled them Creationist, they labeled themselves that. Again just because you have no clue on how people use terms doesn't mean squat. I never said Creation Science = creationism, though creation science does adopt the tenants of creationism. They are overlapping concepts.

Science Avenger · 21 October 2008

cobby said: ...creation science <> creationism. study harder
You are full of shit, as usual. The only difference between creationism and "creation science" is the politicization of the label, as is "intelligent design". In the end, it is all the same shit, and stinks just as badly.

Wayne Francis · 21 October 2008

cobby said: Do you understand that your meaning of “Creationist” isn’t the meaning anyone else, including said Creationist, have? .... sorry charlie, wiki agrees with ME not YOU: Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution as an explanation of origins.[2] Such beliefs include young Earth creationism, proponents of which believe that the earth is thousands rather than billions of years old. They believe the days in Genesis Chapter 1 are 24 hours in length, while Old Earth creationism accepts geological findings and other methods of dating the earth and believes that these findings do not contradict the Genesis account, but reject evolution. The term theistic evolution has been coined to refer to beliefs in creation which are more compatible with the scientific view of evolution and the age of the Earth. Alternately, there are other religious people who support creation, but in terms of allegorical interpretations of Genesis.
How does this disagree with what I said? The bold faced text above says what I said. That most people associate creationism with people that have literal view of the bible. You yourself said that you would call them ‘bible literalist’. The rest of us, including creationist themselves, call them creationist. The key is that "Creationist" reject evolution despite all the evidence.

Wayne Francis · 21 October 2008

cobby said: So far there hasn’t been a need for a question of “Is DNA is sufficient?”. ... DUHHHH!!! I think if you believe in the sci method you have to prove things whether you feel there is a 'need' or not ... have you seen anything that shows that pink unicorns do not exist? you are saying as long as we do not see any evidence that DNA is not sufficient it is sufficient? sorry charlie, thats not SCIENCE!
I don't say pink unicorns don't exist because you can't prove a negative. I also don't suggest that anyone write a scientific paper on the existence of pink unicorns. I don't say there is some other information source for development. What I say is that there is no evidence that there is some other source needed. All the evidence points to the fact that DNA is enough. That is what science is about following the evidence not looking for something that there is no evidence of.

Dave Lovell · 21 October 2008

cobby said: YES we do reasonably know that DNA has enough info. .... how have you determined that??
Is that the entirety of your response to my post? No opinion on whether you think there is sufficient info in a fertilised human egg cell? No opinion on whether you think there is sufficient difference between fertilised Great Dane and Chijuajua egg cells? No suggestions on how to even begin estimate the information requirements of a process not fully understood? So, YES we do reasonably know that DNA has enough info, (I've put my emphasis back,) but it can only be shown to be sufficient once development if fully understood.
cobby also said: So far there hasn’t been a need for a question of “Is DNA is sufficient?”. … DUHHHH!!! I think if you believe in the sci method you have to prove things whether you feel there is a ‘need’ or not … have you seen anything that shows that pink unicorns do not exist? you are saying as long as we do not see any evidence that DNA is not sufficient it is sufficient? sorry charlie, thats not SCIENCE!
It would not be science if a conclusion depended on the assumption that there was sufficient information, Research can only ever show how a structure derives from a particular part of the genome, but the fact that eggs always seem to manage to grow into chickens without further help suggests it is a reasonble woking assumption. Do you see any evidence that gravity does not have sufficient pull to hold things on the ground? Your logic would suggest Boeing should be investing their R&D budget in Gravitational Physics, not wasting it on aerodynamics.

Dave Lovell · 21 October 2008

Wayne Francis said to cobby: In fact you've proven that your understanding of the meanings of words is marginal at best.
I have to disagree with you here. His understanding of the meanings of words is not marginal, it is the core of all his arguments. You will never get him to agree with you on the exact meaning of a word or idea. By not agreeing a common vocabulary, he can convince himself he has won any argument based on his current interpretation of words. By debating the meaning of words, he can avoid having to contemplate the implications of the ideas they are expressing. Long ago, he was prepared to argue at length about how many bits make up a byte, claiming from 4 to at least 64, whilst simultaneously claiming seven hundred and fifty million of them were insufficient, regardless of how big they were. Every time he concedes a point, or clarifies some ambiguity, his little cloud of fuzzy logic shrinks a little bit more. I think he has learnt from experience never to do this in case reality intrudes into his comfortable make-believe world.

cobby · 21 October 2008

By not agreeing a common vocabulary,

... YOU are the one not agreeing on a common vocabulary.

... for starts define 'evolution;.

cobby · 21 October 2008

Long ago, he was prepared to argue at length about how many bits make up a byte, claiming from 4 to at least 64, whilst simultaneously claiming seven hundred and fifty million of them were insufficient, regardless of how big they were

.... wrong again. a bytes is a collection of bits. the amount can vary but now the customary, conventional amount is 8. stop lying

cobby · 21 October 2008

So, YES we do reasonably know that DNA has enough info,

.... you do not know ! you believe! FAITH!

cobby · 21 October 2008

What I say is that there is no evidence that there is some other source needed.

.... so lack of evidence makes conclusions??? Not SCIENCE! sorry.

PvM · 21 October 2008

Ignoring the evidence once again? Still reluctant to educate yourself?
cobby said: So, YES we do reasonably know that DNA has enough info, .... you do not know ! you believe! FAITH!

Robin · 21 October 2008

cobby said: So, YES we do reasonably know that DNA has enough info, .... you do not know ! you believe! FAITH!
False. We do know and have demonstrated such. Not our problem that you will not read or cannot understand that which has been provided in plenty of detail.

Stanton · 21 October 2008

cobby said:

By not agreeing a common vocabulary,

... YOU are the one not agreeing on a common vocabulary. ... for starts define 'evolution;.
You are the one who is trying to redefine "creationist," and we have already defined "evolution," i.e., "descent with modification from generation to generation" months and months and months ago.

Wayne Francis · 21 October 2008

Hey Blow Jobby,
Have you read that paper you asked me to pick so we can discuss it yet? Or are you going to, once again, claim it doesn't actually say what it says then say you don't have to read it until someone puts it into a language that a kindergartner can understand? (which I still think is about 3 years to advanced for you)

In case you forgot and are to lazy to look up a few post the paper is

“Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”

by Kenneth Weber, Nancy Johnson, David Champlin, and April Patty from Genetics Society of America

I eagerly await your response on how and why this paper does not actually explain Drosophila Melanogaster wing morphology. I'll clue you in..."morphology" is a grown up word for "shape"

Henry J · 21 October 2008

“Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”

But it's still a fruit fly!!1111!!eleven!!

Wayne Francis · 21 October 2008

*crickets chirping*

over 12 hours now. Maybe Hand Jobby has finished reading the abstract of paper, then again probably not.

Come on blow jobby the paper is less then 10,000 words.

Wayne Francis · 22 October 2008

I read the paper again jobby. Hope you are taking so long because you are doing some research on any questions you have about the paper.

cobby · 22 October 2008

Wayne Francis said: Hey Blow Jobby, Have you read that paper you asked me to pick so we can discuss it yet? Or are you going to, once again, claim it doesn't actually say what it says then say you don't have to read it until someone puts it into a language that a kindergartner can understand? (which I still think is about 3 years to advanced for you) In case you forgot and are to lazy to look up a few post the paper is “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” by Kenneth Weber, Nancy Johnson, David Champlin, and April Patty from Genetics Society of America I eagerly await your response on how and why this paper does not actually explain Drosophila Melanogaster wing morphology. I'll clue you in..."morphology" is a grown up word for "shape"
.... have YOU read it??

Wayne Francis · 22 October 2008

cobby said:
Wayne Francis said: Hey Blow Jobby, Have you read that paper you asked me to pick so we can discuss it yet? Or are you going to, once again, claim it doesn't actually say what it says then say you don't have to read it until someone puts it into a language that a kindergartner can understand? (which I still think is about 3 years to advanced for you) In case you forgot and are to lazy to look up a few post the paper is “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” by Kenneth Weber, Nancy Johnson, David Champlin, and April Patty from Genetics Society of America I eagerly await your response on how and why this paper does not actually explain Drosophila Melanogaster wing morphology. I'll clue you in..."morphology" is a grown up word for "shape"
.... have YOU read it??
Yes I have blow jobby. I told you that here http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170606 and here http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170699 the second one appearing just above your post. You know where I said "I read the paper again jobby." I await your analysis on what problems you have with said paper. You are avoiding actually learning something aren't you Blow Jobby. You've had a day now since you asked me to pick one and many more days since you where pointed to these papers by others. Now you claim that these papers, to include the one I have picked, and have read twice now, do not address how wing morphology is controlled by genetics. It is under 10,000 words Jobby. Doesn't take that long to read.

Wayne Francis · 22 October 2008

Well Blow Jobby you have another 6-8 hours to read the paper. I'm going to bed. I look forward to your comments on the paper. You keep saying the papers don't address how genetics control morphology but you clearly have not read the papers so unless "God" is talking to you I'm at a loss how you can make those statements.

DS · 22 October 2008

Wayne,

Good luck. I picked a paper for the dill weed to read almost three weeks ago. Althouth it never read it, it still demanded just such a paper thirty more times since then. I think it knows that it could never understand a real scientific paper, so it must avoid reading one at all costs. Of course everyone else already knows that it can't comprehend anything scientific. Now why on earth would it want to come here and display it's ignorance for all to see? Who cares, let it wallow in ignorance.

Dave Lovell · 22 October 2008

Wayne Francis said: Well Blow Jobby you have another 6-8 hours to read the paper. I'm going to bed. I look forward to your comments on the paper. You keep saying the papers don't address how genetics control morphology but you clearly have not read the papers so unless "God" is talking to you I'm at a loss how you can make those statements.
A prophesy.
cobby will say: … DUHHHH!!! Of course it shows genetics affect morphology, but it doesn't show HOW it does it.

cobby · 22 October 2008

... you really counted the hours since I last talked to you??

cobby · 22 October 2008

“Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”

... if you read it you can tell me what is says that makes you believe it shows how the shape of the wings are determined. not just now they are 'affected' actually I do not think you read one word of this article.

Henry J · 22 October 2008

Good grief.

SWT · 22 October 2008

cobby said: “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” ... if you read it you can tell me what is says that makes you believe it shows how the shape of the wings are determined. not just now they are 'affected' actually I do not think you read one word of this article.
And so our intrepid troll of many names provides additional validation of the title of this thread ...

cobby · 22 October 2008

Good grief.

... I agree. I do not think of these posters have read ANY of the articles they have referred to. It is easy just to make a list of article that supposed prove their points and say 'go read them'.

phantomreader42 · 22 October 2008

And of course, your evidence in support of this claim consists entirely of the sworn testimony of the voices in your head. Yet, it is utterly impossible for YOU to read even a single word of any of those articles. Despite the fact that YOU are the one who has been demanding them for months. Poor illiterate sack of shit. Totally devoid of even the illusion of substance. The undead troll has finally reached its lifelong goal. Bobby the boob has acheived clinical brain-death. There is nothing left there. Just an empty husk repeating its old lies until the end of time. No thought behind it at all.
cobby said: Good grief. ... I agree. I do not think of these posters have read ANY of the articles they have referred to. It is easy just to make a list of article that supposed prove their points and say 'go read them'.

PvM · 22 October 2008

Still refusing to educate yourself I notice? Somehow I do not feel surprised.
cobby said: Good grief. ... I agree. I do not think of these posters have read ANY of the articles they have referred to. It is easy just to make a list of article that supposed prove their points and say 'go read them'.

Wayne Francis · 22 October 2008

cobby said: “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” ... if you read it you can tell me what is says that makes you believe it shows how the shape of the wings are determined. not just now they are 'affected' actually I do not think you read one word of this article.
See now the purpose isn't for me to write cliff notes on the paper for you in less then kindergarten terms. This is about you reading a paper that clearly states how some feature's development is controlled by genetics, in this case wing morphology. Then you making clearly false statements about specific claims so that we can, yet again, show you to be an ignorant lying troll even when you do read even part of the paper. Now if you hadn't proven yourself to be a willfully ignorant lying troll over the last 1500+ posts then you would find many of us more willing to spoon feed you the information and politely correct your misunderstanding of genetics and development. Hell we would even dismiss your poor use/understanding of the English language. But once again you avoid doing anything to increase your knowledge and expect everyone to do a bunch of work which you would clearly ignore anyway. I'd normally be happy to put a more complicated paper into easier terms using analogies but you taken analogies to literally have time and time again. You have a biblical literalist mind set and believe something is either completely true or completely false which means analogies, metaphors and allegory are lost on you. Real shame because, despite your contrary claim that you are not religious, your actions point to a fundamentalist religious nut job and thus you can't understand the one book you probably worship so much in the proper context. I'll read the next set of posts on page 54. Maybe you had a change of heart and actually decided to do some self improvement and stop evading task that you yourself have set for yourself. I will not hold my breath though.

Wayne Francis · 22 October 2008

cobby said: Good grief. ... I agree. I do not think of these posters have read ANY of the articles they have referred to. It is easy just to make a list of article that supposed prove their points and say 'go read them'.
You said pick one. I picked one that I have now read twice in the last week. You are the one that claims that the paper does not address the topic of genetics and how it controls wing morphology without even reading it. This is akin to saying the "The wicked witch of the east did not die by a house falling on her in the wizard of oz" without reading the book The Wonderful Wizard of Oz I've read the paper and I'm prepared to read it many times over to address any issue you have with the paper after you read it. This means you need to read the paper and if you think you have found a problem with part of the paper you state what part of the paper you have a problem with and what exactly is problem with it. I'm sure then that not only myself but many other people would be more then happy to address your misunderstanding. No doubt you will move the goal post but be assured I'll keep pointing out that you have requested me to pick one paper that we have both read so that we can discuss it. You now don't want to read the paper and make claims about the content of the paper without even reading it. Blow Jobby, you are a willfully ignorant lying worm that lacks any integrity at any level of your being. If you are a religious person then I really would fear for your soul if I was you.

Wayne Francis · 22 October 2008

Glad I didn't hold my breath.

Dave Luckett · 22 October 2008

Proverbs 15:14.

DS · 22 October 2008

Wayne,

Nice try, but remember that others have previously picked papers and even presented entire abstracts. Hand Jobby still hasn't realized that he will never know if the papers answer the questions it asks or not until it reads them. It also hasn't seemed to realize that unless it reads them, it can never tell if anyone else has read them or not.

It's refusal to read the papers is strong evidence that it doesn't care about the answers to it's questions. If it really did care, it would have gotten a real education and read the papers already. It also doesn't seem to realize that absolutely no one cares if it chooses to remain ignorant or not. In the end, all that it can demonstrate is the level of it's ignorance ind it's determination to maintain that condition.

Oh well, this asshole would probably read a recipe for cake and demand to know where in the recipe the shape was determined.

cobby · 23 October 2008

DS said: Wayne, Nice try, but remember that others have previously picked papers and even presented entire abstracts. Hand Jobby still hasn't realized that he will never know if the papers answer the questions it asks or not until it reads them. It also hasn't seemed to realize that unless it reads them, it can never tell if anyone else has read them or not. It's refusal to read the papers is strong evidence that it doesn't care about the answers to it's questions. If it really did care, it would have gotten a real education and read the papers already. It also doesn't seem to realize that absolutely no one cares if it chooses to remain ignorant or not. In the end, all that it can demonstrate is the level of it's ignorance ind it's determination to maintain that condition. Oh well, this asshole would probably read a recipe for cake and demand to know where in the recipe the shape was determined.
...I do not believe any of you have actually read this articles. You just think you can make me go on a wild goose chase. Sorry, not going to do that. If you feel one of these studies back up your points paraphrase the points it makes and make your point. Other wise you are just a bunch of BSers.

cobby · 23 October 2008

Oh well, this asshole would probably read a recipe for cake and demand to know where in the recipe the shape was determined.

... well is a cake formed a shape say like a pyramid and you say the combination of ingredients cause that shape rather than some sort of mold or scaffolding well of course I would not believe it.

... and really what is going on with the toilet mouth stuff here? Don't you feel the least bit embarrassed about your language? Are you posters low-lifes?

Wayne Francis · 23 October 2008

cobby said:
DS said: Wayne, Nice try, but remember that others have previously picked papers and even presented entire abstracts. Hand Jobby still hasn't realized that he will never know if the papers answer the questions it asks or not until it reads them. It also hasn't seemed to realize that unless it reads them, it can never tell if anyone else has read them or not. It's refusal to read the papers is strong evidence that it doesn't care about the answers to it's questions. If it really did care, it would have gotten a real education and read the papers already. It also doesn't seem to realize that absolutely no one cares if it chooses to remain ignorant or not. In the end, all that it can demonstrate is the level of it's ignorance ind it's determination to maintain that condition. Oh well, this asshole would probably read a recipe for cake and demand to know where in the recipe the shape was determined.
...I do not believe any of you have actually read this articles. You just think you can make me go on a wild goose chase. Sorry, not going to do that. If you feel one of these studies back up your points paraphrase the points it makes and make your point. Other wise you are just a bunch of BSers.
We've done this and you've still just evaded reading anything. I've read this article twice. I have no problem with the article. You, blow jobby, are the one that claims it doesn't address genetic control of morphology without reading it. I say again this is like claiming the Wicked Witch of the East did not get crushed by Dorothy's house in The Wonderful Wizard of Oz while never even opening the book. ~9,200 words isn't much. You are a lying troll. You say you want to discuss a paper but you refuse to read said paper. There are thousands of papers that back our statements up. You just refuse to look at any of them. You, Blow Jobby, are a willfully ignorant lying troll that isn't capable of understanding even simple analogies. You make mentally handicapped individuals look like Newton.

Wayne Francis · 23 October 2008

cobby said: Oh well, this asshole would probably read a recipe for cake and demand to know where in the recipe the shape was determined. ... well is a cake formed a shape say like a pyramid and you say the combination of ingredients cause that shape rather than some sort of mold or scaffolding well of course I would not believe it.
surprise, surprise, Hand Jobby doesn't get the analogy and has to read it litterally. Look Blow Jobby, Genes can cause signal gradients. Cells developing along that gradient can develop differently depending on where they are along the gradient. The signal gradient is the "Cake Tin". You claim to understand gradients in one breath but every bit of shit that comes out of shows you have absolutely no clue what the hell is actually going on.
cobby said: ... and really what is going on with the toilet mouth stuff here? Don't you feel the least bit embarrassed about your language? Are you posters low-lifes?
You are a tool, a lying shit for brain troll. You don't respond to anything. We use this language so that the lurkers are clear you have zero respect from anyone here. We are all grown ups here. Swears are valid adjectives. We use them in a emphatic manner. They indicate the extreme disdain we have for your lack of integrity

fnxtr · 23 October 2008

Poor Yobbo's really backed itself into a corner. It's been so belligerent and confrontational this whole time, so that now, even if it does read the paper, it won't dare ask any questions about it, because that would be a sign of weakness.

I warned you in your last disguise, Yobbo, that if you were really serious about learning you'd get treated with respect, but if you came here looking for a fight you'd get creamed.

There's still a chance, Yobbo. Bury the hatchet, go read the friggin' paper already, and ask your questions. Who knows you might actually learn something from people who really do know more than you. I've learned a lot here in the last year or so and I'm grateful.

Of course, if you're 14 years old this will fall on blind eyes...

Robin · 23 October 2008

cobby said: “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” ... if you read it you can tell me what is says...
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! That's about as funny a troll tactic as I've ever seen! Talk about willful ignorance...LOL!

phantomreader42 · 23 October 2008

Robin said:
cobby said: “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” ... if you read it you can tell me what is says...
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! That's about as funny a troll tactic as I've ever seen! Talk about willful ignorance...LOL!
Even if anyone were to take the time to do this, the lying sack of shit would never bother reading the explanation. It's acheived total brain-death, and it likes it that way. It's never had the slightest interest in understanding the real world, and now it's thrown away even the ability to contemplate such things.

PvM · 23 October 2008

Seems Bobby is still unwilling to engage in a scientific discussion. I am not surprised as he would not stand a chance. Excellent choice Bobby, ignorance is best hidden in a dark place. As to being a bunch of BS'ers, can we expect any time soon a coherent estimate of the information content of the human body? Or was that just 'BS'? Thought so.
cobby said: ...I do not believe any of you have actually read this articles. You just think you can make me go on a wild goose chase. Sorry, not going to do that. If you feel one of these studies back up your points paraphrase the points it makes and make your point. Other wise you are just a bunch of BSers.

cobby · 23 October 2008

PvM said: Seems Bobby is still unwilling to engage in a scientific discussion. I am not surprised as he would not stand a chance. Excellent choice Bobby, ignorance is best hidden in a dark place. As to being a bunch of BS'ers, can we expect any time soon a coherent estimate of the information content of the human body? Or was that just 'BS'? Thought so.
cobby said: ...I do not believe any of you have actually read this articles. You just think you can make me go on a wild goose chase. Sorry, not going to do that. If you feel one of these studies back up your points paraphrase the points it makes and make your point. Other wise you are just a bunch of BSers.
... no lets talk about that article you supposedly read. can you quote a few sentences out of it that support your assertion??

cobby · 23 October 2008

Robin said:
cobby said: “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” ... if you read it you can tell me what is says...
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! That's about as funny a troll tactic as I've ever seen! Talk about willful ignorance...LOL!
... i doubt YOU read it! read it and quote me a few pertinent paragraphs. you big BSer!

PvM · 23 October 2008

cobby said:
PvM said: Seems Bobby is still unwilling to engage in a scientific discussion. I am not surprised as he would not stand a chance. Excellent choice Bobby, ignorance is best hidden in a dark place. As to being a bunch of BS'ers, can we expect any time soon a coherent estimate of the information content of the human body? Or was that just 'BS'? Thought so.
cobby said: ...I do not believe any of you have actually read this articles. You just think you can make me go on a wild goose chase. Sorry, not going to do that. If you feel one of these studies back up your points paraphrase the points it makes and make your point. Other wise you are just a bunch of BSers.
... no lets talk about that article you supposedly read. can you quote a few sentences out of it that support your assertion??
It was not me who claimed to have read the article in question. I was commenting on your inability to address scientific research unless it is spoon fed to you. I am not surprised.

PvM · 23 October 2008

cobby said: ... i doubt YOU read it! read it and quote me a few pertinent paragraphs. you big BSer!
Ah, the scientific vacuity of Bobby's position is once again exposed. Afraid to discuss science eh Bobby? I am not surprised given your past performance, or lack thereof. Your foolishness is exposing not only the scientific vacuity of ID but it also reflecting poorly on your faith. WWJD Bobby?

cobby · 23 October 2008

Afraid to discuss science eh Bobby?

... No but obviously YOU are. Just write 2 sentences on how that article demonstrates your point!

cobby · 23 October 2008

Intelligent Design:
Required by Biological Life?
February 19, 2008
K.D. Kalinsky

... here is an article that explains how ID is required for life. It supports my assertions here.

Dave Lovell · 23 October 2008

cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
Are you old enough to remember John McEnroe at Wimbledon?

PvM · 23 October 2008

cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
No it doesn't. So when will you discuss the papers which expose your ignorance?

cobby · 23 October 2008

PvM said:
cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
No it doesn't. So when will you discuss the papers which expose your ignorance?
You are too lazy to read the paper?? Your willful ignorance is showing yet again!

phantomreader42 · 23 October 2008

cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
I don't believe you've even read this paper :P If you've read it, summarize it for us. Explain which of your IDiotic assertions it supports, and how. Then explain it again, ten thousand times. Of course, you've contradicted yourself so many times it's hard to even tell what the hell you're arguing anymore. What, don't like being held to your own double standards? Well you can go fuck yourself. You've been lying and bullshitting for months. Not once, in all that time, have you even attempted to offer the slightest speck of evidence in support of your IDiocy. This paper is worthless. The author pretends evolution is a purely random one-step process. Anyone with the slightest understanding of evolution knows this is nonsense. The question of whether the author is incompetent or a liar cannot be conclusively answered from this one article, but it's clear he must be at least one of these. In your case, it is obvious you are willfully ignorant, intellectually bankrupt, and lying through your teeth. Also note, for the record, that the troll is explicitly endorsing ID. He's sure to lie about this in the future, as he has before.

phantomreader42 · 23 October 2008

cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
If this actually supports your IDiotic, self-contradictory bullshit, why have you not mentioned it before? You've been babbling for months, flinging your shit in every direction, asked countless times for even the slightest shred of evidence. And you never even tried to offer ANY. If this is your evidence, why wait until now? Oh, yeah, because it, like you, is a worthless piece of shit.

PvM · 23 October 2008

What suggests you that I have not read the paper. In fact, the paper does little to support your claims. Simple as that. But you still owe us your comments on the papers proposed to resolve your ignorance of developmental biology. I guess you have all but admitted defeat here? Not too surprised really
cobby said:
PvM said:
cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
No it doesn't. So when will you discuss the papers which expose your ignorance?
You are too lazy to read the paper?? Your willful ignorance is showing yet again!

phantomreader42 · 23 October 2008

The voices in his head told him that you didn't read it. Who's he gonna believe, reality, or the voices in his head? It's obvious to anyone with a brain that he's a total failure, but he will never see it. He's turned off his brain to better hide from reality.
PvM said: What suggests you that I have not read the paper. In fact, the paper does little to support your claims. Simple as that. But you still owe us your comments on the papers proposed to resolve your ignorance of developmental biology. I guess you have all but admitted defeat here? Not too surprised really
cobby said:
PvM said:
cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
No it doesn't. So when will you discuss the papers which expose your ignorance?
You are too lazy to read the paper?? Your willful ignorance is showing yet again!

Henry J · 23 October 2008

Who’s he gonna believe, reality, or the voices in his head?

I guess the voices are louder.

tresmal · 23 October 2008

One problem with this paper is that it declares that natural selection (if it exists) must itself be a product of intelligent design.This is just an invocation of the Strong Anthropic Principle. Another problem is that it suffers from the "lottery fallacy". It confuses the probability of a lottery producing a particular winner for the probability of it producing a winner.

Henry J · 23 October 2008

It confuses the probability of a lottery producing a particular winner for the probability of it producing a winner.

Don't pretty much all the probability-based anti-evolution arguments do that? Henry

phantomreader42 · 23 October 2008

Henry J said:

It confuses the probability of a lottery producing a particular winner for the probability of it producing a winner.

Don't pretty much all the probability-based anti-evolution arguments do that? Henry
What do you expect? The facts are against them, so their only hope is to misrepresent and make shit up.

Robin · 23 October 2008

phantomreader42 said:
Robin said:
cobby said: “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” ... if you read it you can tell me what is says...
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! That's about as funny a troll tactic as I've ever seen! Talk about willful ignorance...LOL!
Even if anyone were to take the time to do this, the lying sack of shit would never bother reading the explanation. It's acheived total brain-death, and it likes it that way. It's never had the slightest interest in understanding the real world, and now it's thrown away even the ability to contemplate such things.
This has never been about interest, valid criticism, scientific improvement, or learning; this has always been about it just getting some attention.

Robin · 23 October 2008

cobby said:
Robin said:
cobby said: “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” ... if you read it you can tell me what is says...
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! That's about as funny a troll tactic as I've ever seen! Talk about willful ignorance...LOL!
... i doubt YOU read it! read it and quote me a few pertinent paragraphs. you big BSer!
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! You just keep getting funnier there, Jobob! No my simple-minded troll, *YOU* demonstrate that *YOU'VE* read and understand the article provided by critically analyzing the evidence presented. I won't hold my breath...you little BSer.

Robin · 23 October 2008

cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! Not only is said "article" not published in any valid scientific publication and not only does the author not identify any credentials as having any authority on the subject, the article does not even support any of the assertions you've brought up in the last 50 or so pages here. You're just a hoot, Jobob!! LOL!

cobby · 23 October 2008

Robin said:
cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! Not only is said "article" not published in any valid scientific publication and not only does the author not identify any credentials as having any authority on the subject, the article does not even support any of the assertions you've brought up in the last 50 or so pages here. You're just a hoot, Jobob!! LOL!
... the whole point went completely over your head. where is YOUR article supporting YOUR assertions???

cobby · 23 October 2008

These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory!

pages of avoidance. just pick an article and discuss it! dummies!

tresmal · 23 October 2008

cobby said: These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory! pages of avoidance. just pick an article and discuss it! dummies!
I have a better idea. Why don't you pick an article and discuss it. The one Wayne Francis referred to will be fine or any of the articles PvM referred you to will also work. Then you can paraphrase it, since only you see any point to that, and point out where it fails.

phantomreader42 · 23 October 2008

cobby said: These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory! pages of avoidance. just pick an article and discuss it! dummies!
Wayne Francis picked an article two pages ago. YOU'RE the one who refuses to discuss it. Put up or shut up, you lying sack of shit. You've been spewing bullshit for months, but you're utterly incapable of offering the slightest speck of evidence, or even discussing someone else's evidence. Lies are all you have, all you've ever had, all you ever will have.

cobby · 23 October 2008

phantomreader42 said:
cobby said: These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory! pages of avoidance. just pick an article and discuss it! dummies!
Wayne Francis picked an article two pages ago. YOU'RE the one who refuses to discuss it. Put up or shut up, you lying sack of shit. You've been spewing bullshit for months, but you're utterly incapable of offering the slightest speck of evidence, or even discussing someone else's evidence. Lies are all you have, all you've ever had, all you ever will have.
... I dont think he ever read it. Also he has to do is write a couple of sentences about why he thinks it supports etc. But he never will because he DID NOT READ IT. its a bluff. why are you such a toilet mouth? did you come from a bad background??

SWT · 23 October 2008

cobby said: These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory!
Project much?

Henry J · 23 October 2008

Project much?

Maybe he works in a movie theater?

PvM · 23 October 2008

cobby said: ... I dont think he ever read it. Also he has to do is write a couple of sentences about why he thinks it supports etc. But he never will because he DID NOT READ IT. its a bluff. why are you such a toilet mouth? did you come from a bad background??
Why are you insisting on remaining ignorant of the facts? Why is it that you keep projecting?

PvM · 23 October 2008

Ironic, you have just described your state of ignorance.
cobby said: These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory! pages of avoidance. just pick an article and discuss it! dummies!

cobby · 23 October 2008

Henry J said:

Project much?

Maybe he works in a movie theater?
... no projection here. just want you to discuss the articles you say support your positions. go ahead why are you afraid? well i know why: 1. you have not read them 2. you know they are not very supportive. other wise why are you hiding??

PvM · 23 October 2008

No reason to be afraid, just aware of the simple fact that you are going to refuse to engage.
cobby said: ... no projection here. just want you to discuss the articles you say support your positions. go ahead why are you afraid? well i know why: 1. you have not read them 2. you know they are not very supportive. other wise why are you hiding??

cobby · 23 October 2008

PvM said: No reason to be afraid, just aware of the simple fact that you are going to refuse to engage.
cobby said: ... no projection here. just want you to discuss the articles you say support your positions. go ahead why are you afraid? well i know why: 1. you have not read them 2. you know they are not very supportive. other wise why are you hiding??
... I am very willing to discuss the article. So go ahead and tell me why you think it supports your position. why are you hiding?

DS · 23 October 2008

Man, this troll is just full of bullshit. All it has to do is read the paper and then it can ask a question that only someone who has read the paper can answer. Until it does, it will never know if anyone else has read a paper or not. Man, talk about being immune to evidence, this jerk wad is even immune to the concept of evidence.

PvM · 23 October 2008

cobby said: ... I am very willing to discuss the article. So go ahead and tell me why you think it supports your position. why are you hiding?
Nothing. I am merely exposing your level of ignorance my dear confused friend. My attempts to educate you about embryology, or the examples of natural selection or various other concepts have fallen on deaf ears and have been totally ignored by you. Your past actions speak loudly enough. PS: Speaking of hiding, why are you continuing to change your alias in violation of the policies of this board?

cobby · 23 October 2008

DS said: Man, this troll is just full of bullshit. All it has to do is read the paper and then it can ask a question that only someone who has read the paper can answer. Until it does, it will never know if anyone else has read a paper or not. Man, talk about being immune to evidence, this jerk wad is even immune to the concept of evidence.
... all YOU got to do is read the article. you have made claims back them up dummy

PvM · 23 October 2008

cobby said: ... all YOU got to do is read the article. you have made claims back them up dummy
I guess Bobby has abandoned reason and is now continuing his ignorance by refusing to read and discuss the relevant papers quoted which outline in detail why Bobby's understanding of embryology is significantly flawed. Ignorance does begets ignorance it seems

cobby · 23 October 2008

PvM said:
cobby said: ... all YOU got to do is read the article. you have made claims back them up dummy
I guess Bobby has abandoned reason and is now continuing his ignorance by refusing to read and discuss the relevant papers quoted which outline in detail why Bobby's understanding of embryology is significantly flawed. Ignorance does begets ignorance it seems
... why cant YOU read the article? and tell us why you think it supports your position. you are the one that say the article does so. back up your BS!

PvM · 23 October 2008

cobby said:
PvM said: I guess Bobby has abandoned reason and is now continuing his ignorance by refusing to read and discuss the relevant papers quoted which outline in detail why Bobby's understanding of embryology is significantly flawed. Ignorance does begets ignorance it seems
... why cant YOU read the article? and tell us why you think it supports your position. you are the one that say the article does so. back up your BS!
I have and you have ignored my arguments. Understandably but still somewhat foolishly. What's so scary about doing some actual reading and research Bobby. Show us that you understand embryology.

tresmal · 23 October 2008

Jobby. No one here is going to translate any article for you. You are going to have to read the article yourself. Admit it, you can't read scientific prose. If I'm wrong, Wayne Francis has an article that he would like to discuss. I've provided a link here:

Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”


Here's how it works: First you read the article and comment on it's faults, then we respond. IN THAT ORDER!

cobby · 23 October 2008

tresmal said: Jobby. No one here is going to translate any article for you. You are going to have to read the article yourself. Admit it, you can't read scientific prose. If I'm wrong, Wayne Francis has an article that he would like to discuss. I've provided a link here:
Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”

Here's how it works: First you read the article and comment on it's faults, then we respond. IN THAT ORDER!
.... sorry charlie, YOU are the one saying it supports your position. YOU should be the one to back up YOUR statement.

Henry J · 23 October 2008

Does ?obby have a relative named Eliza?

PvM · 23 October 2008

Now that is ironic when Bobby has failed to live up to his own standards. What a joke
cobby said: .... sorry charlie, YOU are the one saying it supports your position. YOU should be the one to back up YOUR statement.

Wayne Francis · 23 October 2008

cobby said:
Robin said:
cobby said: “Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster” ... if you read it you can tell me what is says...
HAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHAHA!!!! That's about as funny a troll tactic as I've ever seen! Talk about willful ignorance...LOL!
... i doubt YOU read it! read it and quote me a few pertinent paragraphs. you big BSer!
Cobby I read it. Three times now. I had a geeky dinner conversation last night where we discussed shit for brain lying trolls like hand jobby and we also got onto the topic of epigenetics and how things like temperature can effect the signal gradients. I'm sick of Hand Jobby evading using the same excuse so I'll give him a brief overview. Using inbred lines to keep genetic similarities outside of the insertions to a maximum they compare control groups to test groups. They show that rather then just one gene effecting wing shape there are multiple regions, both inside and outside of known genes that can effect wing shape. They pick wing shape since it is a essentially a 2 dimensional model. The determination of wing shape can be thought of as a polar equation where many variables are used to determent the shape of the wing. Let it be clearly understood that this doesn't mean that inserting GGA in a particular location equates to any numerical value you could plug into an actual mathematical formula. This study basically points out the complexity of even something like the wing morphology and that many different genetic segments, here using P Elements, can contribute to the overall morphology of the wing. These changes amplify and suppress existing signaling gradients. Some genes are co-opted in the developmental role. We know the genes that control the direction of the "hairs" on the wing also control the orientation of cells when they divide. The cells are regulated by morphogen gradients. The same genes are used in more then one place too. Often changes to wing morphology effect eye morphology because many of the same genes are used in development. This is why when you see someone with a noticeable genetic defect they most often have multiple physiological differences that are all do to the one genetic change or even just an epigenetic change like temperature during a given period of development. The study leveraged on this fact when analyzing the data. IE the genetic change to cause flies to have white or red eyes is well known. This can be used as an easy determination factor if a given change to a gene may be present. Now Blow Jobby, you lying sack of shit willfully ignorant troll, move your goal post and explain why you still won't read the paper I suggested and you are clearly avoiding reading. That is if you even understood any of this post. I understand why you won't read the paper. You can't understand that "arbitrary" and "logical" are antonyms, how can we expect you to understand about how many different genes can contribute to any given trait and how this is a good thing for a population. Genes that have highly beatifically changes and low negative side effects can be easily selected for over other genetic changes that may produce similar or even better morphological changes but also carry a larger negative impact upon an organism. Crawl back into your hole Blow Jobby.

Dave Luckett · 23 October 2008

Hopeless, and unintentionally hilarious. We started out with an assertion that genetics and known physical laws are not sufficient to determine morphology. When this was called nonsense - which it plainly is - the troll demanded "proof" that it was nonsense.

This ignores logic, not only because it defies Occam's Razor, and not only because it demands that an unknown cause whose effect is entirely unstated be ruled out, but because it inverts the debate in unreasonable terms. If the troll thinks that he has a defensible proposal that contradicts conventional biology, he must be the one to show the evidence for it. It is the proposer of a hypothesis who must defend it by reasoned argument from evidence.

But to proceed. Despite the manifest unreason of the demand, evidence that genetics and known physical laws are sufficient to account for morphology was furnished. Papers were cited. References found. Now the troll says he isn't going to look at the evidence, but demands that it be elucidated and defended to him so that he can decide whether he accepts it or not. Thus, he makes the plainly insane assertion that unless he is persuaded by evidence that he doesn't understand and won't even look at, he wins.

The whole transaction is ridiculous. It was patently and furiously unreasonable from the start, and has now descended into pure farce, except that farce often has a point to make. This is pointless.

Wayne Francis · 23 October 2008

cobby said: Afraid to discuss science eh Bobby? ... No but obviously YOU are. Just write 2 sentences on how that article demonstrates your point!
Ball is in your court Blow Jobby. Why don't you just run back to your pastor and complain how we are calling you names for being a willfully ignorant lying sack of shit for brain troll? I've waited a few days for you to read the paper you asked me to select. I've responded with my own abstract of said paper. The only thing left for me to do is post the whole paper in another post. All of this doesn't matter because, as PvM has pointed out, you have repeatedly ignored everything given to you to just turn around and say we are afraid to discuss anything. Well you are a typical religious fundamentalist nut job that projects his own inadequacy onto others. You are the type of person that makes all religion look bad to the causal observer. Keep avoiding learning. Hope that is working out for you in your daily life. As long as you stay in groups of other worthless pieces of shit that have no issues about lying for Jesus you should be just fine but as we've shown here time and time again your chances against normal rational people are non-existent.

Wayne Francis · 23 October 2008

cobby said: Intelligent Design: Required by Biological Life? February 19, 2008 K.D. Kalinsky ... here is an article that explains how ID is required for life. It supports my assertions here.
Yea and I've read "articles" about how the earth is really flat and that ether really exists. They are full of shit, much like you. There is a reason why your "article" has never been in a scientific journal. It can only be believed by willfully ignorant lying sacks of shit like yourself.

Wayne Francis · 23 October 2008

cobby said: These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory! pages of avoidance. just pick an article and discuss it! dummies!
Projection by the lying sack of shit troll named hand Jobby/cobby. He has either ignored every real discussion outright or just yelled "LIAR" or "WRONG" without even understanding what has been written. I picked an article which you claimed does not talk about genetics effecting morphology, without you even reading mind you. To which you've avoided reading the article and expected it to be spoon fed to you, even though this had been done in the past and you have ignored those efforts. So I've done the same. I've written my own little abstract of the paper and eagerly await your attempt to move the goalpost yet again so that you don't have to read a ~9200 word paper. I'm waiting for you to now read the paper and tell me what problems you have with said paper. But I won't hold my breath. The paper is fairly involved with lots of references to other papers that would confuse the shit out of an idiot such as yourself.

Wayne Francis · 23 October 2008

cobby said:
phantomreader42 said:
cobby said: These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory! pages of avoidance. just pick an article and discuss it! dummies!
Wayne Francis picked an article two pages ago. YOU'RE the one who refuses to discuss it. Put up or shut up, you lying sack of shit. You've been spewing bullshit for months, but you're utterly incapable of offering the slightest speck of evidence, or even discussing someone else's evidence. Lies are all you have, all you've ever had, all you ever will have.
... I dont think he ever read it. Also he has to do is write a couple of sentences about why he thinks it supports etc. But he never will because he DID NOT READ IT. its a bluff. why are you such a toilet mouth? did you come from a bad background??
I did read it, Blow Jobby, multiple times. I've paraphrased it, just as others have paraphrased other papers and had you ignore it. You can keep claiming no one reads anything despite all the evidence to the contrary but your actions are no better then a 2 year old throwing a fit. I've also explained why we use such terms when referring to you. So expect to be called a shit for brains willfully ignorant lying troll until you get some integrity and actually back your claims.

Wayne Francis · 23 October 2008

cobby said:
Henry J said:

Project much?

Maybe he works in a movie theater?
... no projection here. just want you to discuss the articles you say support your positions. go ahead why are you afraid? well i know why: 1. you have not read them 2. you know they are not very supportive. other wise why are you hiding??
No, you are projecting. As you have demonstrated in the past you do not want to discuss anything. Any time someone tries to discuss anything with you all you do is reply in the manner "WRONG, go away and learn something" without explaining why you feel they are wrong. There are thousands of papers on genetic control on morphology all peer reviewed. Have I read them all? Nope, don't need to. Have I read most of them? Nope, don't need to. Have I read a few of them? Yup, and every time I found that I either understood the concepts and they where logical or I didn't understand the concepts and you pretty much had to be at the PHD level in the relevant field to have the knowledge to follow the paper. You are the one that keeps yelling that there is no evidence without reading even a single paper. You are a willfully ignorant lying piece of shit for brain troll blow jobby. Go back to your holy book and stick your nose in it.

cobby · 24 October 2008

Wayne Francis said:
cobby said:
Henry J said:

Project much?

Maybe he works in a movie theater?
... no projection here. just want you to discuss the articles you say support your positions. go ahead why are you afraid? well i know why: 1. you have not read them 2. you know they are not very supportive. other wise why are you hiding??
No, you are projecting. As you have demonstrated in the past you do not want to discuss anything. Any time someone tries to discuss anything with you all you do is reply in the manner "WRONG, go away and learn something" without explaining why you feel they are wrong. There are thousands of papers on genetic control on morphology all peer reviewed. Have I read them all? Nope, don't need to. Have I read most of them? Nope, don't need to. Have I read a few of them? Yup, and every time I found that I either understood the concepts and they where logical or I didn't understand the concepts and you pretty much had to be at the PHD level in the relevant field to have the knowledge to follow the paper. You are the one that keeps yelling that there is no evidence without reading even a single paper. You are a willfully ignorant lying piece of shit for brain troll blow jobby. Go back to your holy book and stick your nose in it.
.... dummy, why the toilet mouth? how were you brought up? are you that dumb marine? is that what it is? ... anyhow how do you know I have not read papers? I claim pink unicorns do not exist and you keep saying 'keep looking, i have seen many of them. keep looking' and then i ask. 'show me one' and you say 'no its up to you to keep looking' sounds like a con game to me. the proverbial goose chase. ... this is just part of the con games Darwinists run. how many times have i heard 'there is mountains of evidence' and i say 'lets talk about one' and hear back 'there is so much we could not go over all of it' ... then i ask for a test. and hear back 'its just too, too complicated to be tested' what a con! ... what a bunch of cons!

cobby · 24 October 2008

Have I read them all? Nope, don’t need to. Have I read most of them? Nope, don’t need to.

..... yes your FAITH in Darwinism is unshakeable!

cobby · 24 October 2008

You can’t understand that “arbitrary” and “logical” are antonyms,

.... they are not 'antonyms' an arbitrary decision can be the most logical thing to do. for instance deciding that people whose last names are from A to M can only get drivers license on odd numbered days. this might be beyond your cognitive abilities.

cobby · 24 October 2008

They show that rather then just one gene effecting wing shape there are multiple regions, both inside and outside of known genes that can effect wing shape.

... and this shows how the shape is formed? sorry charlie. there is nowhere in the literature where any researchers have found out how the shapes are constructed. yes genes turn off and on etc but it is a gigantic mystery on WHY then turn on WHEN they do.

.... ok lets see if you can engage in a civil, academic converstaion:

.... do humans keep growing or at a certain age does growth stop. bones quit elongating? what age does this happen?

cobby · 24 October 2008

The only thing left for me to do is post the whole paper in another post.

... that would be a good idea. or just parts of it that you feel are appropriate

Wayne Francis · 24 October 2008

Blow jobby/cobby said: .... dummy, why the toilet mouth? how were you brought up? are you that dumb marine? is that what it is?
I've told you many times why we treat you with contempt shit for brains. I'm sorry if you can't understand that? Hope you know that the USMC has higher average entrance scores then the other branches of the armed services. That aside me calling you a useless twit has no bearing on my intelligence. It is directly correlated to your attitude on this thread.
Hand jobby/cobby said: ... anyhow how do you know I have not read papers? I claim pink unicorns do not exist and you keep saying 'keep looking, i have seen many of them. keep looking' and then i ask. 'show me one' and you say 'no its up to you to keep looking' sounds like a con game to me. the proverbial goose chase.
I you that mentally deficient that you can never remember what you yourself post you shit for brain troll? You've said you will not waste your time Look at your post here http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170778 where you say
... You just think you can make me go on a wild goose chase. Sorry, not going to do that...
Your own words. I told you I read the article and you said you wanted to discuss it but you've proven you are worthless piece of shit that can't even remember that you've admitted you won't read the papers.
Blow jobby/cobby said: ... this is just part of the con games Darwinists run. how many times have i heard 'there is mountains of evidence' and i say 'lets talk about one' and hear back 'there is so much we could not go over all of it'
Well, I've done what you've asked and summarized the paper and surprise surprise you ignore it and claim no one is willing to have a discussion with you.
Blow jobby/cobby said: ... then i ask for a test. and hear back 'its just too, too complicated to be tested' what a con!
Please show use where any one of us has said it is to complicated? What we have said is you are to stupid to understand the experiments that have been done. We can't help if you have an IQ under 75.
Blow jobby/cobby said: ... what a bunch of cons!
What an evader. You ask for papers on genetics controlling morphology. We provide you with stacks of papers. You ask to discuss 1 paper. We pic 1 paper that we can discuss. You refuse to read it and ask to be spoon fed. We summarize the paper. You go back to your unsupported accusations that we won't discuss anything with you. You are a worthless willfully ignorant lying sack of shit for brains troll that is incapable of learning even the basics of science or grammar and spelling for that matter. Only you are so stupid that you can't understand why we hold you in contempt.

Wayne Francis · 24 October 2008

cobby said: Have I read them all? Nope, don’t need to. Have I read most of them? Nope, don’t need to. ..... yes your FAITH in Darwinism is unshakeable!
I read them Blow Jobby/Cobby. I've even summarized it for you. Your an ignorant ass Hand Jobby. Keep evading.

cobby · 24 October 2008

As a side note, Kimura reasoned that about 107 or 108 bits bits of information would be necessary to specify human anatomy.(Source: Adaptation and Natural Selection By George Christopher Williams)

.... 10,000,000 bits for the human body?? way way too low!

cobby · 24 October 2008

... what is with the toilet-mouths here? Where I am from the underclass, uneducated, criminal types talk like this.

... I have responded to your discussion of the article. did you miss that?

... actually this toilet mouth talking makes the marine corp look really bad. and makes me ashamed of the US. no class, vulgar. just what the rest of the world thinks of us and this grunt is making US citizens look like ignorant, foul-mouthed bullies.

Wayne Francis · 24 October 2008

cobby said: You can’t understand that “arbitrary” and “logical” are antonyms, .... they are not 'antonyms' an arbitrary decision can be the most logical thing to do. for instance deciding that people whose last names are from A to M can only get drivers license on odd numbered days. this might be beyond your cognitive abilities.
You really are the biggest idiot Blow Jobby. That isn't an arbitrary decision. It is a logical decision based on the situation given situation. from http://encarta.msn.com/encnet/features/dictionary/DictionaryResults.aspx?lextype=2&refid=561565703 Synonyms: random, chance, subjective, uninformed, illogical, capricious, indiscriminate, haphazard You've shown over and over you have a poor grasp of the english language and definitions of words. An arbitrary decision would be something like rolling a 6 sided die when someone comes up for their drivers license and telling them to go away if it comes up 1 - 3. Just because you don't know the definition of a word and even if you find some other quote that misuses a word doesn't actually change the meaning of said word.

Wayne Francis · 24 October 2008

cobby said: They show that rather then just one gene effecting wing shape there are multiple regions, both inside and outside of known genes that can effect wing shape. ... and this shows how the shape is formed? sorry charlie. there is nowhere in the literature where any researchers have found out how the shapes are constructed. yes genes turn off and on etc but it is a gigantic mystery on WHY then turn on WHEN they do.
There is no mystery to anyone but you Blow Jobby. They turn on and off based on environmental factors and genetic factors. Its like your saying a giant set of dominoes can't fall in an intricate pattern all the while a huge pattern emerges before you http://www.broadcaster.com/clip/30597 And before you say that there has to be a start to this what do you think the fertilization of an egg does?
cobby said:.... ok lets see if you can engage in a civil, academic converstaion:
We've tried, you ignore every thing that has been told to you and shown to you. We are done trying to have a discussion with you and we are just here to show you for the worthless piece of shit that you are.
cobby said: .... do humans keep growing or at a certain age does growth stop. bones quit elongating? what age does this happen?
Depends on the human. There are humans that continue growing until, usually, their heart can no longer cope with the strain of pumping blood around their body. The age that people "stop growing" differs for different people depending of many factors to include genetics and environmental factors. So regardless your question is meaningless. Yes we understand you want some type of computer code that says
if(age.Year == 18) { stop_growing; }
But it doesn't work like that. People don't just "stop growing". When do people stop growning? Usually a few hours after they are prenounced dead.

Wayne Francis · 24 October 2008

cobby said: The only thing left for me to do is post the whole paper in another post. ... that would be a good idea. or just parts of it that you feel are appropriate
You've been provided the link to the full paper you lazy ignorant ass. Click on it and read it. The whole paper is appropriate. It explains what they tested for, how they did the tests, how they collected the results and what the results mean. You just refuse to read it because your a willfully ignorant lying sack of shit.

Wayne Francis · 24 October 2008

cobby said: As a side note, Kimura reasoned that about 107 or 108 bits bits of information would be necessary to specify human anatomy.(Source: Adaptation and Natural Selection By George Christopher Williams) .... 10,000,000 bits for the human body?? way way too low!
Prove it and your incredulity doesn't count. You'll have to define the limits of your encoding mechanism. You will also have to explain how and why this encoding mechanism accurately reflects the capability of biochemical processes. Like PvM has said before, we are still waiting for you to come up with a valid hypothesis from you. So far all you have done is pull shit from your ass and thrown it around.

Wayne Francis · 24 October 2008

cobby said: ... what is with the toilet-mouths here? Where I am from the underclass, uneducated, criminal types talk like this.
Don't like how normal people treat pieces of shit like you? Go back to your place of worship and cry to them. While you continue to spout your shit here we will keep referring to you as the willfully ignorant ass they you have shown yourself to be.
cobby said: ... I have responded to your discussion of the article. did you miss that?
No you didn't you lying sack of shit. You waved your hand and said that it doesn't prove anything. Behe tried this in court and the nation laughed at him. We've been laughing at your ignorance for over 1,500 posts now.
cobby said: ... actually this toilet mouth talking makes the marine corp look really bad. and makes me ashamed of the US. no class, vulgar. just what the rest of the world thinks of us and this grunt is making US citizens look like ignorant, foul-mouthed bullies.
Hey I don't swear 1/10th as much as I did when I was in active duty. I don't care what you think. People don't think bad of the USA because of swearing. They think bad of the USA because so many ignorant ass wipes like yourself that clearly don't know anything spout shit all the time and try to tell experts that they are all lying. Your ignorance would not be limited to just science and English but world politics too. For the record I don't support any of the current administrations action. Funny that the G.W.B. would probably agree with most of your statements but he a willfully ignorant ass too when it comes to anything intellectual.

phantomreader42 · 24 October 2008

Cobby would rather die than read that paper. You could post it ten thousand times, and he won't dare look at a single letter. He wouldn't even see it. His pitiful excuse for a brain will edit it out, or if that fails he can always gouge out his own eyes. Anything to avoid reality. He can't function without making shit up. Cobby is Bahgdad Bob. He lives by lies. He will go to his grave denying that the infidels have entered his country, while they stand all around him. Just like creationists have been saying that evolution is dead for two centuries, and been utterly wrong every single time. Bottom line, he's a lying sack of shit. He deserves nothing more than ridcule and derision, because he offers nothing more than endless lies and stupidity.
Wayne Francis said:
cobby said: The only thing left for me to do is post the whole paper in another post. ... that would be a good idea. or just parts of it that you feel are appropriate
You've been provided the link to the full paper you lazy ignorant ass. Click on it and read it. The whole paper is appropriate. It explains what they tested for, how they did the tests, how they collected the results and what the results mean. You just refuse to read it because your a willfully ignorant lying sack of shit.

cobby · 24 October 2008

Wayne Francis said:
cobby said: ... what is with the toilet-mouths here? Where I am from the underclass, uneducated, criminal types talk like this.
Don't like how normal people treat pieces of shit like you? Go back to your place of worship and cry to them. While you continue to spout your shit here we will keep referring to you as the willfully ignorant ass they you have shown yourself to be. ... I am not religious and do not go to church.
cobby said: ... I have responded to your discussion of the article. did you miss that?
No you didn't you lying sack of shit. You waved your hand and said that it doesn't prove anything. Behe tried this in court and the nation laughed at him. We've been laughing at your ignorance for over 1,500 posts now. ... well you cant wave your had and say ' this proves it ' either. did you understand at all what i was saying?
cobby said: ... actually this toilet mouth talking makes the marine corp look really bad. and makes me ashamed of the US. no class, vulgar. just what the rest of the world thinks of us and this grunt is making US citizens look like ignorant, foul-mouthed bullies.
Hey I don't swear 1/10th as much as I did when I was in active duty. I don't care what you think. People don't think bad of the USA because of swearing. ... I think the vulgar speech makes us look like low lifes. They think bad of the USA because so many ignorant ass wipes like yourself that clearly don't know anything spout shit all the time and try to tell experts that they are all lying. Your ignorance would not be limited to just science and English but world politics too. For the record I don't support any of the current administrations action. Funny that the G.W.B. would probably agree with most of your statements but he a willfully ignorant ass too when it comes to anything intellectual. ... actually you remind me of bully Bush

cobby · 24 October 2008

You’ve been provided the link to the full paper you lazy ignorant ass. Click on it and read it. The whole paper is appropriate. It explains what they tested for, how they did the tests, how they collected the results and what the results mean.

... where is the link??

cobby · 24 October 2008

phantomreader42 replied to comment from Wayne Francis | October 24, 2008 8:58 AM | Reply

Cobby would rather die than read that paper.

.... have YOU read it??

cobby · 24 October 2008

Depends on the human. There are humans that continue growing until, usually, their heart can no longer cope with the strain of pumping blood around their body.

... you cant be serious. even Acromegalics eventually stop growing. are you saying that most people continue to increase in height throughout their lives? you simply cannot be serious.

you are trolling me right??

SWT · 24 October 2008

cobby said: You’ve been provided the link to the full paper you lazy ignorant ass. Click on it and read it. The whole paper is appropriate. It explains what they tested for, how they did the tests, how they collected the results and what the results mean. ... where is the link??
The link is in this comment: http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170878 You have now been provided with, as you requested, ONE single paper to discuss, as you requested, a good summary of the paper in a PT poster's own words, and, as you requested, a link to the paper. It's now time for you to demonstrate that you've read the paper itself by commenting on the paper (not on the PT summary of the paper). It's an interesting paper, and part of an interesting line of research. Of course, I don't expect that you will actually read the paper, because I don't think you're here to learn anything or to make a particular point. I think you're only here to argue for the pleasure you get in arguing and irritating some of the people here; you don't need any particular technical knowledge to do that successfully.

SWT · 24 October 2008

cobby said:
tresmal said: Jobby. No one here is going to translate any article for you. You are going to have to read the article yourself. Admit it, you can't read scientific prose. If I'm wrong, Wayne Francis has an article that he would like to discuss. I've provided a link here:
Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”

Here's how it works: First you read the article and comment on it's faults, then we respond. IN THAT ORDER!
.... sorry charlie, YOU are the one saying it supports your position. YOU should be the one to back up YOUR statement.
I find it particularly amusing that you actually quoted the link you later requested; that strikes me as particularly inept, but completely in line with the hypothesis that you care only about argument, not about content.

Stanton · 24 October 2008

SWT said: I find it particularly amusing that you actually quoted the link you later requested; that strikes me as particularly inept, but completely in line with the hypothesis that you care only about argument, not about content.
Cobby/bobby/jobby/jacob/balanced/hamstrung/goff doesn't even care about argument: all he cares about is aggravating people with his malicious stupidity.

PvM · 24 October 2008

Sigh, can you not even find the link. Wow.
cobby said: You’ve been provided the link to the full paper you lazy ignorant ass. Click on it and read it. The whole paper is appropriate. It explains what they tested for, how they did the tests, how they collected the results and what the results mean. ... where is the link??

PvM · 24 October 2008

cobby said: you are trolling me right??
You should be able to tell, you are the biggest troll Bobby, and content less.

PvM · 24 October 2008

And yet it seems to be enough. So perhaps Bobby can walk us through his reasoning why he believes it is way too low. Especially since it seems to be in line with what all the evidence show. Does Bobby even understand the issues? So far his understanding of embryology and morphogenesis have been exposed as woefully insufficient if not totally absent.
cobby said: As a side note, Kimura reasoned that about 107 or 108 bits bits of information would be necessary to specify human anatomy.(Source: Adaptation and Natural Selection By George Christopher Williams) .... 10,000,000 bits for the human body?? way way too low!

SWT · 24 October 2008

Stanton said:
SWT said: I find it particularly amusing that you actually quoted the link you later requested; that strikes me as particularly inept, but completely in line with the hypothesis that you care only about argument, not about content.
Cobby/bobby/jobby/jacob/balanced/hamstrung/goff doesn't even care about argument: all he cares about is aggravating people with his malicious stupidity.
Sorry, I was unclear. I meant argument in the sense of "verbal dispute," not in the sense of "a connected series of statements intended to establish a proposition."

tresmal · 24 October 2008

PvM said: And yet it seems to be enough. So perhaps Bobby can walk us through his reasoning why he believes it is way too low. Especially since it seems to be in line with what all the evidence show. Does Bobby even understand the issues? So far his understanding of embryology and morphogenesis have been exposed as woefully insufficient if not totally absent.
cobby said: As a side note, Kimura reasoned that about 107 or 108 bits bits of information would be necessary to specify human anatomy.(Source: Adaptation and Natural Selection By George Christopher Williams) .... 10,000,000 bits for the human body?? way way too low!
(My emphasis) Now, that's a short walk! Pity he won't read your comment on C. elegans on the DNA information thread. Not that he would understand it if he read it. Not that he would accept it if he understood it.

DaveH · 24 October 2008

SWT said: ... I meant argument in the sense of "verbal dispute," not in the sense of "a connected series of statements intended to establish a proposition."
(Just to get it out of the way, so we can all get on with our lives) No you didn't!

phantomreader42 · 24 October 2008

DaveH said:
SWT said: ... I meant argument in the sense of "verbal dispute," not in the sense of "a connected series of statements intended to establish a proposition."
(Just to get it out of the way, so we can all get on with our lives) No you didn't!
Yes he did!

Henry J · 24 October 2008

Uh oh, was something contagious? :p

DaveH · 24 October 2008

Henry J said: Uh oh, was something contagious? :p
Hey, at least it's better informed than the discourse of that [python]steaming pile of parrot droppings [/python], Jobbie!

cobby · 24 October 2008

SWT said:
cobby said:
tresmal said: Jobby. No one here is going to translate any article for you. You are going to have to read the article yourself. Admit it, you can't read scientific prose. If I'm wrong, Wayne Francis has an article that he would like to discuss. I've provided a link here:
Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”

Here's how it works: First you read the article and comment on it's faults, then we respond. IN THAT ORDER!
.... sorry charlie, YOU are the one saying it supports your position. YOU should be the one to back up YOUR statement.
I find it particularly amusing that you actually quoted the link you later requested; that strikes me as particularly inept, but completely in line with the hypothesis that you care only about argument, not about content.
... Ok read most of the article. So where does it say how the shape of the wings are formed. I think you jokers just googled words like morphology. This article is not on how the shape of wings are formed. It is on the shapes affected. Big difference. Nice bluff try again.

Stanton · 24 October 2008

cobby said: This article is not on how the shape of wings are formed. It is on the shapes affected. Big difference.
How is that a meaningful difference?

Stanton · 24 October 2008

And does this mean you are going to finally provide undeniable evidence and or a logical explanation to support your claim that Genomic DNA is informationally insufficient to produce a (human) body, even though no extra-genomic protein or other gene product have ever been proven to exist, and that all of the translation/transcription processes initiated by any stimulus, environmental or bodily, are all regulated and mediated by gene products?

DS · 24 October 2008

Stanton wrote:

"How is that a meaningful difference?"

Yea, come on you guys. Showing that you can change the shape of a wall by adding or removing bricks doesn't prove that you can make a wall by just putting bricks together.

Seriously, as I suggested several hundred posts ago, knowledge of how changes in gene interaction affect wing shape is strong evidence that wing shape is indeed determined by gene interactions in development. That and the fact that there is absolutely no evidence whatsoever for any other mechanism and no need to hypothesize one.

Of course a troll who doesn't understand any of this fancy smancy gene stuff can't really be expected to appreciate the finer nuances of the evidence now can it?

DS · 24 October 2008

Wayne,

Congratulations, you're making real progress. It proved that it could at least read part of the title anyway.

PvM · 24 October 2008

Science is wasted on poor Jobby
cobby said: ... Ok read most of the article. So where does it say how the shape of the wings are formed. I think you jokers just googled words like morphology. This article is not on how the shape of wings are formed. It is on the shapes affected. Big difference. Nice bluff try again.

Stanton · 24 October 2008

Thank you so much for that newsflash of earthshaking importance, PmV.
PvM said: Science is wasted on poor Jobby
cobby said: ... Ok read most of the article. So where does it say how the shape of the wings are formed. I think you jokers just googled words like morphology. This article is not on how the shape of wings are formed. It is on the shapes affected. Big difference. Nice bluff try again.

Wayne Francis · 24 October 2008

cobby said: You’ve been provided the link to the full paper you lazy ignorant ass. Click on it and read it. The whole paper is appropriate. It explains what they tested for, how they did the tests, how they collected the results and what the results mean. ... where is the link??
More proof that hand Jobby is a shit for brains idiot. First all you had to do was cut and past the title into Google and click on the first link. But that was to difficult for your small brain. A link was provided to you in post http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170878 and maybe you could try to claim that you didn't read that post but we see the very next post is from you http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170879 in which you reply to the post saying
Blow Jobby/cobby said: .... sorry charlie, YOU are the one saying it supports your position. YOU should be the one to back up YOUR statement.
Our position is that genetics is the base cause of morphology within living organisms. This is Blow Jobby understandable language is DNA controls the shape of an organism's physical structures. Even that will go over Blow Jobby's head. The title alone sums up the paper. "Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster" For your little brain that means that that scientists can add in little bits of genetic code in lots of different places that have effects (increase and decrease different dimensions) on the shape of a fruit flies wing. Claiming it doesn't is like claiming a paper with the title "Why the sky is blue" doesn't explain why ... well the sky is blue. You don't even read the post that you reply too...oh wait. Maybe Blow Jobby does not know what a hyperlink is! OK Hand Jobby. When you see text with an underline under it and it is in a different color and when you move your mouse over it the underline goes away (if you are using the latest IE) then that is called a "Hyperlink" when you click on it a magical thing will happen and you'll be whisked away to another web page you shack of shit pea brain.

Wayne Francis · 24 October 2008

cobby said: phantomreader42 replied to comment from Wayne Francis | October 24, 2008 8:58 AM | Reply Cobby would rather die than read that paper. .... have YOU read it??
Doesn't matter if he/she has Blow Jobby. I've read it. You said you would discuss the paper with me. I've read it 3 times now. You refuse to read it so that we can discuss it. You wanted me to paraphrase it, probably because your pea brain couldn't get past even the abstract of the paper, which I did. You refused to really discuss even that, which is called moving the goal post as at that point if you could even understand my cliff notes version we wouldn't be discussing the paper but my understanding of the paper. You are a almost worthless piece of shit hand Jobby. The only redeeming fact about you is that you show, to the lurkers, how dangerous religious nut jobs like yourself could be to the world if you had any power.

Wayne Francis · 24 October 2008

cobby said: Depends on the human. There are humans that continue growing until, usually, their heart can no longer cope with the strain of pumping blood around their body. ... you cant be serious. even Acromegalics eventually stop growing. are you saying that most people continue to increase in height throughout their lives? you simply cannot be serious. you are trolling me right??
Again you have a reading comprehension problem. I pointed out that your question was faulty. You do continue to grow until you die. If you didn't ...well you would die a lot earlier wouldn't you. Your hair grows doesn't it? Most people brains continue to grow until they die, I think yours stopped about 20 weeks after you where conceived. Your skin grows at a huge rate. Different parts of the body grow at different rates. Just because you stop getting "taller" doesn't mean you stop growing shit for brains. Brenden Adams from the UK has a genetic alteration on one of the copies of chromosome 21 which broke the gene that is partly responsible for turning off most signals to grow. Consequently he would have continued growing if doctors didn't intervene and induce puberty which starts a process in which an individual stops growing "taller". Even so there are parts of Brenden that will continue to grow even tho he shouldn't grow any taller. This isn't acromegalics, which is only one of many disorders that can effect growth. Just like there isn't just one cause to cancer because "cancer" is just a blanket term for a number of conditions that have similar results. Ever notice how kids heads are bigger in comparison to their bodies then adults? Our bodies grow at a different rate then our head. Our brain continues to grow through out our life. Our frontal cortex isn't even well developed until our late 20's early 30's I know you don't think about things before you open your mouth and spew out shit but honestly you make yourself look like an ass every time you do it. And I am more then happy to point that you are an ass every time you do do it.

Wayne Francis · 24 October 2008

Stanton said:
SWT said: I find it particularly amusing that you actually quoted the link you later requested; that strikes me as particularly inept, but completely in line with the hypothesis that you care only about argument, not about content.
Cobby/bobby/jobby/jacob/balanced/hamstrung/goff doesn't even care about argument: all he cares about is aggravating people with his malicious stupidity.
Thing is he doesn't really aggravate me. I have a fun time showing him to be the village idiot gone wild. Kind of like going out to a club and standing next to ugly people. They make you look better looking just by standing next to them.

Malcolm · 24 October 2008

I get the impression that the troll thinks that there must be one set of genes for the right eye and one for the left eye, one set for the left leg and one for the right, etc, each one requiring exact measurements. Probably in inches.

By the way troll, as someone not from the US, I don't think less of Americans when they swear. I do however think less of them when they show a complete lack of understanding of biology. And in case you weren't sure, that last sentence is referring to you.

PvM · 24 October 2008

If that is true, and your description seems to match his previous attempts at describing his limited understanding of embryology then it is not surprising to find him confused about the amount of genetic information needed. I guess for a millipede, the amount of information to form all these extras legs must mean many more information? Of course we all know that this is an outdated and overly simplistic understanding of genetics. Oh well, I provided him with several opportunities to educate himself. Let's see if he can redeem himself. WOuld make for an interesting experiment.
Malcolm said: I get the impression that the troll thinks that there must be one set of genes for the right eye and one for the left eye, one set for the left leg and one for the right, etc, each one requiring exact measurements. Probably in inches. By the way troll, as someone not from the US, I don't think less of Americans when they swear. I do however think less of them when they show a complete lack of understanding of biology. And in case you weren't sure, that last sentence is referring to you.

Malcolm · 24 October 2008

cobby said: ... Ok read most of the article. So where does it say how the shape of the wings are formed. I think you jokers just googled words like morphology. This article is not on how the shape of wings are formed. It is on the shapes affected. Big difference. Nice bluff try again.
In other words, "Your article doesn't answer my objections, which are entirely based on the fact that I don't understand anything about this subject, and merely contains the stuff that shows why I'm wrong. Big difference."

Henry J · 25 October 2008

Maybe if somebody were to explain that chemical gradient thing in smaller words? Would that help?

Henry

Wayne Francis · 25 October 2008

Malcolm said: I get the impression that the troll thinks that there must be one set of genes for the right eye and one for the left eye, one set for the left leg and one for the right, etc, each one requiring exact measurements. Probably in inches. By the way troll, as someone not from the US, I don't think less of Americans when they swear. I do however think less of them when they show a complete lack of understanding of biology. And in case you weren't sure, that last sentence is referring to you.
Blow Jobby knows I live in Australia. But with his pea brain he can't seem to grasp that I talk to many people from around the world here and I'm always interested to hear their views on Americans. As patriotic as I am I always joke that I can always claim to be from Canada. The number one remark about Americans is how stupid and ignorant Americans are and how that is the worst mix with the arrogance that the rest of the world sees. Hand Jobby is prime example of that. Stupid, ignorant and arrogant.

Dave Luckett · 25 October 2008

Malcolm said: I get the impression that the troll thinks
Well, there's your problem right there.

Wayne Francis · 25 October 2008

Henry J said: Maybe if somebody were to explain that chemical gradient thing in smaller words? Would that help? Henry
I was thinking of making a web page with pretty pictures but remembered that about 1,000+ post ago I gave him a link to a video from the HHMI that explained this stuff and he ignored that. Honestly I don't think you can talk in small enough words to have blow jobby understand. I know from my years as a trainer that different people respond to different teaching techniques and often saying something in different ways will normally have the person's brain click and they'll grasp the concept. Blow Jobby hasn't grasped a single concept ever it seems.

cobby · 25 October 2008

Wayne Francis said:
Stanton said:
SWT said: I find it particularly amusing that you actually quoted the link you later requested; that strikes me as particularly inept, but completely in line with the hypothesis that you care only about argument, not about content.
Cobby/bobby/jobby/jacob/balanced/hamstrung/goff doesn't even care about argument: all he cares about is aggravating people with his malicious stupidity.
Thing is he doesn't really aggravate me. I have a fun time showing him to be the village idiot gone wild. Kind of like going out to a club and standing next to ugly people. They make you look better looking just by standing next to them.
... what an embarrasing attempt to backpedal and camoflage your misstatement. .... study much harder: http://answers.yahoo.com/question/index?qid=1006052638603

cobby · 25 October 2008

Henry J said: Maybe if somebody were to explain that chemical gradient thing in smaller words? Would that help? Henry
... sorry chemical gradients are only marginally useful in morphogenesis. read more carefully!

cobby · 25 October 2008

Malcolm said: I get the impression that the troll thinks that there must be one set of genes for the right eye and one for the left eye, one set for the left leg and one for the right, etc, each one requiring exact measurements. Probably in inches. By the way troll, as someone not from the US, I don't think less of Americans when they swear. I do however think less of them when they show a complete lack of understanding of biology. And in case you weren't sure, that last sentence is referring to you.
... of course I realize that hox genes can be used in different areas and even used in different species. ... nice try at obfuscation but sorry charlie: you lose again.

cobby · 25 October 2008

... OK morons. I think we have too really, really dumb this down for you to understand.

... lets start with an easy question:

.... Can human tissue be grown outside of the human body? in vitro?

cobby · 25 October 2008

... I just wonder what motivates this posters to spend so much time on getting so angry and so vulgar. And then trying to portray themselves as educated people. Don't they have real lives? Family? Friends? Jobs? Hobbies? Let's see now they react to this.

Science Avenger · 25 October 2008

cobby said: ... I just wonder what motivates this posters to spend so much time on getting so angry and so vulgar. And then trying to portray themselves as educated people. Don't they have real lives? Family? Friends? Jobs? Hobbies? Let's see now they react to this.
This from the hypocrite who has made more pointless posts on this thread than anyone else by an order of magnitude. But then, we all knew poor handjobby can't seem to get much attention from anyone in the real world, which is why he has to come here to get it. Come on you poor loser, let's see if you can get the thread up to 60 pages of your worthless drivel.

DS · 25 October 2008

Well who cares what corn cobby the corn holer doesn't understand? Everyone else already knows how development works. If anyone is really interested, here is a short list of examples of how hox genes affect wing shape in arthropods and morphology in other animals:
Nature 376:420-423 (1995)
Nature 388:682-686 (1997)
Nature 415:914-917 (2002)
Current Bio. 12:R291-R293 (2002)
American Scientist 85(2):1-10 (1997)

Of course bobby booby/hand jobby/corn cobby is expressly forbidden from reading these papers. Oh well, it's probably too buzy doing it's jumping monkey routine anyway.

rog · 25 October 2008

I feel sorry for Cobby...Jacob. He has passive-aggressive disorder and should get some professional help.

Passive-aggressive behavior traits: Ambiguity, Avoiding responsibility by claiming forgetfulness, Blaming others, Chronic lateness and forgetfulness, Complaining, Does not express hostility or anger openly (e.g., expresses it instead by leaving notes), Fear of authority, Fear of competition, Fear of dependency, Fear of intimacy (infidelity as a means to act out anger): The passive aggressive often can't trust. Because of this, they guard themselves against becoming intimately attached to someone., Fosters chaos, Intentional inefficiency, Making excuses, Losing things, Lying, Obstructionism, Procrastination, Resentment, Resists suggestions from others, Sarcasm, Stubbornness, Sullenness, Willful withholding of understanding

The last trait is especially diagnostic.

I suspect that communication with him will continue to be fruitless until he gets the help he needs.

cobby · 25 October 2008

Science Avenger said:
cobby said: ... I just wonder what motivates this posters to spend so much time on getting so angry and so vulgar. And then trying to portray themselves as educated people. Don't they have real lives? Family? Friends? Jobs? Hobbies? Let's see now they react to this.
This from the hypocrite who has made more pointless posts on this thread than anyone else by an order of magnitude. But then, we all knew poor handjobby can't seem to get much attention from anyone in the real world, which is why he has to come here to get it. Come on you poor loser, let's see if you can get the thread up to 60 pages of your worthless drivel.
... so illogical. its the morons here that have filled up 90% of those pages with their gibberish

cobby · 25 October 2008

rog said: I feel sorry for Cobby...Jacob. He has passive-aggressive disorder and should get some professional help. Passive-aggressive behavior traits: Ambiguity, Avoiding responsibility by claiming forgetfulness, Blaming others, Chronic lateness and forgetfulness, Complaining, Does not express hostility or anger openly (e.g., expresses it instead by leaving notes), Fear of authority, Fear of competition, Fear of dependency, Fear of intimacy (infidelity as a means to act out anger): The passive aggressive often can't trust. Because of this, they guard themselves against becoming intimately attached to someone., Fosters chaos, Intentional inefficiency, Making excuses, Losing things, Lying, Obstructionism, Procrastination, Resentment, Resists suggestions from others, Sarcasm, Stubbornness, Sullenness, Willful withholding of understanding The last trait is especially diagnostic. I suspect that communication with him will continue to be fruitless until he gets the help he needs.
... why do waste time like this? dont you have anything contructive to do?

cobby · 25 October 2008

DS said: Well who cares what corn cobby the corn holer doesn't understand? Everyone else already knows how development works. If anyone is really interested, here is a short list of examples of how hox genes affect wing shape in arthropods and morphology in other animals: Nature 376:420-423 (1995) Nature 388:682-686 (1997) Nature 415:914-917 (2002) Current Bio. 12:R291-R293 (2002) American Scientist 85(2):1-10 (1997) Of course bobby booby/hand jobby/corn cobby is expressly forbidden from reading these papers. Oh well, it's probably too buzy doing it's jumping monkey routine anyway.
.... of course hox genes INITIATE wing development but they do not determine the shape. read one of those articles and lets discuss it.

cobby · 25 October 2008

............ interesting how the morons avoided the question here: are they really that dumb?

… OK morons. I think we have too really, really dumb this down for you to understand.

… lets start with an easy question:

.… Can human tissue be grown outside of the human body? in vitro?

DS · 25 October 2008

Rog,

I agree with your assessment. However, you forgot fixation on sexual perversity and obsession with foul language (even though it has used exactly the same language). Oh well, maybe that is just a smoke screen to hide the fact that it doesn't know anything and doesn't want to learn anything either.

Well now it knows how wing development is "initiated" by cascades of gene expression that create morphogenic gradients and how wing development is "affected" by alteration of gene expression that alters those gradients. The only thing left for it to discover is how wing shape is "determined". Now how could that possibly be accomplished? I know, maybe those pesky photons are responsible. Maybe it should do an experiment and try to raise fruit flies in the dark.

Wayne Francis · 25 October 2008

cobby said:
Wayne Francis said:
Stanton said:
SWT said: I find it particularly amusing that you actually quoted the link you later requested; that strikes me as particularly inept, but completely in line with the hypothesis that you care only about argument, not about content.
Cobby/bobby/jobby/jacob/balanced/hamstrung/goff doesn't even care about argument: all he cares about is aggravating people with his malicious stupidity.
Thing is he doesn't really aggravate me. I have a fun time showing him to be the village idiot gone wild. Kind of like going out to a club and standing next to ugly people. They make you look better looking just by standing next to them.
... what an embarrasing attempt to backpedal and camoflage your misstatement. .... study much harder: http://answers.yahoo.com/question/index?qid=1006052638603
please quote where I said ANYTHING that that disagrees with that article Blow Jobby! In fact you are the one that argues against that article.
http://answers.yahoo.com/question/index?qid=1006052638603 ... It is our genes, made of DNA, that determine how we grow and develop. ...
What I said is unless you define what you mean by growing the question is meaningless and even then there isn't "an age". Tell me blow jobby, do you get hair cuts? Do you cut your finger and toe nails? Can people get larger muscles, to include muscles like the heart? Can people's brains grow even over the age of 20? The answer to all of these questions, beside your brain not growing, is yes. So once again you spout shit and the link that you provide refutes your position not mine you worthless piece of shit troll. What is embarrassing, with 2 "s"s is the fact that not only do you post links saying that they refute what other people have said without actually any proof, ie a quote from that person. But the link you provide clearly refutes your own claims. That and you can't spell for shit. So I'd say you need to study harder. Actually you just need to read what you post before you post it.

Wayne Francis · 25 October 2008

cobby said:
Henry J said: Maybe if somebody were to explain that chemical gradient thing in smaller words? Would that help? Henry
... sorry chemical gradients are only marginally useful in morphogenesis. read more carefully!
Marginally? Chemical gradients are a huge key when genes turn on and off. That is like saying "Flour is only marginally useful for making bread". You really can not be this stupid can you?

Wayne Francis · 25 October 2008

cobby said:
Malcolm said: I get the impression that the troll thinks that there must be one set of genes for the right eye and one for the left eye, one set for the left leg and one for the right, etc, each one requiring exact measurements. Probably in inches. By the way troll, as someone not from the US, I don't think less of Americans when they swear. I do however think less of them when they show a complete lack of understanding of biology. And in case you weren't sure, that last sentence is referring to you.
... of course I realize that hox genes can be used in different areas and even used in different species. ... nice try at obfuscation but sorry charlie: you lose again.
don't throw around a term and think we will be impressed blow Jobby, the HOX gene is just one piece of the pie. Play with SHH and see how any vertebrate will turn out. This is what we are saying. The basic toolkit for most life isn't all that different. It is all in how the different species mixes and matches these genes that is more important.

Wayne Francis · 25 October 2008

cobby said: ... OK morons. I think we have too really, really dumb this down for you to understand. ... lets start with an easy question: .... Can human tissue be grown outside of the human body? in vitro?
Yes, we do this all the time these days. Don't see where you are going with this at this point though. Now there is a big difference from growing something like "heart tissue" and growing an actual heart.

Wayne Francis · 25 October 2008

cobby said: ... I just wonder what motivates this posters to spend so much time on getting so angry and so vulgar. And then trying to portray themselves as educated people. Don't they have real lives? Family? Friends? Jobs? Hobbies? Let's see now they react to this.
Like I said I'm not angry. I quite enjoy showing you as the shit for brains idiot that you are. I swear when I refer to you so that all the lurkers are clear that I have absolutely no respect for you. Yes I have a life. Just got back from a mates place where about 24 of us played Texas Hold Em. $25 buy in. I came in 2nd. Was a fun night. Won $180. Would have been a fun night if I won $0. Tonight, as it is 3am, I'm going to see Max Payne with my friend Christine. Out every night and I still have plenty of time to show you for the useless willfully ignorant lying shit for brain troll that you are. Oh and learning about things like biology, physics, etc is one of my hobbies. I also like roller blading, dancing, cooking and many other activities.

DS · 25 October 2008

Wayne,

What did you expect for someone who claimed that proteins were only "bricks"? Man this ignorant SOB will really go into another jumping monkey fit if it ever figures out that most of the chemical gradients are protein gradients. Obviously it doesn't know the first thing about biology or development, just as obviously it never will.

Maybe PvM will start another uncontaminated thread where people who are really interested in learning can discuss Drosophila wing development. There we could examine the molecular mechanisms whereby morphogenic fields are established and how they control cell differentiation and cell division. Maybe then someone could explain how anyone could ever get the idea that those mechanisms could not be responsibe for determining wing shape. Or maybe not, after all, everyone else already seems to understand the basics of developmental genetics.

Wayne Francis · 25 October 2008

cobby said:
Science Avenger said:
cobby said: ... I just wonder what motivates this posters to spend so much time on getting so angry and so vulgar. And then trying to portray themselves as educated people. Don't they have real lives? Family? Friends? Jobs? Hobbies? Let's see now they react to this.
This from the hypocrite who has made more pointless posts on this thread than anyone else by an order of magnitude. But then, we all knew poor handjobby can't seem to get much attention from anyone in the real world, which is why he has to come here to get it. Come on you poor loser, let's see if you can get the thread up to 60 pages of your worthless drivel.
... so illogical. its the morons here that have filled up 90% of those pages with their gibberish
Just because you can't understand something does not make it gibberish. Did you think the same thing about all those text books in high school, all filled with gibberish?

Wayne Francis · 25 October 2008

cobby said:
rog said: I feel sorry for Cobby...Jacob. He has passive-aggressive disorder and should get some professional help. Passive-aggressive behavior traits: Ambiguity, Avoiding responsibility by claiming forgetfulness, Blaming others, Chronic lateness and forgetfulness, Complaining, Does not express hostility or anger openly (e.g., expresses it instead by leaving notes), Fear of authority, Fear of competition, Fear of dependency, Fear of intimacy (infidelity as a means to act out anger): The passive aggressive often can't trust. Because of this, they guard themselves against becoming intimately attached to someone., Fosters chaos, Intentional inefficiency, Making excuses, Losing things, Lying, Obstructionism, Procrastination, Resentment, Resists suggestions from others, Sarcasm, Stubbornness, Sullenness, Willful withholding of understanding The last trait is especially diagnostic. I suspect that communication with him will continue to be fruitless until he gets the help he needs.
... why do waste time like this? dont you have anything contructive to do?
Blow Jobby, I've told you this tons of times before. We do this because it clearly demonstrates to lurkers we don't cave you people that spout shit like you. That and it makes all of us look extremely smart when compared to you. If any of us actually thought we could teach you something and that was the reason we do this, then that would be a waste of time.

Wayne Francis · 25 October 2008

DS said: Wayne, What did you expect for someone who claimed that proteins were only "bricks"? Man this ignorant SOB will really go into another jumping monkey fit if it ever figures out that most of the chemical gradients are protein gradients. Obviously it doesn't know the first thing about biology or development, just as obviously it never will. Maybe PvM will start another uncontaminated thread where people who are really interested in learning can discuss Drosophila wing development. There we could examine the molecular mechanisms whereby morphogenic fields are established and how they control cell differentiation and cell division. Maybe then someone could explain how anyone could ever get the idea that those mechanisms could not be responsibe for determining wing shape. Or maybe not, after all, everyone else already seems to understand the basics of developmental genetics.
I don't expect anything from Blow Jobby but the normal shit he spouts out. I do have fun pointing out how stupid he is at every opportunity. If he read the papers about wing development then he'd find a handful of other genes that are also responsible for wing shape. But I gave up on him learning/reading anything about 1600 posts ago.

PvM · 25 October 2008

cobby said:
Science Avenger said: This from the hypocrite who has made more pointless posts on this thread than anyone else by an order of magnitude. But then, we all knew poor handjobby can't seem to get much attention from anyone in the real world, which is why he has to come here to get it. Come on you poor loser, let's see if you can get the thread up to 60 pages of your worthless drivel.
... so illogical. its the morons here that have filled up 90% of those pages with their gibberish
Is that not what he implied :-) Still avoiding dealing with science I notice. What a surprise...

PvM · 25 October 2008

Good idea. Bobby can continue to hide in the shadows of ignorance. I think you are correct, Bobby knows nothing about biology or development and worse is unwilling to learn. Nevertheless, Bobby serves as a good example of how ignorance, which is so commonly found amongst ID proponents, fails to have any scientific content to contribute. Remember that any attempt of Bobby to educate himself, would reduce his ignorance and thus undermine his claims.
DS said: Wayne, What did you expect for someone who claimed that proteins were only "bricks"? Man this ignorant SOB will really go into another jumping monkey fit if it ever figures out that most of the chemical gradients are protein gradients. Obviously it doesn't know the first thing about biology or development, just as obviously it never will. Maybe PvM will start another uncontaminated thread where people who are really interested in learning can discuss Drosophila wing development. There we could examine the molecular mechanisms whereby morphogenic fields are established and how they control cell differentiation and cell division. Maybe then someone could explain how anyone could ever get the idea that those mechanisms could not be responsibe for determining wing shape. Or maybe not, after all, everyone else already seems to understand the basics of developmental genetics.

cobby · 25 October 2008

...Can human tissue be grown outside of the human body? in vitro?

no answers? not a hard question. try to follow the logic here, moron.

cobby · 25 October 2008

Marginally? Chemical gradients are a huge key when genes turn on and off. That is like saying “Flour is only marginally useful for making bread”. You really can not be this stupid can you?

... no read some studies. they dont know how the shape are formed. yes they know how certain cells are instructed to start and stop but the shape, sorry charlie: its a mystery. go ask someone in the field.

cobby · 25 October 2008

Tonight, as it is 3am, I’m going to see Max Payne with my friend Christine. Out every night and I still have plenty of time to show you for the useless willfully ignorant lying shit for brain troll that you are.

... sounds like you are an alcoholic. how many times a week do you drink and how much?

PvM · 25 October 2008

Seems Bobby could benefit from reading some of the studies. Ignorance should never be an excuse.
cobby said: Marginally? Chemical gradients are a huge key when genes turn on and off. That is like saying “Flour is only marginally useful for making bread”. You really can not be this stupid can you? ... no read some studies. they dont know how the shape are formed. yes they know how certain cells are instructed to start and stop but the shape, sorry charlie: its a mystery. go ask someone in the field.

PvM · 25 October 2008

Why is it that whenever Bobby's ignorance is exposed he resort to senseless insults. If he spent only a fraction on reducing his ignorance by reading the books in the library he frequents, there would be some hope. Such a resource and yet such ignorance.
cobby said: Tonight, as it is 3am, I’m going to see Max Payne with my friend Christine. Out every night and I still have plenty of time to show you for the useless willfully ignorant lying shit for brain troll that you are. ... sounds like you are an alcoholic. how many times a week do you drink and how much?

PvM · 25 October 2008

What logic? Has it occurred to you that you have not even presented an argument other than presented your state of ignorance.
cobby said: ...Can human tissue be grown outside of the human body? in vitro? no answers? not a hard question. try to follow the logic here, moron.

cobby · 25 October 2008

PvM said: Why is it that whenever Bobby's ignorance is exposed he resort to senseless insults. If he spent only a fraction on reducing his ignorance by reading the books in the library he frequents, there would be some hope. Such a resource and yet such ignorance.
cobby said: Tonight, as it is 3am, I’m going to see Max Payne with my friend Christine. Out every night and I still have plenty of time to show you for the useless willfully ignorant lying shit for brain troll that you are. ... sounds like you are an alcoholic. how many times a week do you drink and how much?
.... Have YOU read the studies???

PvM · 25 October 2008

Again Bobby shows his ignorance, chemical gradients are essential in morphogenesis. What an ignorant comment.
cobby said:
Henry J said: Maybe if somebody were to explain that chemical gradient thing in smaller words? Would that help? Henry
... sorry chemical gradients are only marginally useful in morphogenesis. read more carefully!

PvM · 25 October 2008

cobby said:
PvM said: Why is it that whenever Bobby's ignorance is exposed he resort to senseless insults. If he spent only a fraction on reducing his ignorance by reading the books in the library he frequents, there would be some hope. Such a resource and yet such ignorance.
cobby said: Tonight, as it is 3am, I’m going to see Max Payne with my friend Christine. Out every night and I still have plenty of time to show you for the useless willfully ignorant lying shit for brain troll that you are. ... sounds like you are an alcoholic. how many times a week do you drink and how much?
.... Have YOU read the studies???
Some of them. Of course anything I have presented to you has been consistently ignored by you. So tell us, why do you go around calling people alcoholics? WWJD Bobby? Or do you not know?

cobby · 25 October 2008

PvM said: Again Bobby shows his ignorance, chemical gradients are essential in morphogenesis. What an ignorant comment.
cobby said:
Henry J said: Maybe if somebody were to explain that chemical gradient thing in smaller words? Would that help? Henry
... sorry chemical gradients are only marginally useful in morphogenesis. read more carefully!
.... cite, quote, resource?? oh I forgot your FAITH is sufficient! .... anyhow you dont know whether human tissues can be grown in vitro?

PvM · 25 October 2008

So let's expose the fallacies some more. How much information is needed to specify the formation of an ice crystal?

As this diagram shows there are 4 generic depending on temperature and when taking saturation into consideration one has about 16 different basic shapes. In other words, the amount of information needed to specify the basic shape of a snow flake/ice crystal is about 4 bits. However, when a snowflake forms, the surrounding environment strongly affects the exact shape which is only under rare circumstances perfectly symmetric. So how much information is needed to describe one of the basic forms? And how much additional information is imparted by the laws of physics and the environment? I'd argue that the amount of information is far more than what is initially specified by the initial conditions. So where did this additional information come from? Simple really, from the laws of physics and the local conditions, the environment of the crystals.

This simple example shows how silly Bobby's claims are when realizing as people have so carefully attempted to explain to Bobby that the genetic information is sufficient to set in motion the morphogenesis while local conditions (epigenetics) determine the fate of the cells, and as we have seen in case of nematodes in a predictable fashion. We have also seen how the nematode vulva forms under the directions of genetic networks, local interactions.

So why is Bobby refusing to address these facts?

Mind boggling...

cobby · 25 October 2008

Some of them. Of course anything I have presented to you has been consistently ignored by you. So tell us, why do you go around calling people alcoholics?

... did call someone an alcoholic. how could i know if wayne is or not? he sounds like one tho

WWJD Bobby?

Or do you not know?

.... let discuss one the studies you allegedly have read

cobby · 25 October 2008

PvM said: So let's expose the fallacies some more. How much information is needed to specify the formation of an ice crystal? As this diagram shows there are 4 generic depending on temperature and when taking saturation into consideration one has about 16 different basic shapes. In other words, the amount of information needed to specify the basic shape of a snow flake/ice crystal is about 4 bits. However, when a snowflake forms, the surrounding environment strongly affects the exact shape which is only under rare circumstances perfectly symmetric. So how much information is needed to describe one of the basic forms? And how much additional information is imparted by the laws of physics and the environment? I'd argue that the amount of information is far more than what is initially specified by the initial conditions. So where did this additional information come from? Simple really, from the laws of physics and the local conditions, the environment of the crystals. This simple example shows how silly Bobby's claims are when realizing as people have so carefully attempted to explain to Bobby that the genetic information is sufficient to set in motion the morphogenesis while local conditions (epigenetics) determine the fate of the cells, and as we have seen in case of nematodes in a predictable fashion. We have also seen how the nematode vulva forms under the directions of genetic networks, local interactions. So why is Bobby refusing to address these facts? Mind boggling...
... wow that was dumb! a snow flake is much, much simple than even the most simplistic human or cell for that matter ... you have reached a new level of stupidity. give yourself a gold stupid star.

cobby · 25 October 2008

... latest most feared question:

... can human tissues grow in vitro?

PvM · 25 October 2008

cobby said: .... cite, quote, resource?? oh I forgot your FAITH is sufficient! .... anyhow you dont know whether human tissues can be grown in vitro?
On the contrary, my statements are supported by known facts of morphogenesis which show how bodyplans arise under the control of gradients. As to whether or not human tissues can be grown in vitro, I fail to see the relevance of this. Some people have submitted patents that claim that they can do so. It's called tissue engineering and seems most applicable to growing skin grafts for burn victims but other organs seem well within reach.

Engineering body parts -- tissues and whole organs that are genetically compatible and available on demand -- sounds like science fiction. But researchers at medical centers around the world are working to make it a reality. Already, a handful of children with spina bifida have received new bladders. Replacement blood vessels are being tested on dialysis patients. And researchers have re-created a beating rat heart.

You are in a library, how hard can it be to do some of this research yourselves rather than have others spoonfeed it to you, only for you to spit it out and pretend you were never provided with any answers?

PvM · 25 October 2008

I am pointing out that based on ignorance alone Bobby has chosen to call someone an alcoholic and I wonder why Bobby believes this is a valid 'argument'? Especially in line with WWJD? Why is Bobby so intent on making his faith look foolish? I presented you with several studies, perhaps Bobby wants to discuss the nematode, and perhaps he would like to address the work done its vulva? Doubt it though.
cobby said: Some of them. Of course anything I have presented to you has been consistently ignored by you. So tell us, why do you go around calling people alcoholics? ... did call someone an alcoholic. how could i know if wayne is or not? he sounds like one tho WWJD Bobby? Or do you not know? .... let discuss one the studies you allegedly have read

PvM · 25 October 2008

As expected, the argument is once again totally lost on Bobby and yet I have shown that the information in the crystal phenotype is higher than the information needed to get the crystal growing. In other words, the environment is imparting a lot of additional information onto the crystal. The same principles apply to embryogenesis. Mind boggling that Bobby cannot even address the arguments. But Bobby did make a positive claim which he, if history is repeating itself, will refuse to support: How much information is stored in a human cell? How much information is stored in a snow flake crystal? Lacking any concrete data, I have to reject Bobby's unsupported claims. Of course, Bobby will now pretend he never made these claims and continue to wallow in his ignorance. And I will be there to remind him of his failures. That's the least I can do for my confused Christian friend.
cobby said:
PvM said: So let's expose the fallacies some more. How much information is needed to specify the formation of an ice crystal? As this diagram shows there are 4 generic depending on temperature and when taking saturation into consideration one has about 16 different basic shapes. In other words, the amount of information needed to specify the basic shape of a snow flake/ice crystal is about 4 bits. However, when a snowflake forms, the surrounding environment strongly affects the exact shape which is only under rare circumstances perfectly symmetric. So how much information is needed to describe one of the basic forms? And how much additional information is imparted by the laws of physics and the environment? I'd argue that the amount of information is far more than what is initially specified by the initial conditions. So where did this additional information come from? Simple really, from the laws of physics and the local conditions, the environment of the crystals. This simple example shows how silly Bobby's claims are when realizing as people have so carefully attempted to explain to Bobby that the genetic information is sufficient to set in motion the morphogenesis while local conditions (epigenetics) determine the fate of the cells, and as we have seen in case of nematodes in a predictable fashion. We have also seen how the nematode vulva forms under the directions of genetic networks, local interactions. So why is Bobby refusing to address these facts? Mind boggling...
... wow that was dumb! a snow flake is much, much simple than even the most simplistic human or cell for that matter ... you have reached a new level of stupidity. give yourself a gold stupid star.

cobby · 25 October 2008

I presented you with several studies, perhaps Bobby wants to discuss the nematode, and perhaps he would like to address the work done its vulva?

... well tell us why that study supports your assertion.

.... i dont know if wayne is an alcoholic. i asked him. maybe he will respond.

... why are you not familiar with the growth of human tissue in vitro? just dumb??

cobby · 25 October 2008

The same principles apply to embryogenesis.

... no it doesnt. theres your FAITH getting in the way again!

cobby · 25 October 2008

But Bobby did make a positive claim

... and what claim is that??

cobby · 25 October 2008

... pvm, are you going on and on about this hoping you will redeem yourself from the stupid comments you have made?

... its too late you are just looking stupider trying to backpedal. you need to take some college courses and learn to sharpen your mind.

fnxtr · 25 October 2008

cobby said: ... latest most feared question: ... can human tissues grow in vitro?
Latest dodge, more like.

PvM · 25 October 2008

As I said, the work on the C Elegans nematode and its vulva formation. Why did you even feel the need to ask if Wayne is an alcoholic? Is it your ignorance speaking again? As to in vitro growing of tissues, I seem to know more than you, which of course could still make me dumb on the topic as I have no real competition. In the land of the blind, 'one eye' is king my dear confused Christian friend.
cobby said: I presented you with several studies, perhaps Bobby wants to discuss the nematode, and perhaps he would like to address the work done its vulva? ... well tell us why that study supports your assertion. .... i dont know if wayne is an alcoholic. i asked him. maybe he will respond. ... why are you not familiar with the growth of human tissue in vitro? just dumb??

fnxtr · 25 October 2008

let discuss one the studies you allegedly have read
Yobbo that joke isn't funny any more.

PvM · 25 October 2008

But it does, I have shown several examples of gradients, and other environmental factors guiding the development of the embryo showing how information is imparted by the environment on the formation of the embryo. That you ignore these facts is quite expected and telling as ignorance only begets more ignorance. Not only have you failed to address the claims but you also have failed to present your evidence and alternatives. That's ignorance for you in action, it ain't pretty but it can surely serve as a good example as to the scientific vacuity of Intelligent Design arguments which also are based largely on a state of ignorance. I thank you for your participation in exposing the foolishness.
cobby said: The same principles apply to embryogenesis. ... no it doesnt. theres your FAITH getting in the way again!

PvM · 25 October 2008

Even ignorant of his own claims even though I did quote them. Notice the inability of Bobby to deal with anything he says. What a foolishness.
cobby said: But Bobby did make a positive claim ... and what claim is that??

PvM · 25 October 2008

What you see as stupid is just you projecting your inability to address them. I understand why you taunt people, since they have just exposed, once again the depth and breadth of your ignorance, and the darkness exposed has never been pretty and yet there is a positive side to it that even when you refuse to educate yourself or be educated, others can still benefit from seeing what ignorance leads to. I thank you for participating as a volunteer in educating others and exposing the cost of ignorance.
cobby said: ... pvm, are you going on and on about this hoping you will redeem yourself from the stupid comments you have made? ... its too late you are just looking stupider trying to backpedal. you need to take some college courses and learn to sharpen your mind.

PvM · 25 October 2008

Note that I predict that Bobby will ignore the nematode and vulva issues and continue to pretend that no objections were raised to his ignorance.

Just watch the thread and enjoy

Stanton · 25 October 2008

cobby said: ... why are you not familiar with the growth of human tissue in vitro? just dumb??
The reason why he appears unfamiliar with human tissue growth in vitro is specifically because you ignored his response. And you are aware that it is possible to grow human cancer cells, as well as human skin cells, and even stem cells derived from human eggs and placenta tissue, right? http://en.wikipedia.org/wiki/HeLa http://en.wikipedia.org/wiki/Tissue_engineering

DS · 25 October 2008

So far the troll of many names has accused two total strangers of being an alcoholic and a pedophile. It has also complained about inappropriate language, even though it has used exactly the same language. It even complained and blamed others for it's own ignorance in response to a comment accusing it of complaining and blaming others!

It has refused to discuss even a single scientific reference for three weeks now. What could possibly be stopping it? It says it wants to discuss the papers but somehow never gets around to actually doing it. Maybe it reads the titles, but that appears to be all. It simply refuses to understand that until it proves that it has read the papers it will never know if anyone else has or not. I suppose that it can prove indefinately that it cannot understand science.

Thanks to everyone who has helped to keep it from contaminating other threads.

cobby · 25 October 2008

... pvm, are you going on and on about this hoping you will redeem yourself from the stupid comments you have made?

... its too late you are just looking stupider trying to backpedal. you need to take some college courses and learn to sharpen your mind.

cobby · 25 October 2008

...OK morons. one of you was able to wiki up the answer and you now know that some human tissues can be grown in vitro.

.... now next question: can human ORGANS be grown in vitro??

fnxtr · 25 October 2008

cobby said: ...OK morons. one of you was able to wiki up the answer and you now know that some human tissues can be grown in vitro. .... now next question: can human ORGANS be grown in vitro??
How is this relevant to the thread, Yobbo? Are you going to say "Yes? They can? AHA! Then it's not epigenetics resposible for development!" Or "No? They can't? Then there's something MAGIC inside my mom!" Either way you're full of shit.

cobby · 25 October 2008

fnxtr said:
cobby said: ...OK morons. one of you was able to wiki up the answer and you now know that some human tissues can be grown in vitro. .... now next question: can human ORGANS be grown in vitro??
How is this relevant to the thread, Yobbo? Are you going to say "Yes? They can? AHA! Then it's not epigenetics resposible for development!" Or "No? They can't? Then there's something MAGIC inside my mom!" Either way you're full of shit.
... translation: I dont know.

iml8 · 25 October 2008

Dropping back in for the moment to see what the folks in
the back room are up to with their Punching Bag ...
... ah, ya'll are up to 59 pages!

I like this. The PB is no longer amusing himself, he's
just trapped to go along with the game indefinitely
in hopes he'll have the last word. But there's more of
you than there are of him, so he can't win,
all he can do is run like the hamster on the wheel
forever. "Run, hamster, run!"

White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

cobby · 25 October 2008

iml8 said: Dropping back in for the moment to see what the folks in the back room are up to with their Punching Bag ... ... ah, ya'll are up to 59 pages! I like this. The PB is no longer amusing himself, he's just trapped to go along with the game indefinitely in hopes he'll have the last word. But there's more of you than there are of him, so he can't win, all he can do is run like the hamster on the wheel forever. "Run, hamster, run!" White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html
... actually it seem like i can get 8 hamsters to run with a click of my fingers. watch! .... still no answers on studies showing NS can evolve a complex structure. < click >

PvM · 25 October 2008

Cobby wrote; .… still no answers on studies showing NS can evolve a complex structure.

Liar. And I do not take that word lightly. And why are you once again shifting the goalposts?

By avoidance you have shown once again that you are no match for knowledge, in fact you have shown that you actively avoid knowledge.

WWJD Bobby?

cobby · 25 October 2008

PvM said: Cobby wrote; .… still no answers on studies showing NS can evolve a complex structure. Liar. And I do not take that word lightly. And why are you once again shifting the goalposts? By avoidance you have shown once again that you are no match for knowledge, in fact you have shown that you actively avoid knowledge. WWJD Bobby?
... IML8, see how easy it is to get the hamsters running. just a *click* of my fingers. ... ok one is running can i get 2? .... 750 megs is not enough info to construct a human *click*

PvM · 25 October 2008

cobby said: ...OK morons. one of you was able to wiki up the answer and you now know that some human tissues can be grown in vitro. .... now next question: can human ORGANS be grown in vitro??
These questions were already answered. You troll...

PvM · 25 October 2008

Ah, I love to be so right. But then again, ignorance is predictable, and Bobby is no different.
PvM said: Note that I predict that Bobby will ignore the nematode and vulva issues and continue to pretend that no objections were raised to his ignorance. Just watch the thread and enjoy

PvM · 25 October 2008

cobby said: ... IML8, see how easy it is to get the hamsters running. just a *click* of my fingers. ... ok one is running can i get 2? .... 750 megs is not enough info to construct a human *click*
Again Bobby exemplifies to what level his arguments and behavior and language have to drop. What a foolish exposition of scientific vacuity and what a poor representative for Bobby's faith. WWJD Bobby?

PvM · 25 October 2008

Remember that Bobby was presented sufficient evidence to undermine his claims, that Bobby has been unable to address this evidence nor has he been able to support his ignorance. Only through willful ignorance can Bobby avoid dealing with such issues as information content, embryology of the nematode and the nematode vulva.

In these days of ignorance, both scientific and political, it is good to have such excellent representatives who are willing to share the depth and breadth of their ignorance with all of us, helping many a uncommitted reader to make up their minds.

Ignorance does serve its purpose and Bobby should be thanked for his contributions. But at what a cost...

PvM · 25 October 2008

The snowflake is an exciting example however we find out more when we dig deeper

My favorite example, of course, is the snowflake - the poster child of morphogenesis. Snowflakes often have exceedingly complex shapes and the patterning appears spontaneously as snow crystals growth.

This kind of positive feedback produces what is called a branching instability even the tiniest protruding points will grow faster than its surroundings and thus protrude even more. Small corners grow into branched; random bumps on the branches grow into side branches. Complexity is born

Kenneth George Libbrecht, Patricia Rasmussen The Snowflake: Winter's Secret Beauty Voyageur Press, 2003 Must be tough to be so wrong all the time eh Bobby?

cobby · 25 October 2008

PvM said:
cobby said: ... IML8, see how easy it is to get the hamsters running. just a *click* of my fingers. ... ok one is running can i get 2? .... 750 megs is not enough info to construct a human *click*
Again Bobby exemplifies to what level his arguments and behavior and language have to drop. What a foolish exposition of scientific vacuity and what a poor representative for Bobby's faith. WWJD Bobby?
.... my hamster Pvm just cant stop. lets try again! .... small changes do not necessarily extrapolate into large changes: the tragic flaw in Darwinism

cobby · 25 October 2008

... oops I forgot to click my fingers *click*

PvM · 25 October 2008

I was wrong about 16 categories in fact Nakaya categorized 41 different snowflake categories. In addition, Bobby may want to familiarize himself with Lindenmayer. Science has so much to offer to Bobby and yet he keeps ignoring it.

PvM · 25 October 2008

A great example of how models of morphogenesis, based on biological processes can recover the embryological development of limbs is explored in Trevor M. Cickovski , Chengbang Huang, Rajiv Chaturvedi , Til mann Glimm, H. George E. Hentschel , Mark S. Alber, James A. Glazier, Stuart A. Newman, and Jesus A. Izaguirre A Framework for Three-Dimensional Simulation of Morphogenesis IEEE/ACM TRANSACTIONS ON COMPUTATIONAL BIOLOGY AND BIOINFORMATICS, VOL. 2, NO. 4, OCTOBER-DECEMBER 2005

Abstract—We present COMPUCELL3D, a software framework for three-dimensional simulation of morphogenesis in different organisms. COMPUCELL3D employs biologically relevant models for cell clustering, growth, and interaction with chemical fields. COMPUCELL3D uses design patterns for speed, efficient memory management, extensibility, and flexibility to allow an almost unlimited variety of simulations. We have verified COMPUCELL3D by building a model of growth and skeletal pattern formation in the avian (chicken) limb bud.

and P. HOGEWEG Evolving Mechanisms of Morphogenesis: on the Interplay between Di4erential Adhesion and Cell Differentiation J. theor. Biol. (2000) 203, 317-333

Differential cell adhesion, mediated by e.g. integrin and cadherins/catenines, plays an important role in morphogenesis and it has been shown that there is intimate cross-talk between their expression and modification, and inter-cellular signalling, cell differentiation, cell growth and apoptosis. In this paper, we introduce and use a formal model to explore the morphogenetic potential of the interplay between these processes. We demonstrate the formation of interesting morphologies. Initiated by cell differentiation, differential cell adhesion leads to a long transient of cell migrations, e.g. engulfing and intercalation of cells and cell layers. This transient can be sustained dynamically by further cell differentiation, and by cell growth/division and cell death which are triggered by the (also long range) forces (stretching and squeezing) generated by the cell adhesion. We study the interrelation between modes of cell differentiation and modes of morphogenesis. We use an evolutionary process to zoom in on gene-regulation networks which lead to cell differentiation. Morphogenesis is not selected for but appears as a side-effect. The evolutionary dynamics shows the hallmarks of evolution on a rugged landscape, including long neutral paths. We show that a combinatorially large set of morphologies occurs in the vicinity of a neutral path which sustains cell differentiation. Thus, an almost linear molecular phylogeny gives rise to mosaic evolution on the morphological level.

PvM · 25 October 2008

More recent research Metzger RJ, Klein OD, Martin GR, Krasnow MA. The branching programme of mouse lung development. Nature. 2008 Jun 5;453(7196):745-50. Epub 2008 May 7.

Mammalian lungs are branched networks containing thousands to millions of airways arrayed in intricate patterns that are crucial for respiration. How such trees are generated during development, and how the developmental patterning information is encoded, have long fascinated biologists and mathematicians. However, models have been limited by a lack of information on the normal sequence and pattern of branching events. Here we present the complete three-dimensional branching pattern and lineage of the mouse bronchial tree, reconstructed from an analysis of hundreds of developmental intermediates. The branching process is remarkably stereotyped and elegant: the tree is generated by three geometrically simple local modes of branching used in three different orders throughout the lung. We propose that each mode of branching is controlled by a genetically encoded subroutine, a series of local patterning and morphogenesis operations, which are themselves controlled by a more global master routine. We show that this hierarchical and modular programme is genetically tractable, and it is ideally suited to encoding and evolving the complex networks of the lung and other branched organs.

cobby · 25 October 2008

.. wow so you found a couple of abstract by googling keywords like morphogenesis etc.

... well the first is a simulation and the second still does not show how the shapes were formed.

... did you really understand these studies? can you read them. paraphrase what they say. all you have ever done is cut and paste.

.... you really ought to take some courses in research. you are sounding stupider by the post.

cobby · 25 October 2008

"""How such trees are generated during development, and how the developmental patterning information is encoded, have long fascinated biologists and mathematicians."""

... translation: 'we have no idea how this is done'

"""We propose that each mode of branching is controlled by a genetically encoded subroutine, a series of local patterning and morphogenesis operations, which are themselves controlled by a more global master routine."""

translation: ' here is our guess'

... do you even read these abstracts??

PvM · 25 October 2008

Well, we have a first step, Bobby has acknowledged the existence of research but claims that they do not explain how the shapes are formed even though the articles are quite clear about the various processes involved. Like the branching processes found in the morphogenesis of snow flakes, branching patterns are one of the aspects of morphogenesis in biology as well. For instance with lungs and kidneys, science has come to understand how a variety of factors influence the shape formation of organs. These include, but are not limited to differential cell adhesion, physical constraints, and even the process of cell death (apoptosis). Such as in Evolving Mechanisms of Morphogenesis: on the Interplay between Differential Adhesion and Cell Di4erentiation

Thus, we see that the explosion of morphologies arise as a result of different combinations of cell migration and cell growth properties. Notwithstanding the progressive change at the genomic and the network level, we see a reoccurrence of similar morphogenetic mechanisms at different moments in evolution.

In other words, contrary to what Bobby claims, real scientists do understand how shapes arise in biology. All this work, including the modeling are based on such topics as diffusion, branching and other relevant process and these simulations are very able to recapture the actually observed processes, showing that indeed, the combination of genes and epigenetic effects are able to explain how shapes arise. Not that Bobby has any better explanation but worse, Bobby has to foolishly deny the existence of research in these areas.
cobby said: .. wow so you found a couple of abstract by googling keywords like morphogenesis etc. ... well the first is a simulation and the second still does not show how the shapes were formed.

PvM · 25 October 2008

Of course, and the actual papers as well. That your best and only response is to quote mine the abstracts is once again quite telling. That you in the process continue to further expose your ignorance of the scientific process is an unexpected bonus. Keep up the good job jobby.
cobby said: """How such trees are generated during development, and how the developmental patterning information is encoded, have long fascinated biologists and mathematicians.""" ... translation: 'we have no idea how this is done' """We propose that each mode of branching is controlled by a genetically encoded subroutine, a series of local patterning and morphogenesis operations, which are themselves controlled by a more global master routine.""" translation: ' here is our guess' ... do you even read these abstracts??

PvM · 25 October 2008

As I explained, the morphogenesis of the lung has been quite extensively studied and as early as 2002, researcher reported

It has been known for decades that branching morphogenesis of the lung is mediated through reciprocal interactions between the epithelium and its underlying mesenchyme. In recent years, several key players, in particular members of the major signaling pathways that mediate this interaction, have been identified. Here, we review the genetic and molecular studies of these key components, which have provided a conceptual framework for understanding the interactions of these major signaling pathways in branching morphogenesis. The future challenge is to translate understanding of the signaling cascade into knowledge of the cellular responses, including cell proliferation, migration and differentiation, that lead to the stereotyped branching.

The authors point out that

In recent years, significant progress has been made in understanding the genetic and molecular control of lung branching. Several key players that mediate epithelial – mesenchymal interactions have been identified [3,4], including members of the Hedgehog (Hh), Fibroblast growth factor (Fgf), Wingless (Wnt) and Transforming growth factor-b (TGF-b) signaling pathways (Table 1).

Based on this work, the researchers have increase our understanding of the genes responsible for the lung development although the exact interaction leading to branched structures has yet to be formulated. Until recently where models have allowed scientists to make experimental predictions.

Vertebrate lung has tree-like structure which facilitates gas exchange. After discovery of the involvement of several key toolkit genes--FGF10, BMP4, and Shh, huge amount of molecular information on lung development is now available. However, how their interactions result in a branched structure has not been elucidated. Recently, some studies have utilized mathematical models to understand the mechanism of branching morphogenesis, and we now have some models which are reliable enough to make experimental predictions in the in vitro system. In addition, a different type of modeling, which generates tree-like branching pattern by repeatedly applying a set of simple rules iteratively, is also utilized to model lung function. In this review, I focus on how these models can contribute to understand pattern formation phenomena from experimental biologist's point of view.

Miura T. Modeling lung branching morphogenesis. Curr Top Dev Biol. 2008;81:291-310. There is a fascinating amount of research linking genes to the morphogenesis of these complex organs.

PvM · 25 October 2008

Our friend PZ Myers has an oldie on morphogenesis Chance and regularity in the development of the fly eye

Another fascinating aspect of development is that all the intricate, precise steps are carried out without agency: everything is explained and explainable in terms of local, autonomous interactions. Genes are switched on in response to activation by proteins not conscious action, domains of expression are refined without an interfering hand nudging them along towards a defined goal. It's teleonomy, not teleology. We see gorgeously regular structures like the insect compound eye to the right arise out of a smear of cells, and there is no magic involved—it's wonderfully empowering. We don't throw up our hands and declare a miracle, but instead science gives us the tools to look deeper and work out (with much effort, admittedly) how seeming miracles occur

And then continues to outline the morphogenesis of the compound insect eye.

cobby · 25 October 2008

dummuy, that is not quote mining that is QUOTING. do you know there is a difference?

.. you really dont understand any of this do you??

"However, how their interactions result in a branched structure has not been elucidated."

... how many times do they have to say they dont know till you believe they dont know?

cobby · 25 October 2008

"" We don’t throw up our hands and declare a miracle, but instead science gives us the tools to look deeper and work out (with much effort, admittedly) how seeming miracles occur ""

... again translation: ' we dont know how this works '

cobby · 25 October 2008

conceptual framework for understanding the interactions of these major signaling pathways in branching morphogenesis.**** future challenge is to translate understanding of the signaling cascade into knowledge of the cellular responses, including cell proliferation, migration and differentiation, that lead to the stereotyped branching. ****

...THEY DONT KNOW!!

PvM · 25 October 2008

Again Bobby is failing to comprehend.
cobby said: "" We don’t throw up our hands and declare a miracle, but instead science gives us the tools to look deeper and work out (with much effort, admittedly) how seeming miracles occur "" ... again translation: ' we dont know how this works '

PvM · 25 October 2008

They do not know everything but that is hardly evidence for your position. Sure science does not have the answers to all the questions. Although with nematode and the vulva, a topic you seem to wisely avoid, science has indeed been able to track the development of cells in much detail, including the genetic networks involved. The branching patterning in lungs and other organs however is very similar to processes found in snowflakes, even though we may lack a full understanding of every single detail, research has shown how genetic processes, and other relevant local processes guide the formation of these organs. That models based on such processes continue to accurately track the known data is further evidence. Of course, Bobby can always claim that science never has sufficient evidence to satisfy his requirements but that hardly means that science does not know either, in fact, science knows quite a lot, something Bobby seems to be not very eager to admit or even explore. And thus a position of ignorance, such as Bobby's, needs to be compared to how science is progressing to unravel the 'mysteries' without the need for any magic.
cobby said: conceptual framework for understanding the interactions of these major signaling pathways in branching morphogenesis.**** future challenge is to translate understanding of the signaling cascade into knowledge of the cellular responses, including cell proliferation, migration and differentiation, that lead to the stereotyped branching. **** ...THEY DONT KNOW!!

PvM · 25 October 2008

As predicted, Bobby is quick to reject anything, even before having read the paper, just because his quote mining of the abstract causes him to believe that the authors have done nothing to remove some of the remaining areas of ignorance. It's sad to hear that even when evidence undermining Bobby's position is presented, Bobby, as many have predicted, remains unable and unwilling to address the research in any depth.

That my friends is what ignorance begets, just more ignorance. And the impact of such a foolish position is quite self evident.

PvM · 25 October 2008

So far the following 'assertions' by Bobby have not only shown to be without much merit, Bobby also has remained unable to provide any supporting evidence and research

1. The genome does not contain sufficient information
2. No instances of natural selection have been observed
3. No instances of natural selection leading to complex systems have been observed
4. Chemical gradients are only marginally useful in morphogenesis

There are a variety of lesser variants of statements by Bobby which underline his lack of familiarity with evolutionary and biological science. However, these seem to be recurring themes. Typically when cornered with facts, Bobby will chose another claim or revisits an earlier claim even though it had been shown to be lacking in evidence, logic and reason.

Fascinating behavior.

PvM · 25 October 2008

As to gradients and morphogenesis, Bobby should read the Max Planck article by Christiane Nüsslein-Volhard

Gradients That Organize Embryo Development: A few crucial molecular signals give rise to chemical gradients that organize the developing embryo

Anyone familiar with embryology knows the importance of gradients and morphogenesis.

Wayne Francis · 25 October 2008

cobby said: ...Can human tissue be grown outside of the human body? in vitro? no answers? not a hard question. try to follow the logic here, moron.
I answered you in post http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170992 Try to follow the logic? This question of yours is coming from left field. Without a bit more explanation of where you going there is little apparent "logic" to your question. Oh yes this is where you think "Arbitrary" and "Logical" are compatible. A decision or question might look "Arbitrary" to one set of people while to the person that made the decision or question it might be "Logical" because they know the thought process that made the decision or question. I thought of another example to try to explain "Arbitrary" and "Logical". Back in 1991 I had to write a system that would select Marines to take a urinalysis. The system had to be completely random so that it could not be used to specifically target any individual or group of individuals. Thus the list of Marines that where chosen where "Arbitrary". The business rule that the list would be "Arbitrary" was "Logical". The reason can be "Logical" with the result being "Arbitrary" But the neither the reason or the result are both "Logical" and "Arbitrary". I know this concept is lost on you.

Wayne Francis · 25 October 2008

cobby said: Marginally? Chemical gradients are a huge key when genes turn on and off. That is like saying “Flour is only marginally useful for making bread”. You really can not be this stupid can you? ... no read some studies. they dont know how the shape are formed. yes they know how certain cells are instructed to start and stop but the shape, sorry charlie: its a mystery. go ask someone in the field.
I've said it before I'll say it agian. Just because you don't understand how the gradients work doesn't mean the scientist don't. I do read papers I even read papers where they use markers that show where genes are being expressed and low and behold these visible markers show morphology of developing physiology before the structure is actually formed.

Wayne Francis · 25 October 2008

cobby said: Tonight, as it is 3am, I’m going to see Max Payne with my friend Christine. Out every night and I still have plenty of time to show you for the useless willfully ignorant lying shit for brain troll that you are. ... sounds like you are an alcoholic. how many times a week do you drink and how much?
Sounds like you are delusional. Where did I say I had anything to drink? I drink a handful of times a year one of them normally being on my birthday and I very rarely ever get over the legal limit. Just because I go out late has no bearing on me if I drink or not. I go out all the time to night clubs with friends and dance all night without touching a drop of alcohol and once in a while I will drink which is OK to because 1) I know my limits on what I can drink and stick to those alcohols (normally vodka but baileys and a few others are OK too) 2) I know how much and how fast I can drink without getting "off my face" 3) I don't drive on those few nights and it only cost me about $10-$15 to catch a taxi home from the city. Often I don't drink so that I can drive my friends home. So to answer your question...There is probably a less then 5% chance each week if I'll drink or not. The last time I had a drink was August 30th, celebrating my birthday (that was 2 days earlier) with my friends, and I had 6 drinks over about 4 hours and I was at a pub around the corner from my place. Let it be known I have absolutely no problem with people that drink more then I do. I just don't care about alcohol that much. The real problem here is that you can't get past your pea brain that the world is nothing like you think it is. When anyone actually points out how the world actually works you ignore them. This is why you are a worthless willfully ignorant shit for brains lying troll. Since you project so much one would start to wonder if you are not some type of closet alcoholic.

Wayne Francis · 25 October 2008

cobby said: .. wow so you found a couple of abstract by googling keywords like morphogenesis etc. ... well the first is a simulation and the second still does not show how the shapes were formed. ... did you really understand these studies? can you read them. paraphrase what they say. all you have ever done is cut and paste. .... you really ought to take some courses in research. you are sounding stupider by the post.
All you have ever done is wave your hands and said that everything that you have been shown is not evidence then in the next breath claim no one ever shows you any evidence. This is why you are a worthless willfully ignorant shit for brain lying troll and will never be anything but. You are projecting again Blow Jobby.

Malcolm · 25 October 2008

PvM said: So far the following 'assertions' by Bobby have not only shown to be without much merit, Bobby also has remained unable to provide any supporting evidence and research 1. The genome does not contain sufficient information 2. No instances of natural selection have been observed 3. No instances of natural selection leading to complex systems have been observed 4. Chemical gradients are only marginally useful in morphogenesis There are a variety of lesser variants of statements by Bobby which underline his lack of familiarity with evolutionary and biological science. However, these seem to be recurring themes. Typically when cornered with facts, Bobby will chose another claim or revisits an earlier claim even though it had been shown to be lacking in evidence, logic and reason. Fascinating behavior.
This troll doesn't know JAK/STAT about biology.

Malcolm · 25 October 2008

cobby said: conceptual framework for understanding the interactions of these major signaling pathways in branching morphogenesis.**** future challenge is to translate understanding of the signaling cascade into knowledge of the cellular responses, including cell proliferation, migration and differentiation, that lead to the stereotyped branching. **** ...THEY DONT KNOW!!
This troll manages to be both worthless and priceless at the same time.

Dave Luckett · 25 October 2008

Booby's invisible magical hand will always be present, simply because science will never know everything. His attack, for what it's worth, rests simply on the ancient axiom "a fool can ask questions that the wisest cannot answer." Find a question to which the answer is not yet known, and science is confounded!

It really is that simple, and that specious. All you have to do is keep asking ignorant questions until you reach the frontiers of human knowledge - which will happen, sooner or later, because human knowledge is finite. It doesn't matter that you will reach the frontiers of your own knowledge long before that, and won't understand the answers you receive. Not understanding stuff is familiar ground to ignorant people, among whom I include myself when it comes to the interaction of genetics and morphology; but the invincibly ignorant, like Booby, develop workarounds to deny their ignorance.

We've seen some of these workarounds in action here, like denial, (simple refusal to admit facts) argument from incredulity, (I don't believe this, so it can't be true) projection, (attributing to others one's own fraudulence) shifting ground (when answered, just ask another question) and false absolutism, (not everything is known, therefore nothing is known). There are others, and no doubt they can be discerned as well.

Of course these are fraudulent, and the fraud is obvious, but the point is that this simply doesn't matter to Booby, which is why this is a mug's game for science. I quite take PvM's point that Booby is making a thorough ass of himself, and that this must be plainly apparent to anyone with the slightest scintilla of ordinary common sense, but there's a point beyond which people will start to wonder if he's being taken seriously.

Further, there's a downside to gratifying him with attention like this. He's made his agenda plain a number of times. He enjoys annoying people, and he derives satisfaction from making them react. To him, it's evidence of his own importance and status. These are plainly vital issues for him, probably because people usually ignore and dismiss him. Reacting to him helps him fantasise about being a controller, with others his unwitting and unwilling toys, when he's actually only another sad, brain-dead little tosser with an ego where his brain should be.

Arguing with him is therefore like the proverbial mud wrestling with a pig. By arguing with him - even by exposing him as the contemptible fraud he is - we are actually reinforcing his behaviour. I seriously question whether there's any point to it.

Wayne Francis · 25 October 2008

cobby said: """How such trees are generated during development, and how the developmental patterning information is encoded, have long fascinated biologists and mathematicians.""" ... translation: 'we have no idea how this is done'
Once again Blow Jobby's understanding of words fails him.
dictionary.com fas⋅ci⋅nate [fas-uh-neyt] verb, -nat⋅ed, -nat⋅ing. –verb (used with object) ... 2. to arouse the interest or curiosity of; allure. ...
cobby said: """We propose that each mode of branching is controlled by a genetically encoded subroutine, a series of local patterning and morphogenesis operations, which are themselves controlled by a more global master routine.""" translation: ' here is our guess' ... do you even read these abstracts??
dictionary.com guess   [ges] –verb (used with object) 1. to arrive at or commit oneself to an opinion about (something) without having sufficient evidence to support the opinion fully: to guess a person's weight. ...
But papers are supported by evidence that is peer reviewed. I lay person could call this a "guess" and you might even find a scientist that calls it this because they are thinking of the real meaning of the word. The real term used in papers is
dictionary.com re⋅sult  [ri-zuhlt] –noun 3. something that happens as a consequence; outcome.
and after that
dictionary.com dis⋅cus⋅sion  [di-skuhsh-uhn] –noun an act or instance of discussing; consideration or examination by argument, comment, etc., esp. to explore solutions; informal debate.
where the paper talks about what generalizations can be concluded and why, how the conclusions compare to the current set of scientific understanding of the topic, any implications of the paper, etc. All of which very often points you back to the data within the paper that supports the statement. So these are far from a "guess" like Blow Jobby would like lurkers that don't understand how a scientific paper is written. He is trying to play upon the same misunderstanding that many people, that are not scientifically literate, have about the word "theory". Yet again Blow Jobby has shown himself to be a arrogant willfully ignorant lying shit for brains troll.

Wayne Francis · 25 October 2008

cobby said: dummuy, that is not quote mining that is QUOTING. do you know there is a difference? .. you really dont understand any of this do you?? "However, how their interactions result in a branched structure has not been elucidated." ... how many times do they have to say they dont know till you believe they dont know?
This coming from the Shit for brains that claimed I quoted mined him when I included like 16 complete posts of his that showed him to make a statement he claimed he never made. He has not once, that I have seen, used a quote that supports him in the real context that it was stated. That is quote mining and that is why Blow Jobby is a arrogant willfully ignorant lying shit for brains troll. Blow Jobby also shows, once again, that when he claimed to be a JHS and College teacher he was probably lying as his grammar is at an elementary school level.

Stanton · 25 October 2008

Dave Luckett said: Arguing with {cobby/jobby/bobby/jacob/hamstrung/balanced/goff} is therefore like the proverbial mud wrestling with a pig. By arguing with him - even by exposing him as the contemptible fraud he is - we are actually reinforcing his behaviour. I seriously question whether there's any point to it.
It would help if the Admins were to put this thread out of its unending misery and actually get around to enforcing cobby/jobby/bobby/jacob/hamstrung/balanced/goff's banning once and for all.

Wayne Francis · 26 October 2008

Dave Luckett said: Arguing with him is therefore like the proverbial mud wrestling with a pig. By arguing with him - even by exposing him as the contemptible fraud he is - we are actually reinforcing his behaviour. I seriously question whether there's any point to it.
Ah but I'm not arguing with him. I know I'll never be able to teach him anything and I don't try to change his delusions. What I do it point out his delusions to any lurkers that might not be following this thread as closely as most of us. Let him roll around in the mud I say. It is the definition of insanity to try to educate someone like Blow Jobby but that does not mean there is no reason to point out his stupidity every time he opens his mouth.

cobby · 26 October 2008

Dave Luckett said: Booby's invisible magical hand will always be present, simply because science will never know everything. His attack, for what it's worth, rests simply on the ancient axiom "a fool can ask questions that the wisest cannot answer." Find a question to which the answer is not yet known, and science is confounded! It really is that simple, and that specious. All you have to do is keep asking ignorant questions until you reach the frontiers of human knowledge - which will happen, sooner or later, because human knowledge is finite. It doesn't matter that you will reach the frontiers of your own knowledge long before that, and won't understand the answers you receive. Not understanding stuff is familiar ground to ignorant people, among whom I include myself when it comes to the interaction of genetics and morphology; but the invincibly ignorant, like Booby, develop workarounds to deny their ignorance. We've seen some of these workarounds in action here, like denial, (simple refusal to admit facts) argument from incredulity, (I don't believe this, so it can't be true) projection, (attributing to others one's own fraudulence) shifting ground (when answered, just ask another question) and false absolutism, (not everything is known, therefore nothing is known). There are others, and no doubt they can be discerned as well. Of course these are fraudulent, and the fraud is obvious, but the point is that this simply doesn't matter to Booby, which is why this is a mug's game for science. I quite take PvM's point that Booby is making a thorough ass of himself, and that this must be plainly apparent to anyone with the slightest scintilla of ordinary common sense, but there's a point beyond which people will start to wonder if he's being taken seriously. Further, there's a downside to gratifying him with attention like this. He's made his agenda plain a number of times. He enjoys annoying people, and he derives satisfaction from making them react. To him, it's evidence of his own importance and status. These are plainly vital issues for him, probably because people usually ignore and dismiss him. Reacting to him helps him fantasise about being a controller, with others his unwitting and unwilling toys, when he's actually only another sad, brain-dead little tosser with an ego where his brain should be. Arguing with him is therefore like the proverbial mud wrestling with a pig. By arguing with him - even by exposing him as the contemptible fraud he is - we are actually reinforcing his behaviour. I seriously question whether there's any point to it.
... you sound like a very angry person. I quit reading after the first sentence. But you did jump when I clicked my fingers, good monkey!

cobby · 26 October 2008

... Wayne, are you an alcoholic?

Wayne Francis · 26 October 2008

cobby said:
Dave Luckett said: ...
... you sound like a very angry person. I quit reading after the first sentence. But you did jump when I clicked my fingers, good monkey!
You quit reading everything after the first sentence it seems blow jobby. This is why you don't understand anything and make wrong assumptions all the time like me being an alcoholic. I don't read his post as being anger at all. Are you angry that no one in the world believes any of the ideas that come out of your pea brain?

Wayne Francis · 26 October 2008

cobby said: ... Wayne, are you an alcoholic?
See you didn't read my post at all did you Blow Jobby. Kind of hard to be an alcoholic if you don't have any drinking problem. I don't drink because most often I don't feel like drinking. If I do feel like having a few drinks I'll have a few drinks. It just happens that only happens a few times a year at most. Are you projecting? Are you an alcoholic? We know you are a liar, so I don't know why I even asked you because you probably would not answer honestly.

cobby · 26 October 2008

... well it was fun watching the hamsters run wild in their little cages after my *click* command. Of course I did not read the gibberish.

... anyhow lets get the little vermin back on track.

..... see if they can focus rather than ranting, spitting an gritting their rabid little teeth

.... OK 1. Can human tissue be grown in vitro?

2. Can human organs be grown in vitro?

cobby · 26 October 2008

... Wayne what time is it in Oz? Were you out drinking last night?

Wayne Francis · 26 October 2008

cobby said: .... OK 1. Can human tissue be grown in vitro? 2. Can human organs be grown in vitro?
I've already answered the first question. But as per normal you can't read. As for the 2nd question it depends on the organ. Pick one. There are many organs. The current answer is different depending on the organ you are talking about. See this is your problem Blow Jobby. You look at everything to simply. Just like asking "When does a person stop growing" is an ambiguous question so is this one. A knowledgeable person can't answer that question without more information from you. It is like asking "X + Y = 5?" Well yes and no. If X is 3 and Y is 2 then yes, if X = 3 and Y = 1 then no.

Wayne Francis · 26 October 2008

cobby said: ... Wayne what time is it in Oz? Were you out drinking last night?
Blow jobby shows he can't even tell time and do some basic math. He also shows that he doesn't read any posts even those that answer simple questions he has asked. I have already answered this question and he didn't read it. Why would I answer him again. That would be stupidity because he show no indication he ever reads the answers to any question especially if it isn't the answer he wants to hear. This is why blow jobby is an arrogant willfully ignorant lying shit for brain troll.

cobby · 26 October 2008

Wayne Francis said:
cobby said: ... Wayne what time is it in Oz? Were you out drinking last night?
Blow jobby shows he can't even tell time and do some basic math. He also shows that he doesn't read any posts even those that answer simple questions he has asked. I have already answered this question and he didn't read it. Why would I answer him again. That would be stupidity because he show no indication he ever reads the answers to any question especially if it isn't the answer he wants to hear. This is why blow jobby is an arrogant willfully ignorant lying shit for brain troll.
.... you sound like you have a NASTY hangover.

cobby · 26 October 2008

As for the 2nd question it depends on the organ. Pick one. There are many organs. The current answer is different depending on the organ you are talking about.

... well tell us one organ which CAN be grown in vitro!

.... youre a good monkey!

Wayne Francis · 26 October 2008

I'm off to bed. Blow Jobby has either gone away or is having a hard time figuring out the time in South Australia because he doesn't have enough fingers on one hand.

I'll point out to all the lurkers his stupidity in every post he makes in the next few hours tomorrow morning.

Wayne Francis · 26 October 2008

cobby said:
Wayne Francis said:
cobby said: ... Wayne what time is it in Oz? Were you out drinking last night?
Blow jobby shows he can't even tell time and do some basic math. He also shows that he doesn't read any posts even those that answer simple questions he has asked. I have already answered this question and he didn't read it. Why would I answer him again. That would be stupidity because he show no indication he ever reads the answers to any question especially if it isn't the answer he wants to hear. This is why blow jobby is an arrogant willfully ignorant lying shit for brain troll.
.... you sound like you have a NASTY hangover.
Well this shows how bad Blow Jobby's perception is. It isn't possible for me to have a hangover for 2 reasons. 1) I have not had any alcohol since August 30th, as I've already said in other posts. 2) When I drink I normally drink Vodka and don't drink to excess. This combined with a healthy amount of water and few vitamin B tablets nullifies any hang over effect that might normally happen for most people.

Wayne Francis · 26 October 2008

cobby said: As for the 2nd question it depends on the organ. Pick one. There are many organs. The current answer is different depending on the organ you are talking about. ... well tell us one organ which CAN be grown in vitro! .... youre a good monkey!
Blow Jobby thinks that his Monkey comments bother me in some way. He is deluded as normal. For the lurkers one organ that can be grown in the lab is skin. Blow Jobby probably didn't even know that skin is an organ. It happens to be the biggest organ on a human. If he does respond he'll claim he knew this all along and probably shift the goal post. See in all likely hood Blow Jobby is probably trying to catch someone saying something he can twist around. By asking ambiguous questions he thinks he can get someone to give an answer that can be easily quote mined. This is why others and myself have blow jobby be more specific with his idiotic questions. His actions again and again show him to be an arrogant willfully ignorant lying shit for brain troll.

cobby · 26 October 2008

For the lurkers one organ that can be grown in the lab is skin.

.... any others??

cobby · 26 October 2008

... well I think Wayne passed out. hes right about one thing. he didnt have a hangover cuz its nite over there.

... he'll have a nasty one tomorrow. jeez he gets mean when he's drinking.

Wayne Francis · 26 October 2008

I'll exlain more on why Blow Jobby is a lying ass troll.

A ethical person that was truely interested in discussion would ask a question in the context of some statement like.

"If what PvM says is true we should be able to grow organs in vitro"

or

"If what PvM says is true we should not be able to grow organs in vitro"

But he uses a normal creationist tactic asking ambiguous questions to which he expects a certain answer which he'll pounce upon with some situation that doesn't match the answer given. The answer given would have been given in good faith it is the question that is ambiguous and misleading.

Kind of like when creationist make stupid claims about some radiometric dating then jump all over the answer because there is some exception, that is well known to scientist, that doesn't agree with the answer. Often the questions asked would take pages and pages of text to answer and honest people trying to answer the question will only answer the basic question leaving out the details.

This is the kind of dishonest question blow jobby is trying to lure people into. If he wasn't such a lying religious nut job he would state out his whole question in full. The problem with this for him is it would be so easy for everyone to show how his question is misleading at best and most likely an outright falsehood.

cobby · 26 October 2008

... Wayne, go to bed and sleep it off!

Wayne Francis · 26 October 2008

cobby said: For the lurkers one organ that can be grown in the lab is skin. .... any others??
Just as I pointed out. He doesn't like the answer so he moves the goal post. He asked a question. Got a valid answer, didn't like the answer so he does not explain why he wants to know and in what context he is talking about. For the lurkers there are other organs that have been grown in the lab. Most organs need some type of scaffold to grow because they don't have the proper chemical gradients that control their growth outside of the body. These chemical signals are normally provided by the surrounding tissue. So in the lab the "shape" is controlled in another manner. See this is what Blow Jobby is trying to do. He wants someone to say something like "Yes, a heart has been grown" to which he'll reply something like "The heart needed a scaffold to control its shape. The heart tissue left alone would not form into a heart so this proves that there is more information needed." All the while ignoring that we've said over and over that the shapes of organs are controlled not only by the stem cells turning into those organs but the cells all around that area. Going back to the early pages of this post I pointed out that this is why conjoined twins are very interesting because those gradients end up being very different then what normally happens. This is why you can have conjoined twins that share organs and very often those organs have an unusual shape. Like vertebra that have 2 vertebral foramens. Unfortunately for Blow Jobby I don't think anyone would fall into his trap. Perhaps he should think of a tactic that hasn't been used by many creationist religious nut jobs that have come before him.

Wayne Francis · 26 October 2008

cobby said: ... Wayne, go to bed and sleep it off!
Blow Jobby doesn't want me around to show how much of an lying deceitful shit for brain troll he is. This is his normal reaction when he has backed himself into a corner and can not use the common creationist tactics we are all used to dealing with.

cobby · 26 October 2008

... Wayne go to bed and sleep it off!

cobby · 26 October 2008

Unfortunately for Blow Jobby I don’t think anyone would fall into his trap.

..... yes the ever so clever trap of asking if ' organs can be grown in vitro '!! what a diabolical, devious question to ask. this question should NEVER be asked. it is too, too deceptive!!

Wayne Francis · 26 October 2008

cobby said: ... well I think Wayne passed out. hes right about one thing. he didnt have a hangover cuz its nite over there. ... he'll have a nasty one tomorrow. jeez he gets mean when he's drinking.
More examples of Blow Jobby's inability to read. If I was intoxicated it would be very difficult to articulate myself so well. He thinks I'm mean, how nice. He shouldn't take my insults to him to personally because they are not for his benefit but for the lurkers. We all call him names to show the lurkers we have for the worthless piece of shit. Oh wait, he isn't worthless. He provides a perfect example of an arrogant religious nut job that has no clue about science, the English language, telling time and information theory, to name a few topics. He is probably pissed off that his latest creationist troll tactic was exposed so easily. One must wonder if he ever thinks that lying for Jesus might not be the best idea if he is really worried about his eternal soul.

Wayne Francis · 26 October 2008

cobby said: Unfortunately for Blow Jobby I don’t think anyone would fall into his trap. ..... yes the ever so clever trap of asking if ' organs can be grown in vitro '!! what a diabolical, devious question to ask. this question should NEVER be asked. it is too, too deceptive!!
Once again blow jobby tries to change the issue. The question isn't the problem it is the lack of context in order to try to get an answer that can be more easily quote minded. It is a common creationist tactic and he probably thought he was so cleaver in thinking it up.

Wayne Francis · 26 October 2008

quote minded = quote mined. case of FFS (fat finger syndrome)

cobby · 26 October 2008

The heart tissue left alone would not form into a heart so this proves that there is more information needed.” All the while ignoring that we’ve said over and over that the shapes of organs are controlled not only by the stem cells turning into those organs but the cells all around that area.

.... and this of course has been proven?? has there been one experiment where any shape forming has been induced.

... there is a frantic need for shaped organs. even things like noses and ears because of the large amount of those injuries from the Iraq war. and also to replace damaged bladders etc. a researcher who could devise a way to even grow a shaped bladder would be a great hero. why isnt it happening. if we know the mechanism why arent people using that mechanism. they cannot even get an ear lobe shape to happen.

... yet i am told there are thousands of studies showing the mechanisms for shape. then why arent they growing shaped organs? i know the answer i will here: ' the check is in the mail' ' we havent gotten around to it'

.. why organs take certain shapes is 98% a mystery and it would be nice if these morons would admit it.

cobby · 26 October 2008

If I was intoxicated it would be very difficult to articulate myself so well.

.... i think you are proving my point here.

cobby · 26 October 2008

He thinks I’m mean, how nice. He shouldn’t take my insults to him to personally because they are not for his benefit but for the lurkers.

... now that made no sense. (slurp)

cobby · 26 October 2008

... those vets with blown off faces and missing limbs wish those scientists who know how to shape organs would let the rest of the world know.

cobby · 26 October 2008

If I was intoxicated it would be very difficult to articulate myself so well.

.... denial: one of the core signs of alcoholism. I think he finally passed out, whew. Some people get mean when they drink. I wonder if he is divorced.

Wayne Francis · 26 October 2008

cobby said: The heart tissue left alone would not form into a heart so this proves that there is more information needed.” All the while ignoring that we’ve said over and over that the shapes of organs are controlled not only by the stem cells turning into those organs but the cells all around that area. .... and this of course has been proven?? has there been one experiment where any shape forming has been induced.
We've provided references to papers that talked about this process in other organs of other species. I've also read a paper on heart development in mammalian embryos. Jobby thinks just because a paper hasn't been written yet for the very specific question he asks that all the papers that have been written on similar questions mean nothing. We could have the entire genetic process of a mouse mapped out and show that they where, to date, analogise of human genetic processes but if we didn't have every question answered it meant nothing.
cobby said: ... there is a frantic need for shaped organs. even things like noses and ears because of the large amount of those injuries from the Iraq war. and also to replace damaged bladders etc. a researcher who could devise a way to even grow a shaped bladder would be a great hero. why isnt it happening. if we know the mechanism why arent people using that mechanism. they cannot even get an ear lobe shape to happen.
Why does Blow Jobby think there is no research into this area? Producing organs is a huge area of research. Funny enough the easiest way to produce viable organs is also the most controversial ethically. If we could clone humans like we do animals and learnt how to turn off brain development then we could grow clone, with no brain, soon after a person was conceived to be used for "spare parts". But since there are so many ethical issues about doing this we are looking for alternative methods. One of these methods is also coming up against public criticism. This being growing genetically modified animals that have organs that can be transplanted into humans. We already use pig and bovine valves and testing is already going ahead transplanting whole hearts into non human primates from pigs.
cobby said: ... yet i am told there are thousands of studies showing the mechanisms for shape. then why arent they growing shaped organs? i know the answer i will here: ' the check is in the mail' ' we havent gotten around to it'
Like it has been said before to get all the signals you need you basically have to grow the entire organism. Blow Jobby ignores this fact. The reason we can grow "Tissue" over whole "Organs" so easily is that these gradients are typically not needed in the same way they are for the entire organ. All of this doesn't matter. The point here is blow jobby has no clue on how any of this works so his complaints about it not being done yet mean nothing.
cobby said: .. why organs take certain shapes is 98% a mystery and it would be nice if these morons would admit it.
What would be nice is if Blow Jobby would break out of his creationist ignorance and admit he doesn't know anything. Because he doesn't understand anything he projects this onto others. He has shown time and time again that he is very good with projection.

Wayne Francis · 26 October 2008

cobby said: He thinks I’m mean, how nice. He shouldn’t take my insults to him to personally because they are not for his benefit but for the lurkers. ... now that made no sense. (slurp)
Blow Jobby once again shows he has reading comprehension issues. Perhaps if Blow Jobby had a valid claim he would point out where my spelling, grammar or punctuation is in error in my statement. But, as per normal, he make completely unfounded claims. He doesn't because he is a lying shit for brain troll that can not back up a single claim he has ever made without being shown to be completely wrong. From now on I think I'll go into grammar police mode and show how bad Blow Jobby's grasp on the English language actually is.

Wayne Francis · 26 October 2008

cobby said: If I was intoxicated it would be very difficult to articulate myself so well. .... denial: one of the core signs of alcoholism. I think he finally passed out, whew. Some people get mean when they drink. I wonder if he is divorced.
Blow Jobby ignores what gets said and makes blind unsupported accusations. I would wonder if blow jobby has ever had sex but I know there are some very desperate women out there. At Least when I use colourful adjectives to describe him I also point out how his posts are full of shit. All he can do is try to insult me. The problem of this is that everyone that is following this thread know the truth. So is lying for is own benefit. I'm sure like every other lie that comes out of his mouth only serves to convince himself. I would be interested to see him actually point out a problem with any of my posts. He has tried before but failed miserably every time. Only about a day ago he tried to use an article to refute things I had wrote about "growing" but not only did the article not refute what I wrote it was in direct opposition to Blow Jobby's claim that DNA doesn't control morphology. Let us see what the arrogant willfully ignorant piece of shit lying troll comes up with this time. I'm guessing it will be nothing new.

cobby · 26 October 2008

...Wayne, you spend a lot of time trying to discredit someone you claim is apparently and obviously not credible. Seems illogical to me and a waste of time.

... OK couple of questions: are you saying that organs will never be able to grown in vitro? In the past were you a heavy drinker?

DS · 26 October 2008

Come on Wayne, just admit it, without the mold you don't have any idea what shape the jello will be! Corn cobby doesn't seem to notice that it is arguing against it's own position. What a microcephalic chimpanzee.

As for making unsupported accusations, that is all it has ever had. It don't need no stinkin evidence. That also explains why it is immune to evidence, it doesn't even understand the concept.

Just give up man. Leave this monkey screaming alone on a moribund thread. Two thousand off topic posts is enough. Besides, no one has come to the aid of this deviant. Obviously everyone already realizes that it doesn't have a clue.

cobby · 26 October 2008

Come on Wayne, just admit it, without the mold you don't have any idea what shape the jello will be! Corn cobby doesn't seem to notice that it is arguing against it's own position. What a microcephalic chimpanzee.

... Dave what % of the off topic post do estimate were mine and how many were the monkeys?

PvM · 26 October 2008

One of the signs of defeat is that one uses insults, ignores the promises of discussing science and does anything to erase the embarrassing facts. That Bobby however wants to step so deep shows a sign of desperation that I have not seen for quite a while. Accusing people of being alcoholics... What a wonderful example Bobby makes of what happens when people who have spent a long time in ignorance are exposed to science. Denial seems to be the first step, followed by anger. Is this the behavior that you want to exhibit to represent your faith Bobby? WWJD?
cobby said: If I was intoxicated it would be very difficult to articulate myself so well. .... denial: one of the core signs of alcoholism. I think he finally passed out, whew. Some people get mean when they drink. I wonder if he is divorced.

PvM · 26 October 2008

Tempting although holding up Bobby as an example is also tempting, especially since his presence has been limited to a single thread. Yes you are right, Bobby has violated this board's rules by using a variety of aliases. Nevertheless, seeing what happens when ignorance is exposed with science, ... priceless.
Stanton said:
Dave Luckett said: Arguing with {cobby/jobby/bobby/jacob/hamstrung/balanced/goff} is therefore like the proverbial mud wrestling with a pig. By arguing with him - even by exposing him as the contemptible fraud he is - we are actually reinforcing his behaviour. I seriously question whether there's any point to it.
It would help if the Admins were to put this thread out of its unending misery and actually get around to enforcing cobby/jobby/bobby/jacob/hamstrung/balanced/goff's banning once and for all.

PvM · 26 October 2008

On the contrary, it is extremely logical as it shows the extent to which ignorance can guide someone even when presented with scientific facts. And these postings are not just for you Bobby but for those lurkers who get to see the dark side of ignorance. WWJD?
cobby said: ...Wayne, you spend a lot of time trying to discredit someone you claim is apparently and obviously not credible. Seems illogical to me and a waste of time. ... OK couple of questions: are you saying that organs will never be able to grown in vitro? In the past were you a heavy drinker?

PvM · 26 October 2008

Wayne Francis said: We've provided references to papers that talked about this process in other organs of other species. I've also read a paper on heart development in mammalian embryos. Jobby thinks just because a paper hasn't been written yet for the very specific question he asks that all the papers that have been written on similar questions mean nothing. We could have the entire genetic process of a mouse mapped out and show that they where, to date, analogise of human genetic processes but if we didn't have every question answered it meant nothing.
Yes, Bobby is not only unwilling to address any scientific research or papers but he lets his ignorance guide him in his claims and behavior. Ah, denial, the first step towards recovery... But somehow it seems that the step is taking Bobby down some dark roads. WWJD?

PvM · 26 October 2008

cobby said: .. why organs take certain shapes is 98% a mystery and it would be nice if these morons would admit it.

Cobby, it may be 98% a mystery to you and I am surprised you believe you belong it said category. Well, you said it... But to science, shape formation is hardly 98% a mystery. Anyone familiar with the facts would know how the interaction of genetics, local effects and constraints work to shape the many organs and limbs in the body. Just because Bobby refuses to educate himself does not mean that science is equally ignorant and several papers have been offered that show this.

Bobby's response other than quote mining and ridicule?

Nothing. Nothing at all.

Lurkers beware.

Science Avenger · 26 October 2008

Wow, 62 pages, and total domination of the "recent comments". Could the use of PT resources get further from optimal?

iml8 · 26 October 2008

cobby said: If I was intoxicated it would be very difficult to articulate myself so well.
If the PB talks as he does SOBER, one would be dumbfounded to think of what he might sound like DRUNK. White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html

Science Avenger · 26 October 2008

cobby said: In the past were you a heavy drinker?
His drinking habit was as much a part of his life as the habit of dressing up in little girl's clothing and taking pictures of yourself in their mirrors was a part of yours. I really really REALLY would love to see a succinct, straightforward explanation from the PT owners as to why they allow this to continue. I'm not saying anyone owes me an explanation - you don't. I'm just overwhelmed with curiousity as to how it could be justified.

cobby · 26 October 2008

PvM said: Tempting although holding up Bobby as an example is also tempting, especially since his presence has been limited to a single thread. Yes you are right, Bobby has violated this board's rules by using a variety of aliases. Nevertheless, seeing what happens when ignorance is exposed with science, ... priceless.
Stanton said:
Dave Luckett said: Arguing with {cobby/jobby/bobby/jacob/hamstrung/balanced/goff} is therefore like the proverbial mud wrestling with a pig. By arguing with him - even by exposing him as the contemptible fraud he is - we are actually reinforcing his behaviour. I seriously question whether there's any point to it.
It would help if the Admins were to put this thread out of its unending misery and actually get around to enforcing cobby/jobby/bobby/jacob/hamstrung/balanced/goff's banning once and for all.
...How many aliases does Dave Stanton have?

cobby · 26 October 2008

Science Avenger said:
cobby said: In the past were you a heavy drinker?
His drinking habit was as much a part of his life as the habit of dressing up in little girl's clothing and taking pictures of yourself in their mirrors was a part of yours. I really really REALLY would love to see a succinct, straightforward explanation from the PT owners as to why they allow this to continue. I'm not saying anyone owes me an explanation - you don't. I'm just overwhelmed with curiousity as to how it could be justified.
... I am amazed that PT allows the filthy language here. What if kids somehow wander here and are subjected to this filth. That should be cleaned up. I have already advised some schools not to use this as a source because of the language.

cobby · 26 October 2008

Cobby, it may be 98% a mystery to you and I am surprised you believe you belong it said category. Well, you said it… But to science, shape formation is hardly 98% a mystery.

... then why dont they grow organs?

PvM · 26 October 2008

I have no idea, but I do know that you have violated the terms of services of this site. Surely you do not hold to the belief that the behavior of others is somehow an excuse for your own behavior? WWJD Bobby?
cobby said: ...How many aliases does Dave Stanton have?

PvM · 26 October 2008

cobby said: ... I am amazed that PT allows the filthy language here. What if kids somehow wander here and are subjected to this filth. That should be cleaned up. I have already advised some schools not to use this as a source because of the language.
ROTFL, you're funny Bobby, very funny...

PvM · 26 October 2008

But they do grow organs. Similarly we do understand fusion and yet we cannot recreate it reliably in the lab. Does that mean we don't understand fusion. Surely even Bobby should understand how foolish this statement is?
cobby said: Cobby, it may be 98% a mystery to you and I am surprised you believe you belong it said category. Well, you said it… But to science, shape formation is hardly 98% a mystery. ... then why dont they grow organs?

cobby · 26 October 2008

... they grow organs? tell me more!

... and they do not know how to make fusion reactions? tell me more!

DS · 26 October 2008

PvM wrote:

"I have no idea, but I do know that you have violated the terms of services of this site. Surely you do not hold to the belief that the behavior of others is somehow an excuse for your own behavior?"

Just to be clear, I use only one name when I post and bobby/jobby/cobby/goff/hamstrung/observer/jacob/etc. has no evidence to the contrary. Then again, if it wants to argue that the behavior of others justifies it's own behavior, then I guess accusing total strangers of alcoholism and pedophilia certainly justifies calling that individual a cross dressing child molester.

Now how else could a lying ignorant troll deflect attention away from the fact that it has no evidence and no point other than name calling and complaining about name calling? If it won't read a paper, I guess that is all it has left. A brain is a terrible thing to waste.

cobby · 26 October 2008

DS, are you the same persona as Dave Stanton? and Stanton?

cobby · 26 October 2008

DS said: PvM wrote: "I have no idea, but I do know that you have violated the terms of services of this site. Surely you do not hold to the belief that the behavior of others is somehow an excuse for your own behavior?" Just to be clear, I use only one name when I post and bobby/jobby/cobby/goff/hamstrung/observer/jacob/etc. has no evidence to the contrary. Then again, if it wants to argue that the behavior of others justifies it's own behavior, then I guess accusing total strangers of alcoholism and pedophilia certainly justifies calling that individual a cross dressing child molester. Now how else could a lying ignorant troll deflect attention away from the fact that it has no evidence and no point other than name calling and complaining about name calling? If it won't read a paper, I guess that is all it has left. A brain is a terrible thing to waste.
... No the difference is, Dave, that this forum as I said uses adult language and should not be read by children. I have said over and over the language should be cleaned up here to no avail.

Wayne Francis · 26 October 2008

SFB A.K.A. cobby said: ...Wayne, you spend a lot of time trying to discredit someone you claim is apparently and obviously not credible. Seems illogical to me and a waste of time.
Blow Jobby has not comprehended my answer to this question he has asked many times before. He still doesn't get that. When I post on PT it is usually for 1 of 3 reasons.
  1. To ask a valid on topic question about a post or thread so I get a better understanding about what is being said.
  2. To provide examples of a concept that laypeople can understand easier and often I include analogies to ease the learning process.
  3. To discredit dishonest individuals like hand jobby when they continually post post after post of garbage
  4. I'm sure the everyone besides Jobby/Bobby/Cobby/Jacob/SFB ( my new nick name for Jobby)
    SFB A.K.A. cobby said: ... OK couple of questions: are you saying that organs will never be able to grown in vitro?
    SFB should proof read his posts. "... able to grown..." seems he is missing a little 2 letter word beginning with the letter "b" that means "to take place; happen; occur". SFB here should have learned this in primary school but like everything he was probably not capable of learning very well back then either. SFB once again reads what he wants to read. No where did I ever even remotely say this. In fact I answered this question fairly lengthily just a few hows ago and he ignored the answer. It is all part in parcel of the religious nut job creationist tactics that he is trying to use. But unlike the normal nut job that doesn't get the answer they would like, often because it addresses the issue they would have come up with in the initial answer, SFB here keeps trying the same tactic over and over. For the lurkers it would be stupid to say organs will never be able to be grown in "a test tube". It would be stupid because I've already stated that different organs have already been grown in the laboratory environment and explained the how and why it is done. Once again SFB asks a leading ambiguous question in hopes that he'll catch someone out. But unlike a bad lawyer he doesn't stop with a line of questioning even after he gets an answer that makes his case clearly moot.
    SFB A.K.A. cobby said: In the past were you a heavy drinker?
    SFB once again asks a irrelevant leading and ambiguous question. Perhaps he would care to try to define what his definition of a "heavy drinker" is. Regardless if I had never had a drink, drink like I do, had 1 glass of wine every night with dinner, drank excessively one night a week or drank a bottle of scotch every night does not change the fact that all my posts about SFB, A.K.A. Cobby/Jobby/Jacob/Bobby/handful of other nick names, illogical posts would still be just as valid. He assumes that I would be offended by his remarks but for one person to be offended by another person then that first person should have some type of respect for what the first person has said. I'm also not worried about what lurkers might think. The knowledgeable lurkers know the quality of post that I put up and any lurkers that would be swayed by SFB fall into the same bucket as SFB in my book and thus hold no respect in my eyes.

Wayne Francis · 26 October 2008

SFB a.k.a. cobby said:
Science Avenger said:
SFB a.k.a. cobby said: In the past were you a heavy drinker?
His drinking habit was as much a part of his life as the habit of dressing up in little girl's clothing and taking pictures of yourself in their mirrors was a part of yours. I really really REALLY would love to see a succinct, straightforward explanation from the PT owners as to why they allow this to continue. I'm not saying anyone owes me an explanation - you don't. I'm just overwhelmed with curiousity as to how it could be justified.
... I am amazed that PT allows the filthy language here. What if kids somehow wander here and are subjected to this filth. That should be cleaned up. I have already advised some schools not to use this as a source because of the language.
I wonder if these are the imaginary schools SFB taught at. Big loss there. The use of swearing as has been used against SFB is in the same literary category as calling him "an ignorant stupid troll". The history of the "F" word :) http://www.youtube.com/watch?v=yPlfDIcjrVI

PvM · 26 October 2008

I have done enough to attempt to educate you only to have you reject knowledge out of hand. Educate yourself my dear confused Christian friend.
cobby said: ... they grow organs? tell me more! ... and they do not know how to make fusion reactions? tell me more!

cobby · 26 October 2008

PvM said: I have done enough to attempt to educate you only to have you reject knowledge out of hand. Educate yourself my dear confused Christian friend.
cobby said: ... they grow organs? tell me more! ... and they do not know how to make fusion reactions? tell me more!
... translation: I dont have an answer.

cobby · 26 October 2008

SFB once again asks a irrelevant leading and ambiguous question. Perhaps he would care to try to define what his definition of a “heavy drinker” is. Regardless if I had never had a drink, drink like I do, had 1 glass of wine every night with dinner, drank excessively one night a week or drank a bottle of scotch every night does not change the fact that all my posts about SFB,

... its not a leading question at all. you could simply answer 'no' but you did not so you must have been a heavy drinker. in fact in think you are at the best a recovering alcholic.

... why do you feel you need to justify yourself to me? you say I have no credibility but you seem to get upset if I criticize you in any way. you dont see me trying to defend your attacks. i know they are just gibberish. jeez you are so easy. its almost not fun anymore.

... anyway you have been completely wrong about 98% of what you have said here.

Wayne Francis · 26 October 2008

SFB a.k.a. cobby said: Cobby, it may be 98% a mystery to you and I am surprised you believe you belong it said category. Well, you said it… But to science, shape formation is hardly 98% a mystery. ... then why dont they grow organs?
SFB doesn't know how to use an apostrophe to indicate omitted letters in a contraction. So for those learning the English language out there if you are writing a contraction from an auxiliary verb and the words like "not" you should include an apostrophe in place of the letters that are removed, in this case the letter "o". SFB having been a "teacher" at both the JHS and college level should know this. Does SFB mean "Why don't they grow organs without scaffolding?"? SFB has been told why. We can't yet make a black hole in the lab but we understand a lot about the process that goes into making a black hole. SFB ignored the explanations on why the organs that can currently be grown in the lab are grown the way that are. It is this willful ignorance that shows SFB for the troll that he is.

PvM · 26 October 2008

Projecting again? I have provided my references. And if you believe that we can create a controlled fusion reaction in the lab then be my guest. At best we can create a very destructive version called the hydrogen bomb. As I said, it's never too late to educate yourself although you seem to be somewhat reluctant. WWJD my confused Christian friend?
cobby said:
PvM said: I have done enough to attempt to educate you only to have you reject knowledge out of hand. Educate yourself my dear confused Christian friend.
cobby said: ... they grow organs? tell me more! ... and they do not know how to make fusion reactions? tell me more!
... translation: I dont have an answer.

Wayne Francis · 26 October 2008

SFB a.k.a. cobby said: ... they grow organs? tell me more!
SFB shows a further lack of understanding when it comes to the written language. You should capitalize the first word of a sentence. A little known exception to this is if you are not being serious. In which case SFB is clearly stating that he doesn't care about learning. SFB has been provided examples of organs and how those organs are grown. His continual tactic of ignoring the answers and asking the question in a misleading manner like this is a common religious nut job creationist tactic.
SFB a.k.a. cobby said: ... and they do not know how to make fusion reactions? tell me more!
For the lurkers fusion reactions are not yet efficient. It currently takes more energy to produce fusion here on earth artificially then the reaction produces. To date "Cold Fusion" has not been independently verified, I.E. replicated. "Hot Fusion" while it can be done is both very difficult and not efficient. It is an active line of research though just like growing organs in the lab. Growing organs in the lab has parallels to "Hot Fusion". When we do "Hot Fusion" in the lab it is not done the same way it is done in the core of a star. Just like when we grow organs in the lab it is not like growing organs in a living organism. With "Hot Fusion" we introduce a lot of energy into the system to get the Deuterium and Tritium atoms moving fast enough to overcome the electromagnetic force so that the strong nuclear force can take over and produce helium 4 while releasing 3.5 MeV of energy. This is not how stars do fusion. In stars the process is much more lengthy and the source of energy to get the ions moving fast enough is gravity. Here on earth we have no way of creating the gravitational effect found in the cores of stars so we "cheat" and do things a bit differently. In the same manner we currently don't have any way of effectively producing the complex set of chemical gradients, amongst other processes, to be able to "grow" an organ as it would normally "grow" in an organism. We cheat the system by providing a scaffold that gives us similar results. Does this mean we will never be able to grow an organ by artificially producing the chemical gradients/etc the organ would normally be exposed to during development? I would guess that eventually be done as long as we humans don't wipe ourselves out of existence even if that is done by some 5 year old human descendant a million years from now as a school project. I would predict that it would be overlooked because of the drawbacks that come with that type of development. I can more easily see biologist coming up with a better designed heart, eye or any other organ. That or people will get over the human cloning issue and spare bodies might be grown for the explicit purpose of harvesting compatible organs. These are not the only alternatives either. As I mentioned in another post we are already in medical trials using pig hearts transplanted into primates. These examples with no doubt be ignored, dismissed or misunderstood by SFB but the rest of the PT readers should understand them just fine.

Stanton · 26 October 2008

cobby/jobby/bobby/jacob/balanced/hamstrung/goff trolled: DS, are you the same persona as Dave Stanton? and Stanton?
DS is not, given as how his name is not David Stanton, and neither one of them post the link to my DeviantArt gallery like I do in all of my posts. And tell us again how falsely accusing DS, David Stanton, and me of being one sock puppeteer is supposed to neutralize the fact that you constantly engage in sock puppetry, and have never bothered to support any of your moronic claims, even when asked repeatedly, nor have you ever acknowledged that all of your moronic questions have been repeatedly answered?

fnxtr · 26 October 2008

(sigh)

A very belated happy birthday, Wayne.

We now return you to your regularly-scheduled taunting of the village idiot.

(aside to PVM: I don't think Yobbo's coming at this from a Christian perspective, he's more the Von Daniken / Heaven's Gate type)

Wayne Francis · 26 October 2008

SFB a.k.a. cobby said:
DS said: PvM wrote: "I have no idea, but I do know that you have violated the terms of services of this site. Surely you do not hold to the belief that the behavior of others is somehow an excuse for your own behavior?" Just to be clear, I use only one name when I post and bobby/jobby/cobby/goff/hamstrung/observer/jacob/etc. has no evidence to the contrary. Then again, if it wants to argue that the behavior of others justifies it's own behavior, then I guess accusing total strangers of alcoholism and pedophilia certainly justifies calling that individual a cross dressing child molester. Now how else could a lying ignorant troll deflect attention away from the fact that it has no evidence and no point other than name calling and complaining about name calling? If it won't read a paper, I guess that is all it has left. A brain is a terrible thing to waste.
... No the difference is, Dave, that this forum as I said uses adult language and should not be read by children. I have said over and over the language should be cleaned up here to no avail.
Perhaps if SFB stopped being a arrogant willfully ignorant lying and deceitful troll then the language wouldn't be here. Seems all the language is used as literary devices to show how little respect SFB has amongst the Pandas Thumb community. He has no problem slandering other people but when valid adjectives are used against himself he gets all high and mighty. He is like William Crotts president of the now bankrupt Baptist Foundation of Arizona. William Crotts defrauded over 11,000 investors. Even after being exposed William Crotts tried to claim the fraud was OK because the investors would eventually have got their money back. In the end the 11,000 investors lost almost a total of $600,000,000. Audits found about $140,000,000 of questionable transactions leading to directors of the organization. Taking the clearly criminal act of channeling funds to the directors personal account through a series of intermediate organizations aside, Crotts thought it was fine to lie to investors over a number of years because he could not admit the truth of what he had done to the organization. I bet SFB and Crotts would be great friends.

Wayne Francis · 26 October 2008

SFB a.k.a. cobby said:
PvM said: I have done enough to attempt to educate you only to have you reject knowledge out of hand. Educate yourself my dear confused Christian friend.
cobby said: ... they grow organs? tell me more! ... and they do not know how to make fusion reactions? tell me more!
... translation: I dont have an answer.
SFB once again show how he believes if he ignores everything he wins. He is obviously highly deluded and should seek some professional help. SFB has been provide many answers with references to back them up and ignores it all and then claims no one has answered him. This is why he is a arrogant deceitful willfully ignorant lying troll.

Wayne Francis · 26 October 2008

SFB a.k.a. cobby said: SFB once again asks a irrelevant leading and ambiguous question. Perhaps he would care to try to define what his definition of a “heavy drinker” is. Regardless if I had never had a drink, drink like I do, had 1 glass of wine every night with dinner, drank excessively one night a week or drank a bottle of scotch every night does not change the fact that all my posts about SFB, ... its not a leading question at all. you could simply answer 'no' but you did not so you must have been a heavy drinker. in fact in think you are at the best a recovering alcholic.
I addressed SFB question in another post. I explained how much and how often I drink. He choose not to read/understand that post because SFB doesn't care to do anything but slander people that show him to be a lying arrogant willfully ignorant deceitful troll. I know religious nut jobs that think having a glass of wine is "Heavy Drinking" and ignore the fact that their precious Jesus would be defined as an alcoholic. I offered SFB the opportunity to clarify his questions but if he did that he would further expose himself as a deceitful troll wanting to quote mine individuals. One just has to look at how many times he has asked me if I got drunk this weekend even after being told the last time I had a drink was on August 30th of this year while calibrating my birthday with friends at a local pub. Clear evidence that he is out to slander and has nothing to back up anything he says.
SFB a.k.a. cobby said: ... why do you feel you need to justify yourself to me? you say I have no credibility but you seem to get upset if I criticize you in any way. you dont see me trying to defend your attacks. i know they are just gibberish. jeez you are so easy. its almost not fun anymore.
I've also addressed this question many times. Again note how SFB ignores answers to why we continually point him out to be a arrogant and willfully ignorant deceitful troll. Any post that answers his questions he conciders gibberish. He is deluded if he thinks I get up set about him trying to slander me. I will point out where he is being deceitful but I am not sure how he mistakes that with being upset.
SFB a.k.a. cobby said: ... anyway you have been completely wrong about 98% of what you have said here.
Notice the SFB provides not a shred of evidence or justification that "98%" what I have said here is completely wrong. This is in contrast to almost every post answering his questions that point out why he is wrong. There is the difference. SFB makes unsupported/unjustified claims and the rest of the PT community provides often detailed explanations and often backed up with references. When SFB has tried to back up his claim the references he uses clearly show they refute SFB's claims. Like in my response to his post http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-170989 where he claims http://answers.yahoo.com/question/index?qid=1006052638603 supports his position and some how refuted something I said. Not only could he not point out how something I said disagreed with the article he linked but the article clearly states.
… It is our genes, made of DNA, that determine how we grow and develop. …
SFB then started ignoring that line of posts. This is why every question SFB asks has to be approached very carefully. He is a lying deceitful arrogant and willfully ignorant troll that asks ambiguous and leading questions to try to trap someone into saying something they really didn't mean like a bad lawyer does in court. I would welcome any proof from SFB that I am wrong about something I've written. I welcome this from anyone because at the end of the day I would correct my misunderstanding and move on. Something SFB has shown incapable of doing.

Wayne Francis · 26 October 2008

fnxtr said: (sigh) A very belated happy birthday, Wayne. We now return you to your regularly-scheduled taunting of the village idiot. (aside to PVM: I don't think Yobbo's coming at this from a Christian perspective, he's more the Von Daniken / Heaven's Gate type)
Thanks fnxtr.

cobby · 27 October 2008

the last time I had a drink was on August 30th of this year while calibrating my birthday with friends at a local pub.

... well how did the 'calibration' go? OK you on the wagon now but you have in the past been a heavy drinker, correct? now come on stop the denial!

cobby · 27 October 2008

It currently takes more energy to produce fusion here on earth artificially then the reaction produces.

... not true better study harder!

cobby · 27 October 2008

.. Wayne could you keep your rants down to like 2 paragraphs. I am not going to waste my time sifting thru the gibberish for some rational thought.

... Any if you have sobered up lets talk about the growing of organs gain. Well the main point is that you say that DNA enough info to construct a human. Yet we cannot even grow the simplest organ shape in vitro. Did the DNA disappear? Oh sure you have FAITH in your assumptions but sorry charlie thats not science.

... I know that ugly horse the sci method rears its head again but sorry charlie no cigar unless you can prove something experimentally. Now you can believe in as many pink unicorns as you want but until you show me one it is just FAITH on your part.

... so for now there is a very mysterious unknown factor in developing a human organ let alone the whole body. so you cannot say that the DNA has all the enough until you can prove it.

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said: It currently takes more energy to produce fusion here on earth artificially then the reaction produces. ... not true better study harder!
Once again SFB makes a claim but doesn't back it up. The fact is fusion is currently not viable as a power source, unless you are talking about solar power :). SFB can only make unsupported claims. Here is the actual data on current fusion technology. Joint European Torus, the largest fusion reactor in the world, is about 30 times less efficient the it would need to be for commercial operation. It is only 70% of break even and that excludes power for running the the rest of the plant. In other words currently we pump in 30% more power into making the plasma then the plasma produces. For those interest in the fact see http://www.jet.efda.org Once again SFB has shown himself to be a lying deceiptful arrogant and willfully ignorant troll that can not back up even one of his claims.

fnxtr · 27 October 2008

… so for now there is a very mysterious unknown factor in developing a human organ let alone the whole body. so you cannot say that the DNA has all the enough until you can prove it.
... call me Kreskin.

DS · 27 October 2008

fnxtr,

OK Kreskin, but you're not the only one.

Remember that I pointed out that the troll was arguing against it's own position. It has now effectively proven that the instructions in DNA are soley responsible for producing an organism. If those instructions are disrupted then the organs are usually not correctly produced, If however the instructions come from some "mysterious unknown factor" outside the body, then the organs should form just fine outside the body.

Oh well, did it really think that it could use some sort of semi-logical approach and show that all developmental biologists are completely wrong? It should just go screw itself into a light socket.

Stanton · 27 October 2008

fnxtr said:
… so for now there is a very mysterious unknown factor in developing a human organ let alone the whole body. so you cannot say that the DNA has all the enough until you can prove it.
... call me Kreskin.
It's astonishing that cobby/jobby/bobby/jacob/balanced/hamstrung/goff takes pains to disqualify everything we say, whether to counter his own, moronic, baseless claims, or to answer his snide, yet moronic questions, as being useless faith and unsupported, yet, cobby/jobby/bobby/jacob/balanced/hamstrung/goff, himself, constantly indulges himself in making baseless claims, and arrogantly clings to his own stupidity, all while adamantly refusing to provide even the most trivial support or explanation for his own claims, and alleged refutations just so he can continue trolling.

Stanton · 27 October 2008

DS said: Oh well, did it really think that it could use some sort of semi-logical approach and show that all developmental biologists are completely wrong? It should just go screw itself into a light socket.
You can't make black-light effects by using a dim bulb, DS.

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said: the last time I had a drink was on August 30th of this year while calibrating my birthday with friends at a local pub. ... well how did the 'calibration' go? OK you on the wagon now but you have in the past been a heavy drinker, correct? now come on stop the denial!
Oh SFB caught me in a singular grammar mistake. Well done SFB. No, I am not on the wagon SFB. I've told you before I do drink, just not often. I don't drink often because I feel no need to drink often. I've already explained to you that I've never been a "Heavy" drinker. I don’t drink beer, don't like the taste. I also don't drink wine, again don't care for the taste. In fact I don’t like the taste of most alcohol. Think what you want SFB. Call me an alcoholic SFB. I don't care. It just shows that you have nothing. As I've shown over and over you can not back up a single claim you have ever made.
SFB a.k.a. cobby said: .. Wayne could you keep your rants down to like 2 paragraphs. I am not going to waste my time sifting thru the gibberish for some rational thought.
SFB probably had this attitude in school. I bet, by his constant poor grammar and lack of understanding of the scientific method he probably didn't even get a high school diploma. He can of coarse prove me wrong. He could give his real name and say what Junior High School and what college he was a "teacher" at.
SFB a.k.a. cobby said: ... Any if you have sobered up lets talk about the growing of organs gain. Well the main point is that you say that DNA enough info to construct a human. Yet we cannot even grow the simplest organ shape in vitro. Did the DNA disappear? Oh sure you have FAITH in your assumptions but sorry charlie thats not science.
SFB once again forgets a grammar school lesson with contractions and forgets that there should be an apostrophe in “that’s”. SFB, again, ignores all the explanations. First we can grow the simplest organ shape. We grow skin. Skin is an organ. Skin doesn't require the same signal gradients as most organs. Most organs are completely surrounded by a numerous other cells types that all contribute to the formation of those organs. The "cake mold" for an organ comes not only from the chemical signals from cells forming into that organ but chemical signals from cells adjacent to that organ. It is a bit more complex then just that but SFB can't grasp that concept and he's said above that his attention span doesn't last for more then 2 paragraphs. ADHD would describe some of SFB behaviour, but this is no excuse for his behaviour. Back to the statement. For scientist to grow a heart outside the body without a artifical scaffold we would have to produce all the signal gradients that a heart stem cells would normally come into contact with over the entire development process it goes through.
SFB a.k.a. cobby said: ... I know that ugly horse the sci method rears its head again but sorry charlie no cigar unless you can prove something experimentally. Now you can believe in as many pink unicorns as you want but until you show me one it is just FAITH on your part.
One has to has to wonder what SFB is referring to with this statement. Science can not "prove" anything. Science can give the best explanation that fits the data. There are many things we have not proven experimentally, unless you count model systems, which SFB here doesn't believe are actually valid in science. Astronomy is full of stuff that we will probably never "prove" experimentally. It is SFB that believes there is some "invisible pink unicorn" that no scientist has ever found and this "unicorn" is the real control mechanism for development. Until SFB can actually articulate what he thinks is controlling development he is the one that has the “invisible pink unicorn” in his hypothesis.
SFB a.k.a. cobby said: ... so for now there is a very mysterious unknown factor in developing a human organ let alone the whole body. so you cannot say that the DNA has all the enough until you can prove it.
SFB once again shows himself to have a poor grasp of the English language.
  • SFB does not capitalize the first word in a sentence. Something most people learn to do in kindergarten or first grade.
  • SFA can not decide if he wants to use a contraction with the auxiliary verb "can" and the adverb "not" so instead of putting a space between the 2 words or using the proper contraction of "can't" he invents some new grammar.
  • SFA finally can't even hold a thought to the end of the sentence "so you cannot say that the DNA has all the enough until you can prove it."
The more I think about it ADHD would explain almost everything with SFB. Still he is a lying deceitful wilfully ignorant arrogant troll.

cobby · 27 October 2008

.. First of all I cant believe someone would waste their time crticizing someones spelling and grammar here. i really an not concerned about that. i do this stuff in between what i am working on as a bit of diversion. i dont take it seriously.

cobby · 27 October 2008

The “cake mold” for an organ comes not only from the chemical signals from cells forming into that organ but chemical signals from cells adjacent to that organ.

... nice belief but its just a guess. where are the experiments??

cobby · 27 October 2008

. Astronomy is full of stuff that we will probably never “prove” experimentally.

... no wrong gain. what is this 'stuff'?

cobby · 27 October 2008

Science can not “prove” anything. Science can give the best explanation that fits the data.

.... evolution has not been proven? should that fact be taught in schools?

cobby · 27 October 2008

Remember that I pointed out that the troll was arguing against it’s own position. It has now effectively proven that the instructions in DNA are soley responsible for producing an organism.

... I was just told nothing can be proven

If those instructions are disrupted then the organs are usually not correctly produced, If however the instructions come from some “mysterious unknown factor” outside the body, then the organs should form just fine outside the body.

... no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape.

... you are basically saying 'gradients-did-it'. attributing the process to unmeasurable, untestable forces. aka pseudoscience.

cobby · 27 October 2008

It currently takes more energy to produce fusion here on earth artificially then the reaction produces.

... the above has been demonstrated several times not to be true. please study much harder.

PvM · 27 October 2008

And the experiments have been provided to you in the form of research papers, papers you so typically refuse to read or even accept that they exist. Instead your ignorance forces you to reject the existence of any such knowledge, even though it was presented to you.
cobby said: The “cake mold” for an organ comes not only from the chemical signals from cells forming into that organ but chemical signals from cells adjacent to that organ. ... nice belief but its just a guess. where are the experiments??

PvM · 27 October 2008

Of course, and it is. Evolution is a fact and the theory of evolution is just that, the best explanation of said facts. Surely you must have known this, although it would help understand your position of ignorance. Hmmm
cobby said: Science can not “prove” anything. Science can give the best explanation that fits the data. .... evolution has not been proven? should that fact be taught in schools?

PvM · 27 October 2008

That depends on the circumstances. In case of an uncontrolled fusion, indeed, the amount of energy exceeds the input but in controlled lab experiments, the poster is correct. Needless to say, Bobby once again remains uninformed.
cobby said: It currently takes more energy to produce fusion here on earth artificially then the reaction produces. ... the above has been demonstrated several times not to be true. please study much harder.

PvM · 27 October 2008

… you are basically saying ‘gradients-did-it’. attributing the process to unmeasurable, untestable forces. aka pseudoscience.

On the contrary, these gradients have been measured and tested. It's your ignorance which drive you to make these pseudoscientific comments and before you pretend otherwise, you have been presented several examples of this. Seems you have not learned much yet about embryology, morphogenesis.

PvM · 27 October 2008

You troll. What a pathetic display.
cobby said: the last time I had a drink was on August 30th of this year while calibrating my birthday with friends at a local pub. ... well how did the 'calibration' go? OK you on the wagon now but you have in the past been a heavy drinker, correct? now come on stop the denial!

cobby · 27 October 2008

PvM said:

… you are basically saying ‘gradients-did-it’. attributing the process to unmeasurable, untestable forces. aka pseudoscience.

On the contrary, these gradients have been measured and tested. It's your ignorance which drive you to make these pseudoscientific comments and before you pretend otherwise, you have been presented several examples of this. Seems you have not learned much yet about embryology, morphogenesis.
.... oh and those tests are in the same alternate reality where your pet pink unicorn lives?

cobby · 27 October 2008

PvM said: And the experiments have been provided to you in the form of research papers, papers you so typically refuse to read or even accept that they exist. Instead your ignorance forces you to reject the existence of any such knowledge, even though it was presented to you.
cobby said: The “cake mold” for an organ comes not only from the chemical signals from cells forming into that organ but chemical signals from cells adjacent to that organ. ... nice belief but its just a guess. where are the experiments??
... show me one and lets discuss it!

cobby · 27 October 2008

... where's Wayne? is out calibrating with the boys again??

DaveH · 27 October 2008

cobby said: ... show me one and lets discuss it!
Wow! I've been away for a couple of days and find that the jobbiebot is back to this again. A very limited set of responses. Surely the programmer must realise by now that his creation is never going to pass the Turing test?

Henry J · 27 October 2008

Surely the programmer must realise by now that his creation is never going to pass the Turing test?

Was Eliza ever meant to do that? ;)

Dan · 27 October 2008

This thread concerns "Luskin and the ID movement on immunology: immune to evidence." The poster "cobby" seems to think that the comment
cobby said: ... where's Wayne? is out calibrating with the boys again??
is relevant to this topic. Reason enough to ignore "cobby".

PvM · 27 October 2008

cobby said: ... show me one and lets discuss it!
Pick any of the ones I shared with you. I do not really have any preferences.

PvM · 27 October 2008

cobby said:
PvM said:

… you are basically saying ‘gradients-did-it’. attributing the process to unmeasurable, untestable forces. aka pseudoscience.

On the contrary, these gradients have been measured and tested. It's your ignorance which drive you to make these pseudoscientific comments and before you pretend otherwise, you have been presented several examples of this. Seems you have not learned much yet about embryology, morphogenesis.
.... oh and those tests are in the same alternate reality where your pet pink unicorn lives?
My pet pink unicorn lives with me at home, although only for Halloween. However, the studies that I and others have presented indeed show how gradients drive body plan during embryogenesis. Perhaps if you had spent some time educating yourself.... I'd say surprise us, but I am not holding my breath. Check out any good book or article about the fruit fly, the nematode or other organisms which have been quite well described in details about embryological development. And don't pretend you do not know how to do your own research, you have access to a vast amount of information.

Henry J · 27 October 2008

you are basically saying ‘gradients-did-it’.

Nah. What the gradient's do is provide something equivalent to a coordinate system, so that cells can react to their relative location within the body. When a gene reacts to the gradients at it's location, it's somewhat analogous to reacting to map coordinates. (That's assuming that my understanding is reasonably close to correct.)

DS · 27 October 2008

And there you have it folks. It's going with the magic invisible hologram hypothesis. As I predicted over 1000 posts ago, it's just those pesky photons. Notice how the invisible magic hologram can work within the uterus but cannot possibly determine organ shape outside the body, truly amazing.

Seriously, either the mechanism works outside the body or the hologram hypothesis makes no predictions different from the chemical gradient model and the whole organogenesis argument becomes no more than another exercise in mental masturbation.

If anyone seriously doubts the importance of chemical gradients in fruit fly development, just read the textbook Molecular Cell Biology. There is a wonderful figure of the chemical gradients in the fruit fly embryo in the very first chapter. I would reproduce it here, but don't want to violate copyright laws. The chapter on development describes in detail how the gradients are established, how they affect gene expression and how they specify body segment and appendage identity. Naturally the troll is expressly forbidden from reading the book or educating itself in any way.

DS · 27 October 2008

For anyone who is really interested:

During development, diffusible ligands, known as morphogens, are thought to move across fields of cells, regulating gene expression in a concentration dependent manner. The case for morphogens has been convincingly made for the Decapentapleigic (Dpp), Wingless (Wg) and Hedgehog (Hh) proteins in the Drosophila wing. In each case, the concentration of the morphogen’s receptor plays an important role in shaping the morphogen gradient, through influencing ligand transport and/or stability. However, the relationships between each ligand/receptor pair are different. The role of heparan sulfated proteoglycans, endocytosis and novel exovesicles called argosomes in regulating morphogen distribution will also be discussed.

Cadigan, K.M. (1998) Regulating morphogen gradients in the Drosophila wing. Seminbars in Vell and Developmental Biology 13(2):125.

Anybody got a reference for the invisible holgram hypothesis?

DS · 27 October 2008

That should be:

Seminars in Cell and Developmental Biology

DaveH · 27 October 2008

Henry J said: Was Eliza ever meant to do that? ;)
Why do you ask was Eliza ever meant to do that? ;-)

cobby · 27 October 2008

DS said: For anyone who is really interested: During development, diffusible ligands, known as morphogens, are thought to move across fields of cells, regulating gene expression in a concentration dependent manner. The case for morphogens has been convincingly made for the Decapentapleigic (Dpp), Wingless (Wg) and Hedgehog (Hh) proteins in the Drosophila wing. In each case, the concentration of the morphogen’s receptor plays an important role in shaping the morphogen gradient, through influencing ligand transport and/or stability. However, the relationships between each ligand/receptor pair are different. The role of heparan sulfated proteoglycans, endocytosis and novel exovesicles called argosomes in regulating morphogen distribution will also be discussed. Cadigan, K.M. (1998) Regulating morphogen gradients in the Drosophila wing. Seminbars in Vell and Developmental Biology 13(2):125. Anybody got a reference for the invisible holgram hypothesis?
... well of course there are all sort of regulatory chemcials. but the mystery is how they know what shape to form.

cobby · 27 October 2008

PvM said:
cobby said: ... show me one and lets discuss it!
Pick any of the ones I shared with you. I do not really have any preferences.
... lets talk about one you have read

fnxtr · 27 October 2008

My thermos keeps hot liquids hot, and cold liquids cold. How does it know how to do that?

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said: .. First of all I cant believe someone would waste their time crticizing someones spelling and grammar here. i really an not concerned about that. i do this stuff in between what i am working on as a bit of diversion. i dont take it seriously.
SFB doesn't realize that his spelling and grammar are examples of his lack of knowledge. If he can not get simple grammar, spelling and even a single idea in to a sentence properly then there is far less credibility on anything he says. SFB has already admitted it is to hard for him to read anything on here over 2 paragraphs and scientific papers at all. SFB also can't bring himself to use spell check or even write at a second grade level. Is SFB the type of person you would take believe when he tries to talk on scientific matters?

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said: The “cake mold” for an organ comes not only from the chemical signals from cells forming into that organ but chemical signals from cells adjacent to that organ. ... nice belief but its just a guess. where are the experiments??
SFB you have been referred to numerous papers. Papers backed up by experiments. Many paper's experiments also replicated and independently verified. You have been pointed to those papers multiple times and out right refused to read them. You want to learn something then go back through the 1,900 odd posts and actually read them this time. When you come to a post that refers you to a paper take a glance at the paper. Can't read? Use a text to speech engine, one comes with XP and Vista. Until you do you are just a lying deceitful willfully ignorant arrogant troll.

cobby · 27 October 2008

Wayne Francis said:
SFB a.k.a. cobby said: The “cake mold” for an organ comes not only from the chemical signals from cells forming into that organ but chemical signals from cells adjacent to that organ. ... nice belief but its just a guess. where are the experiments??
SFB you have been referred to numerous papers. Papers backed up by experiments. Many paper's experiments also replicated and independently verified. You have been pointed to those papers multiple times and out right refused to read them. You want to learn something then go back through the 1,900 odd posts and actually read them this time. When you come to a post that refers you to a paper take a glance at the paper. Can't read? Use a text to speech engine, one comes with XP and Vista. Until you do you are just a lying deceitful willfully ignorant arrogant troll.
....Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336. .... end your ignorance and read the article!

cobby · 27 October 2008

...OK morons. hows the human femur know when to stop lengthening?

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said: . Astronomy is full of stuff that we will probably never “prove” experimentally. ... no wrong gain. what is this 'stuff'?
How neutron stars form. How accretion disks can form into planets. How black holes form. The photon sphere of a black hole. The CMBR being caused by the expansion of the universe. These, and many more, are all things we have learned often by falling out as prediction of other theories and later verified. Take the CMBR. It, the CMBR, falls out of the theory of inflation. It was predicted decades before it was found. When it was found it fit just as predicted. No "experiment" was done here. There was no "control" with a universe with no inflation that we could compare to our universe. Astronomy is a largely "observational science" http://en.wikipedia.org/wiki/Observational_science as opposed to experimental sciences like biology where we can knock out a gene and watch what happens. See SFB constantly claims that others are "wrong" without actually knowing anything about the topic. It is like SFB here claiming gravity doesn't exist because he can't understand the calculus that is used to predict its effect or even that calculus actually exists. Constantly making these types of statements is why SFB here is a willfully ignorant lying deceitful arrogant troll.

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said: Science can not “prove” anything. Science can give the best explanation that fits the data. .... evolution has not been proven? should that fact be taught in schools?
SFB shows how he is a deceitful nut job. Why single out evolution SFB? All we can do is rule out what something isn't in science. There will always be nut jobs that think that means their creationist ideas are right. Just like you can't prove that there are no pink unicorns you can not prove that tomorrow the sun will rise in the east. In fact quantum theory suggests that there is the possibility that it won't. Science just provides the best fitting answer it has at the time. General relativity could be wrong and if someone comes up with a theory that better fits the data then science will run with that. SFB is a creationist troll that would want everyone to think that evolution is on some type of shaky ground when it is not. Evolution is supported by many lines of evidence from many different branches of science. Geology, physics, anthropology, and of course every branch of the biological sciences just to name a few. SFB has yet to produce one shred of evidence to support his idea beyond the equivalent of him pulling the idea out of his ass and yelling "Look! Smell! Isn't my idea the best?!?!?" and ignores everyone that points out to him that his idea looks like, smells like and is a piece of shit. This is why SFB here is a willfully ignorant lying deceitful arrogant troll.

DS · 27 October 2008

Notice that the troll has moved the goal posts yet again. First it claimed that the chemical gradients were "unmeasurable" and "untestable". Now, forced once again to realize that it is wrong, it claims that the gradients actually do exist and can be measured but that they don't determine the shape of the wing. No alternative explanation for their function is offered of course. How hypocritical can you get?

Where is this mysterious hologram? How is it made? Why is it invisible? Why does it operate in the uterus and not outside the body? How does the hologram determine shape? Why is there absolutely no evidence for any of this nonsense? Who cares about the ravings of a deluded lunatic who accuses total strangers of being alcoholics instead of familarizing itself with the evidence? Man, if ignorance is bliss this troll should be the happiest guy around.

Wayne Francis · 27 October 2008

SFB a.k.a cobby said: Remember that I pointed out that the troll was arguing against it’s own position. It has now effectively proven that the instructions in DNA are soley responsible for producing an organism. ... I was just told nothing can be proven If those instructions are disrupted then the organs are usually not correctly produced, If however the instructions come from some “mysterious unknown factor” outside the body, then the organs should form just fine outside the body. ... no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape.
SFB actually makes a claim. I can show this claim to be false. If there was some type of "holographic construction" then you would not see people with 6 fully functioning fingers. You would not see science experiments where scientist can make a fruit fly grow legs where its antennas should be.
SFB a.k.a cobby said: ... you are basically saying 'gradients-did-it'. attributing the process to unmeasurable, untestable forces. aka pseudoscience.
I, and I'm sure many others, here wonder why SFB thinks they are "unmeasurable and untestable. They are very measurable that is why we know they are there. Scientist use a process call fate mapping to detect these gradients. Here is a nice paper with pretty pictures for pea brained SFB. http://dev.biologists.org/cgi/content/full/133/23/4613?maxtoshow=&HITS=10&hits=10&RESULTFORMAT=&fulltext=morphant&searchid=1&FIRSTINDEX=0&resourcetype=HWFIG Not only can we measure these gradients scientist often "turn off" genes that produce some of these gradients in a process called "knock out" tests and "test" what happens if the gradient is not present. In other cases the scientist may just amplify or suppress the effect of the gradient to "test" what the result is. SFB here once again shows his arrogance in thinking anyone should take his ideas seriously when he remains a lying deceitful and willfully ignorant troll.

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said: It currently takes more energy to produce fusion here on earth artificially then the reaction produces. ... the above has been demonstrated several times not to be true. please study much harder.
SFB once again makes an unsupported claim. Notice how I provided reference to what I said and he provides nothing but shit from his ass. Honestly if Fusion power where viable it would be used. Even if you believe there is a conspiracy with the oil companies to stop these power stations from being built places like China would not be stopped. In the next 20 years China be generating 160GW of power from nuclear a process that is expensive due to the fuel requirements. The fuel for fusion is much easier to obtain and poses much less of a problem in many areas, IE to turn off a fusion reactor you just cut the power and the fusion will stop. China will go down this road when it becomes viable as they are not as worried about oil companies as the US government. So SFB show me your evidence. Oh that is right you don't have any. SFB's evidence for currently viable fusion is just like his evidence for some mysteriously unknown "information" needed for development. There is no evidence.

Wayne Francis · 27 October 2008

Henry J said:

SFB aka Jobby said:you are basically saying ‘gradients-did-it’.

Nah. What the gradient's do is provide something equivalent to a coordinate system, so that cells can react to their relative location within the body. When a gene reacts to the gradients at it's location, it's somewhat analogous to reacting to map coordinates. (That's assuming that my understanding is reasonably close to correct.)
Oh you've done it now. SFB is going to claim you said that there is a street directory in each cell that we need to find! SFB does not understand analogies. He doesn't actually understand anything. He is how ever fun to play with. I actually enjoy spending 5 minutes to grab data easily available on the net to show how every statement SFB makes is totally wrong. Though he did catch me in a post where I was doing 2 things at once. I was listening to a paper about a deflectograph survey and the calibration of the sensors when I was typing. So celebration became calibration. Funny mistake and I didn't proof read my post before posting. Of coarse that is one mistake I've made. He seems to be able to cram in 3 different type of mistakes into one sentence. Your understanding seems to be the same as mine and, from what I see, every credible scientist out there that has commented on this. Hell even the creationist don't try to say that DNA isn't enough just that the DNA had to be specially created by their "God".

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: The “cake mold” for an organ comes not only from the chemical signals from cells forming into that organ but chemical signals from cells adjacent to that organ. ... nice belief but its just a guess. where are the experiments??
SFB you have been referred to numerous papers. Papers backed up by experiments. Many paper's experiments also replicated and independently verified. You have been pointed to those papers multiple times and out right refused to read them. You want to learn something then go back through the 1,900 odd posts and actually read them this time. When you come to a post that refers you to a paper take a glance at the paper. Can't read? Use a text to speech engine, one comes with XP and Vista. Until you do you are just a lying deceitful willfully ignorant arrogant troll.
....Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336. .... end your ignorance and read the article!
And this paper support anything you've said how? SFB throws out a reference to a paper hoping no one would even follow this up. Unlike all of us that explain the current scientific point of view and how the papers support that point of view SFB throws out a reference to a paper that does not support his view at all but hopes no one will actually follow it up. This is exactly what he did with the article talking about "growing" which did not support his view and actually supported what I posted. This is why SFB is a lying deceitful arrogant and willfully ignorant troll.

tresmal · 27 October 2008

fnxtr said: My thermos keeps hot liquids hot, and cold liquids cold. How does it know how to do that?
Aliens have planted secret undetectable "information" in your thermos that tells it how to do that.

Wayne Francis · 27 October 2008

SFB aka cobby said: ...OK morons. hows the human femur know when to stop lengthening?
SFB again ignored earlier post pointing him in the right direction. Bones stop lengthening because certain proteins produced in larger quantities during puberty cause the cells in epiphyseal plates ossify. IE it is a genetic signal that the cells that are responsible for causing the bones to lengthen to stop that process and turn the cartilage they are in to form into bone. This is why people that have a genetic disorder that causes them to continually "grow" most often have puberty induced. What doctors do there is trick the body into entering the puberty stage causing a cascade of genetic signally pathways to occur which arrests the bone development. I know this will be totally lost on SFB. It didn't fit into a 5 word sentence so he probably lost interest before the first sentence was complete. If he was really interested in bone development he would look up Fibroblast Growth Factor (FGF) and Bone Morphogenic Proteins (BMP) to learn more but we know SFB is a willfully ignorant troll that really does not want to learn.

Wayne Francis · 27 October 2008

SFB a.k.a. cobby said:
PvM said:
SFB a.k.a. cobby said: ... show me one and lets discuss it!
Pick any of the ones I shared with you. I do not really have any preferences.
... lets talk about one you have read
We have gone down this path before. Next SFB will refuse to read said paper thus he will not be able to discuss said paper. He really is a willfully ignorant troll.

Henry J · 27 October 2008

My thermos keeps hot liquids hot, and cold liquids cold. How does it know how to do that?

Why, intelligent design, oblivously!!111!!!one!!

Why does it operate in the uterus and not outside the body? How does the hologram determine shape?

Obviously, the surrounding parts of the body somehow act as a lens directing those incoming photons. Outside the body, there's no lens. So they're!!111!!!eleven!! Henry

Wayne Francis · 27 October 2008

Any bets on SFB aka Cobby/Jobby/Bobby/Jacob actually producing any evidence of successful controlled fusion with a net surplus of power? I'm giving googolplex to 1 odds he won't. Pretty safe bet for me as there is no such evidence and until ITER comes online in 2016 we are stuck with JET which only produces 70% of the amount of power that is needed to produce the plasma in the first place.
The way ahead ... The success of JET, in terms of optimising plasma stability and confinement, has led to the design of the next step device - ITER. ITER is an international collaboration with seven partners (EU, Japan, USA, South Korea, Russia, China and India) - and is a more advanced, larger version of JET. It will be capable of producing 500MW of fusion power (ten times that needed to heat the plasma). In comparison, JET can only produce fusion power that is ~70% of the power needed to heat the plasma. The go-ahead to build ITER at Cadarache in France was given in June 2005. ITER will take ten years to build and should start to operate within a few years after that.

DS · 27 October 2008

Wayne wrote:

"I can show this claim to be false. If there was some type of “holographic construction” then you would not see people with 6 fully functioning fingers. You would not see science experiments where scientist can make a fruit fly grow legs where its antennas should be."

As already noted several times, the mere fact that mutations that alter chemical gradients and also alter morphology is strong evidence that those gradients in fact determine the morphology.

Unless of course the antennapedia mutation affects the hologram and not just the chemical gradient. But in that case the hologram is simply an unnecessary and redundant hypothesis that really isn't needed at all, so the troll loses again. That makes ninety eight times in a row in this thread alone.

Wayne Francis · 28 October 2008

DS said:
Wayne wrote: I can show this claim to be false. If there was some type of “holographic construction” then you would not see people with 6 fully functioning fingers. You would not see science experiments where scientist can make a fruit fly grow legs where its antennas should be.
As already noted several times, the mere fact that mutations that alter chemical gradients and also alter morphology is strong evidence that those gradients in fact determine the morphology. Unless of course the antennapedia mutation affects the hologram and not just the chemical gradient. But in that case the hologram is simply an unnecessary and redundant hypothesis that really isn't needed at all, so the troll loses again. That makes ninety eight times in a row in this thread alone.
I just had a chuckle. I was thinking of SFB, aka Jobby/Cobby/Jacob/Bobby, holographic idea. His "intelligent designer" controlling those holograms projected from outside of space some where. I can imagine it going down like this. Intelligent Designer Technician #1 : Hey what are those humans doing with those genes in that fruit fly I'm putting together? Don't they know they aren't used for anything? Intelligent Designer Technician #2 : Looks over at the holographic projection console and says "Stupid humans, they think they know everything" Intelligent Designer Technician #1 : Should I do anything about it? Intelligent Designer Technician #2 : Hmmmm, your working on the head right now? Intelligent Designer Technician #1 : Yea about to have the antennas form. Intelligent Designer Technician #2 : Hmmmm, try to freak the humans out. Stick some legs there instead. Intelligent Designer Technician #1 : Wow, great idea! How did you come up with that? Intelligent Designer Technician #2 : I don't know, I'm just a trickster at heart. Remember I'm the tech that invented the "six finger human", anyway I've got to go. My shift is over and the wife asked me to pick up some unicorn chow from the store on the way home. Intelligent Designer Technician #1 : Hey wait! Won't the boss get mad if I do this? I mean I'm not sticking to the bosses plan! Intelligent Designer Technician #2 : When was the last time you saw the boss? I don't think you have much to worry about. Have fun with it, I do.

Marek14 · 28 October 2008

I agree with everything you say, Wayne Francis, except for one thing:

"Cannot" is, indeed, the proper negative of "can". Not "can not".

cobby · 28 October 2008

Wayne Francis said:
SFB aka cobby said: ...OK morons. hows the human femur know when to stop lengthening?
SFB again ignored earlier post pointing him in the right direction. Bones stop lengthening because certain proteins produced in larger quantities during puberty cause the cells in epiphyseal plates ossify. IE it is a genetic signal that the cells that are responsible for causing the bones to lengthen to stop that process and turn the cartilage they are in to form into bone. This is why people that have a genetic disorder that causes them to continually "grow" most often have puberty induced. What doctors do there is trick the body into entering the puberty stage causing a cascade of genetic signally pathways to occur which arrests the bone development. I know this will be totally lost on SFB. It didn't fit into a 5 word sentence so he probably lost interest before the first sentence was complete. If he was really interested in bone development he would look up Fibroblast Growth Factor (FGF) and Bone Morphogenic Proteins (BMP) to learn more but we know SFB is a willfully ignorant troll that really does not want to learn.
... then how does the body know when to produce the ''certain proteins produced in larger quantities during puberty''?

cobby · 28 October 2008

Any bets on SFB aka Cobby/Jobby/Bobby/Jacob actually producing any evidence of successful controlled fusion with a net surplus of power?

... dummy, that was not the original question. learn to read.

cobby · 28 October 2008

…Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336.

.… end your ignorance and read the article!

.... please willfully ignorant trolls. read the article and quit being dumb

DS · 28 October 2008

I think I'll wait for the reference on the magic invisible hologram. Man that should be a good one. Very well kept secret after all.

SWT · 28 October 2008

cobby said: …Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336. .… end your ignorance and read the article! .... please willfully ignorant trolls. read the article and quit being dumb
I'm wondering why you think that this paper in any way supports anything you've posted here.

cobby · 28 October 2008

SWT said:
cobby said: …Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336. .… end your ignorance and read the article! .... please willfully ignorant trolls. read the article and quit being dumb
I'm wondering why you think that this paper in any way supports anything you've posted here.
have you read it??

SWT · 28 October 2008

cobby said:
SWT said:
cobby said: …Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336. .… end your ignorance and read the article! .... please willfully ignorant trolls. read the article and quit being dumb
I'm wondering why you think that this paper in any way supports anything you've posted here.
have you read it??
Yes. Have you?

Henry J · 28 October 2008

Wayne Francis replied to comment from Henry J | October 27, 2008 8:45 PM Oh you’ve done it now.

I've done something? Yay me!

DaveH · 28 October 2008

I've only read the abstract of Sater and Jacobson 1990, (not having a subscription to the Journal of Developmental Biology), but I have read a couple of papers that reference it. Serbedzija et al (Development 125, 1095-1101 (1998)) is a good one. What does jobbie think it's showing us?

Wayne Francis · 28 October 2008

SFB a.k.a. cobby said:
SWT said:
SFB a.k.a. cobby said: …Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336. .… end your ignorance and read the article! .... please willfully ignorant trolls. read the article and quit being dumb
I'm wondering why you think that this paper in any way supports anything you've posted here.
have you read it??
SFB probably thinks he is tricking people into wasting there time by reading a paper. SFB can't possibly understand that most of us don't consider learning something as a waste of time. Only SFB is afraid of learning something. SFB could prove me wrong by stating why he thinks that paper supports his view but then the sun could rise in the west tomorrow. I will not hold my breath for either situation. I see that SFB is trying to move the goal post about fusion. Big surprise there. SFB you should spend more time reading the bible and less time being a lying deceitful arrogant and willfully ignorant troll.
cobby said:
Wayne Francis said:
SFB aka cobby said: ...OK morons. hows the human femur know when to stop lengthening?
SFB again ignored earlier post pointing him in the right direction. Bones stop lengthening because certain proteins produced in larger quantities during puberty cause the cells in epiphyseal plates ossify. IE it is a genetic signal that the cells that are responsible for causing the bones to lengthen to stop that process and turn the cartilage they are in to form into bone. This is why people that have a genetic disorder that causes them to continually "grow" most often have puberty induced. What doctors do there is trick the body into entering the puberty stage causing a cascade of genetic signally pathways to occur which arrests the bone development. I know this will be totally lost on SFB. It didn't fit into a 5 word sentence so he probably lost interest before the first sentence was complete. If he was really interested in bone development he would look up Fibroblast Growth Factor (FGF) and Bone Morphogenic Proteins (BMP) to learn more but we know SFB is a willfully ignorant troll that really does not want to learn.
... then how does the body know when to produce the ''certain proteins produced in larger quantities during puberty''?
SFB must think that everything has to happen at once with DNA. I can see it now. We don't know how to control the ageing process so it must be controlled by his mysterious intelligent designer. SFB probably thinks "How does my body know to heal itself when I get cut" or "How do I know when I'm hungry" Nothing in SFB's world can work without Jesus his Lord and Saviour constantly tinkering with it.

Henry J · 28 October 2008

...how does the body know...

It doesn't know. The cells react to changes in their environment. They don't "know" to do that; it's a series of chemical reactions.

Eric Finn · 28 October 2008

DaveH said: I've only read the abstract of Sater and Jacobson 1990, (not having a subscription to the Journal of Developmental Biology), but I have read a couple of papers that reference it. Serbedzija et al (Development 125, 1095-1101 (1998)) is a good one. What does jobbie think it's showing us?
I believe it is freely online http://8e.devbio.com/article.php?id=18 Regards Eric

DaveH · 28 October 2008

Eric Finn said: I believe it is freely online http://8e.devbio.com/article.php?id=18 Regards Eric
Many thanks! Dave

DaveH · 28 October 2008

Ooops, that's just a citation as well. Interesting article, though.
Jobbie seems to be stuck in the 1920s!

Eric Finn · 28 October 2008

I apologize my loose googling.
The link I provided does not seem to link to the article in question. I am sorry.

Regards

Eric

Henry J · 28 October 2008

The link I provided does not seem to link to the article in question.

Don't be sorry; that article was interesting and readable to a non-expert.

cobby · 28 October 2008

DaveH said: Ooops, that's just a citation as well. Interesting article, though. Jobbie seems to be stuck in the 1920s!
... why do you think that??

cobby · 28 October 2008

… then how does the body know when to produce the ”certain proteins produced in larger quantities during puberty”?

... no anwer? or is your answer 'Godditit'??

cobby · 28 October 2008

“How do I know when I’m hungry"

.. actually there have been a lot of studies on what causes hunger. it is still a bit of a mystery. but they are honest scientists and admit the answer is elusive. unlike Darwinists.

cobby · 28 October 2008

“How does my body know to heal itself when I get cut”

.... this also has been studied. you act like these are silly questions. have you heard of hemophilia??

DaveH · 28 October 2008

cobby said: … then how does the body know when to produce the ”certain proteins produced in larger quantities during puberty”? ... no anwer? or is your answer 'Godditit'??
From Wikipedia: "Onset is associated with high GnRH pulsing, which precedes the rise in sex hormones, LH and FSH[4]. Exogenous GnRH pulses cause the onset of puberty.[5] Brain tumors which increase GnRH output may also lead to premature puberty.[6] The cause of this GnRH rise is contentious. Puberty begins consistently at around 47 kg for girls and 55 kg for boys. This dependence on bodyweight makes leptin a good candidate for causing GnRH rise. It is known that leptin has receptors in the hypothalamus[7] which synthesises GnRH. Furthermore, individuals who are deficient in the leptin pathway fail to initiate puberty[8]. The levels of leptin change in line with the onset of puberty, and then decline to adult levels." So it seems likely Fatdidit.

DaveH · 28 October 2008

cobby said: “How do I know when I’m hungry" .. actually there have been a lot of studies on what causes hunger. it is still a bit of a mystery. but they are honest scientists and admit the answer is elusive. unlike Darwinists.
Also partially leptins!

cobby · 28 October 2008

Puberty begins consistently at around 47 kg for girls and 55 kg for boys.

... then how does the body know what its weight is?? the real answer is they do not know

SWT · 28 October 2008

SWT said:
cobby said:
SWT said:
cobby said: …Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336. .… end your ignorance and read the article! .... please willfully ignorant trolls. read the article and quit being dumb
I'm wondering why you think that this paper in any way supports anything you've posted here.
have you read it??
Yes. Have you?
cobby, you must have missed this response. Have you read this paper? If so, why do you think that it is in any way supportive of anything you've posted here? Inquiring minds want to know!

cobby · 28 October 2008

Henry J said:

...how does the body know...

It doesn't know. The cells react to changes in their environment. They don't "know" to do that; it's a series of chemical reactions.
...i think you know what i meant. you are just trying to be silly. i think people can see how difficult you are trying to be.

cobby · 28 October 2008

cobby, you must have missed this response. Have you read this paper? If so, why do you think that it is in any way supportive of anything you’ve posted here?

Inquiring minds want to know!

... have YOU read the paper??

SWT · 28 October 2008

cobby said: cobby, you must have missed this response. Have you read this paper? If so, why do you think that it is in any way supportive of anything you’ve posted here? Inquiring minds want to know! ... have YOU read the paper??
I assume you meant this in response to my post above, since it was my text, not Henry J's, that you quoted. Since you seem to have missed my response and questions to you: YES, I HAVE READ IT. HAVE YOU READ IT? IF SO, WHY DO YOU THINK IT HELPS YOUR CASE?

PvM · 28 October 2008

And again Bobby has decided to let his ignorance reign. What foolish choice.
cobby said: cobby, you must have missed this response. Have you read this paper? If so, why do you think that it is in any way supportive of anything you’ve posted here? Inquiring minds want to know! ... have YOU read the paper??

PvM · 28 October 2008

Nope they believe that leptin, which is linked to 'weight' may be a candidate. Science hardly lets ignorance stop them from doing research. Unlike Bobby who believes ignorance is the best place to hide. Bobby asks how does the body knows, and believes that godditit is somehow an explanation while science uses logic and reason to determine what causes the link between body mass and onset of puberty. See the difference?
cobby said: … then how does the body know when to produce the ”certain proteins produced in larger quantities during puberty”? ... no anwer? or is your answer 'Godditit'??

DaveH · 28 October 2008

cobby said: Puberty begins consistently at around 47 kg for girls and 55 kg for boys. ... then how does the body know what its weight is?? the real answer is they do not know
No. The real answer is that you can't be bothered to do any research into the question. You are sat in a library, at a terminal with access to the WWW. Use that position, don't hog resources which you are unwilling to use!

cobby · 28 October 2008

DaveH said:
cobby said: Puberty begins consistently at around 47 kg for girls and 55 kg for boys. ... then how does the body know what its weight is?? the real answer is they do not know
No. The real answer is that you can't be bothered to do any research into the question. You are sat in a library, at a terminal with access to the WWW. Use that position, don't hog resources which you are unwilling to use!
... TRANSLATION: I DON'T KNOW.

cobby · 28 October 2008

PvM said: Nope they believe that leptin, which is linked to 'weight' may be a candidate. Science hardly lets ignorance stop them from doing research. Unlike Bobby who believes ignorance is the best place to hide. Bobby asks how does the body knows, and believes that godditit is somehow an explanation while science uses logic and reason to determine what causes the link between body mass and onset of puberty. See the difference?
cobby said: … then how does the body know when to produce the ”certain proteins produced in larger quantities during puberty”? ... no anwer? or is your answer 'Godditit'??
... i didnt say 'goddidit' why do you keep saying that. you must have a mental problem.

DS · 28 October 2008

So, no paper on holograms, no evidence for the hologram hypothesis. Instead the troll asks everyone else to read a paper that it hasn't read that doesn't support it's position. Why a thirty year old paper anyway?

And of course it hasn't answered any questions about the hologram hypothesis either. Where does it come from? Is there a separate hologram for the larval, pupal and adult stages? How does a hologram tell the cells to form a certain shape? How do the cells know what to do? What are all these gradients for if they don't have anything to do with development? Why do changes in the gradients affect wing shape if wing shape is determined by the hologram? Why can't anyone see this hologram? Does the hologram work in the dark? What intelligence is producing this hologram? Why does it care so much what shape a fly wing is? Are the photons processed in the magnetic field of the earth? And most importantly, who cares about a magic invisible hologram?

cobby · 28 October 2008

So, no paper on holograms, no evidence for the hologram hypothesis. Instead the troll asks everyone else to read a paper that it hasn’t read that doesn’t support it’s position. Why a thirty year old paper anyway?

... still applies

And of course it hasn’t answered any questions about the hologram hypothesis either. Where does it come from? Is there a separate hologram for the larval, pupal and adult stages?

How does a hologram tell the cells to form a certain shape? How do the cells know what to do?

... needs reseach

What are all these gradients for if they don’t have anything to do with development?

the follow the image

Why do changes in the gradients affect wing shape if wing shape is determined by the hologram?

Why can’t anyone see this hologram?

... same reason we cant see gravity

Does the hologram work in the dark?

... no

What intelligence is producing this hologram?

... not know

Why does it care so much what shape a fly wing is?

...not known

Are the photons processed in the magnetic field of the earth?

...photons arent involved

And most importantly, who cares about a magic invisible hologram?

...well obviously you do. its no more magic than graivity.

...any of the above questions can be applied to gravity

Henry J · 28 October 2008

And of course it hasn’t answered any questions about the hologram hypothesis either. Where does it come from? Is there a separate hologram for the larval, pupal and adult stages?...

He doesn't have to match your pathetic level of detail!!!!111!!!eleven!!!

DS · 28 October 2008

And there you have it folks. Chemical gradients are "unmeasurable" and "untestable" but the magic invisible hologram that doesn't use photons and doesn't work in the dark is a hypothesis that should be preferred. HA HA HA HA HA. Very funny. Next time you screw yourself into a light socket, forget the light socket.

Dave Lovell · 28 October 2008

cobby said: Does the hologram work in the dark? ... no Are the photons processed in the magnetic field of the earth? ...photons arent involved
A hologram that won't work in the dark, but doesn't use photons? Perhaps you could elaborate?

Malcolm · 28 October 2008

cobby said: So, no paper on holograms, no evidence for the hologram hypothesis. Instead the troll asks everyone else to read a paper that it hasn’t read that doesn’t support it’s position. Why a thirty year old paper anyway? ... still applies And of course it hasn’t answered any questions about the hologram hypothesis either. Where does it come from? Is there a separate hologram for the larval, pupal and adult stages? How does a hologram tell the cells to form a certain shape? How do the cells know what to do? ... needs reseach
I can just see the grant application now: "We were going to look further into the relationship between chemical gradients and embryo morphology, but some kid thinks that its all to do with invisible magic holograms. As such, we'd like to apply for a 3 million dollar grant to conduct a 3 year trial to determine what colour the invisible unicorns are."

Henry J · 28 October 2008

As such, we’d like to apply for a 3 million dollar grant to conduct a 3 year trial to determine what colour the invisible unicorns are.”

They're pink. You may now send me the three million. ;)

Wayne Francis · 28 October 2008

SFB a.k.a. cobby said: So, no paper on holograms, no evidence for the hologram hypothesis. Instead the troll asks everyone else to read a paper that it hasn’t read that doesn’t support it’s position. Why a thirty year old paper anyway? ... still applies And of course it hasn’t answered any questions about the hologram hypothesis either. Where does it come from? Is there a separate hologram for the larval, pupal and adult stages? How does a hologram tell the cells to form a certain shape? How do the cells know what to do? ... needs reseach What are all these gradients for if they don’t have anything to do with development? the follow the image Why do changes in the gradients affect wing shape if wing shape is determined by the hologram? Why can’t anyone see this hologram? ... same reason we cant see gravity Does the hologram work in the dark? ... no What intelligence is producing this hologram? ... not know Why does it care so much what shape a fly wing is? ...not known Are the photons processed in the magnetic field of the earth? ...photons arent involved And most importantly, who cares about a magic invisible hologram? ...well obviously you do. its no more magic than graivity. ...any of the above questions can be applied to gravity
OK, SFB is making a similar claim as the "infinite wave length" idea that creationist put forward a few years ago. SFB "hologram" doesn't use photons but can not work in the dark. So this "hologram" must need photons to get carried. While gravitons are predicted by the standard model SFB's "photonless, but dependent on photons, holograms" is predicted by nothing but SFB's chemically imbalanced brain. Also unlike gravitons, which fill a gap in our knowledge, these "undetectable holograms" does not fill any gap in our knowledge just a gap in SFB's knowledge. In fact in everyone else’s knowledge the “undetectable hologram” has to make a gap in our knowledge and brings up more questions like why it is needed when so far biochemical processes take care of everything we’ve looked at to include trigger mechanism. SFB shows how he is deceitful. If he made these statements 1900 posts ago then we could have just poked holes in his idea instead of attempting the impossible, to actually teach him anything. Few questions for SFB. you said it "...needs reseach". What is reseach? Is it some new scientific method that needs to be invented? you said "the follow the image" What does hell does that even mean? Was it just your brain misfiring again? you said "the same reason we cant see gravity" what is your aversion to using apostrophes in contractions? Is it against your religion? Also why do you think we can't "see gravity"? Will we ever "see gravity". If you know your "hologram" travels in the same manner that gravity does, which the current theory says is via virtual photons, and your "holograms" don't use photons then should you be talking to particle physicist too about their “standard model”? If your "holograms" does not work in the "dark" then why? Do the holograms need some type of photon soup to travel in? Are you bringing back an ether theory? If your holograms don't work in the dark then does this mean that having sex in a totally dark room is a form of birth control since the zygote will not start developing? How much "light" does the hologram need to do its job? You said "...photons arent involved" again what is it with you and apostrophes? Why don't you like to write properly? You said "...well obviously you do. its no more magic than graivity." what is this "graivity" you speak of. I've never hear of it. Could be magic for all I know. I haven't found one single paper on "graivity" Come on SFB, you are finally making some “testable” claims. Tell us more.

DaveH · 28 October 2008

cobby said: ... i didnt say 'goddidit' why do you keep saying that. you must have a mental problem.
Well, he's got you there, PvM. Jobbie has FAITH that the invisibletotallyundetectabledarklightphoton-and-evidence-freehologramofthegapsdidit! =)

cobby · 28 October 2008

DS said: And there you have it folks. Chemical gradients are "unmeasurable" and "untestable" but the magic invisible hologram that doesn't use photons and doesn't work in the dark is a hypothesis that should be preferred. HA HA HA HA HA. Very funny. Next time you screw yourself into a light socket, forget the light socket.
... you really do not understand much of this do you? i think i have been drastically over estimating the posters here.

cobby · 28 October 2008

... trying to explain anything other than the simplest concepts here is like trying to teach my dog algebra. a truly brainless bunch. nothing but jeers and gibberish

SWT · 28 October 2008

cobby said: ... trying to explain anything other than the simplest concepts here is like trying to teach my dog algebra. a truly brainless bunch. nothing but jeers and gibberish
Why don't you start by explaining why you think the Sater and Jacobson you cited is in any way supportive of any point you've tried to make here? If you've read the paper and it really does support any point you've tried to make, that shouldn't be too difficult. No jeers or gibberish, just a question about an article you cited.

tresmal · 28 October 2008

Jobby, the paper you asked us to read doesn't seem to be online. If I'm wrong can you provide a link?

I have read one of the articles that cite the paper and I have an hypothesis. Jobby caught the term "morphogenetic field" and assumed it was some sort of mysterioso phenomenon, therefore possibly something to do with his missing "information". In reality the gradients he is so dismissive of, explain the morphogenetic field.

Wayne Francis · 28 October 2008

SFB a.k.a. cobby said:
DS said: And there you have it folks. Chemical gradients are "unmeasurable" and "untestable" but the magic invisible hologram that doesn't use photons and doesn't work in the dark is a hypothesis that should be preferred. HA HA HA HA HA. Very funny. Next time you screw yourself into a light socket, forget the light socket.
... you really do not understand much of this do you? i think i have been drastically over estimating the posters here.
No one understand what the hell you are on about SFB. You don't explain almost anything, though your large post starts to clarify your idea some. Don't make the mistake of thinking we agree with your idea. Even with the little you have provided there are HUGE problems with it. It is like saying "rainbows didn't exist before the flood of Noah". This has HUGE implications as it means physics was radically different from the way it is now. So please tell us more about your idea so we can "understand" what you are trying to say but you should expect a wave of reasons your idea fails from multiple branches of science. At least now you are starting to make claims that can be tested instead of just waving your hands around and babbling nonsense. I commend you on that SFB.

Wayne Francis · 28 October 2008

SFB a.k.a. cobby said: ... trying to explain anything other than the simplest concepts here is like trying to teach my dog algebra. a truly brainless bunch. nothing but jeers and gibberish
SFB is projecting again. This is a real sign of delusions of grandeur on his part. I think SFB here thinks he's got a whole new model of the physics and biology that everyone should be following.

Wayne Francis · 28 October 2008

SWT said:
SFB a.k.a. cobby said: ... trying to explain anything other than the simplest concepts here is like trying to teach my dog algebra. a truly brainless bunch. nothing but jeers and gibberish
Why don't you start by explaining why you think the Sater and Jacobson you cited is in any way supportive of any point you've tried to make here? If you've read the paper and it really does support any point you've tried to make, that shouldn't be too difficult. No jeers or gibberish, just a question about an article you cited.
I predict SFB will do one of the following
  1. Ignore your post full stop
  2. Insult you without addressing your post
  3. Throw out a line from the paper that doesn't support anything he has said in hopes that lurkers will just believe that it some how supports SFB side
I'm doubtful on #3 though. It would require him to look at the paper long enough to cut and paste.

Henry J · 28 October 2008

nothing but jeers and gibberish

He who doesn't like jeers and gibberish should refrain from using them.

DS · 28 October 2008

Well now all the troll has to do is explain how mutations in DNA alter the hologram projector and how it can determine the shape of human organs in the uterus if it can't work in the dark. Of course I grow fruit flies in the dark all the time and they come out just fine, so I guess the magic invisible hologram doesn't affect wing shape after all.

I guess trying to con people with nonsense only works if the people are sufficiently ignorant. The troll picked the wrong audience to try to sell it's crapola to. Oh well, at least it can no longer contaminate any other threads with it's jumping monkey feces slinging. Man this nut job won't even read a paper it comes up with.

Malcolm · 28 October 2008

Henry J said:

As such, we’d like to apply for a 3 million dollar grant to conduct a 3 year trial to determine what colour the invisible unicorns are.”

They're pink. You may now send me the three million. ;)
Show me the studies! Then paraphrase what they say in two sentences. Each sentence to have a maximum of five words. Small ones. Huh! See, you just have faith!

Wayne Francis · 28 October 2008

SWT said:
SFB a.k.a. cobby said: ... trying to explain anything other than the simplest concepts here is like trying to teach my dog algebra. a truly brainless bunch. nothing but jeers and gibberish
Why don't you start by explaining why you think the Sater and Jacobson you cited is in any way supportive of any point you've tried to make here? If you've read the paper and it really does support any point you've tried to make, that shouldn't be too difficult. No jeers or gibberish, just a question about an article you cited.
I predict SFB will do one of the following
  1. Ignore your post full stop
  2. Insult you without addressing your post
  3. Throw out a line from the paper that doesn't support anything he has said in hopes that lurkers will just believe that it some how supports SFB side
I'm doubtful on #3 though. It would require him to look at the paper long enough to cut and paste.
Malcolm said:
Henry J said:

As such, we’d like to apply for a 3 million dollar grant to conduct a 3 year trial to determine what colour the invisible unicorns are.”

They're pink. You may now send me the three million. ;)
Show me the studies! Then paraphrase what they say in two sentences. Each sentence to have a maximum of five words. Small ones. Huh! See, you just have faith!
...the unicorn are pink. ...study harder. That is my attempt of being like SFB a.k.a. jobby/cobby/bobby/jacob.

Wayne Francis · 28 October 2008

That was odd. Sorry for the post merging with my last one.

fnxtr · 28 October 2008

Still more coherent than anything from Yobbo, Wayne. Of course it's not like Yobbo actually goes out of his way to, you know, explain anything, it's all just "Darwinism is insufficient", end of story.

Maybe he's afraid someone will steal and publish his ideas.

Can't wait for "study harder" to turn into "buy my book".

Wayne Francis · 29 October 2008

fnxtr said: Still more coherent than anything from Yobbo, Wayne. Of course it's not like Yobbo actually goes out of his way to, you know, explain anything, it's all just "Darwinism is insufficient", end of story. Maybe he's afraid someone will steal and publish his ideas. Can't wait for "study harder" to turn into "buy my book".
I think it would hurt my head to read SFB's book then it would to read The Electric Cosmos and there is a LOT of bad science in The Electric Cosmos

Eric Finn · 29 October 2008

Have you read it ?!
DS said: Man this nut job won't even read a paper it comes up with.
Reading papers is routine to scientists. If they are asked to read one or few papers that are claimed to contradict their position, they can do it easily. Have they read all of the papers that might be essential to their inquiry? No, they have not read all of them. Imagine, that all the published papers on e.g. the development of foetuses were stacked on one shelf. The right hand side would be moving at a great speed. According to the theory of relativity, when the speed reaches the speed of light, those papers can no more contain any information. Regards Eric

cobby · 29 October 2008

...OK the trolls were out in their usually ugly selves. But let recap thru all the crap. Well of course some how the dimensions of the pelvis could be stored in the DNA and then the 'gradients' could do their job and direct the construction of the femur. But again thru all their obfuscations the trolls still cannot explain how all that info can be contained in 750
MB. and again the science stopping trolls when presented with an idea like a morphic field that guides development which is supported by many mainstream scientists go thru their ritualistic pounding of chests, spitting and gritting their teeth. 'no new ideas here' they shout and spit.

... the anti-science trolls do not understand that somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.

... now of course there could be other storage methods in the DNA other than the 4 positions or the info could be obtained from an external source or done in a way yet unknown. but trolls. DNA IS NOT SACRED!. these trolls remind me of science fiction movie where the humans want to move some sort of rock statue of the sub-humans god and the sub-humans destroy everything in site in a spitting rage.

... the primal reaction of the trolls here gives away their emotional attachment to Darwinism and DNA. the hostility to new ideas is enormous. science can never move forward if criticism of the status quo is met with such primal aggression.

... no I will sit back and wait for the ritualistic spitting, cursing, and attacking by the anti-science trolls

Dan · 29 October 2008

cobby said: DNA IS NOT SACRED!.
No one said that DNA is sacred. RNA viruses exist that don't use DNA at all. And prions exist that contain neither DNA nor RNA. A complete set of human DNA, siting isolated in a test tube, will not develop into a human.

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said: ...OK the trolls were out in their usually ugly selves. But let recap thru all the crap. Well of course some how the dimensions of the pelvis could be stored in the DNA and then the 'gradients' could do their job and direct the construction of the femur. But again thru all their obfuscations the trolls still cannot explain how all that info can be contained in 750 MB. and again the science stopping trolls when presented with an idea like a morphic field that guides development which is supported by many mainstream scientists go thru their ritualistic pounding of chests, spitting and gritting their teeth. 'no new ideas here' they shout and spit. ... the anti-science trolls do not understand that somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere. ... now of course there could be other storage methods in the DNA other than the 4 positions or the info could be obtained from an external source or done in a way yet unknown. but trolls. DNA IS NOT SACRED!. these trolls remind me of science fiction movie where the humans want to move some sort of rock statue of the sub-humans god and the sub-humans destroy everything in site in a spitting rage. ... the primal reaction of the trolls here gives away their emotional attachment to Darwinism and DNA. the hostility to new ideas is enormous. science can never move forward if criticism of the status quo is met with such primal aggression. ... no I will sit back and wait for the ritualistic spitting, cursing, and attacking by the anti-science trolls
Yes let recap. It has been explained to SFB that comparing DNA to a computer program in a literal way is useless. It has been explained that morphology is a complex interaction of many biochemical processes SFB has been shown to outright lie numerous times and when he is exposed he either ignores it or says that he can’t believe anyone would waste their time in exposing his lies. SFB has been provided numerous papers, as he requested, explaining many of these process and he then refuses to read any of them. SFB has made numerous other scientific claims which have been showned to be false with references SFB claims he is right without ever providing any evidence. SFB tries to get PT posters to post answers to leading questions of his so that he can twist the words and quote mine. Then when it is pointed out that this is a well known common creationist technique he claims that we saying questions can’t be asked. SFB finally makes some testable claims about his idea and has been shown that his own ideas are not even self consistent to even a child in primary school. SFB claims persecution of ideas that he has apparently pulled out of his ass and expects to be treated with respect. SFB thinks that when I label him as an arrogant, deceitful, lying and wilfully ignorant troll that it is unjustified. So SFB, how does your holographic system work? Why doesn’t it work in the dark? Is having sex in the dark a method of birth control?

cobby · 29 October 2008

Wayne Francis said:
SFB a.k.a. cobby said: ...OK the trolls were out in their usually ugly selves. But let recap thru all the crap. Well of course some how the dimensions of the pelvis could be stored in the DNA and then the 'gradients' could do their job and direct the construction of the femur. But again thru all their obfuscations the trolls still cannot explain how all that info can be contained in 750 MB. and again the science stopping trolls when presented with an idea like a morphic field that guides development which is supported by many mainstream scientists go thru their ritualistic pounding of chests, spitting and gritting their teeth. 'no new ideas here' they shout and spit. ... the anti-science trolls do not understand that somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere. ... now of course there could be other storage methods in the DNA other than the 4 positions or the info could be obtained from an external source or done in a way yet unknown. but trolls. DNA IS NOT SACRED!. these trolls remind me of science fiction movie where the humans want to move some sort of rock statue of the sub-humans god and the sub-humans destroy everything in site in a spitting rage. ... the primal reaction of the trolls here gives away their emotional attachment to Darwinism and DNA. the hostility to new ideas is enormous. science can never move forward if criticism of the status quo is met with such primal aggression. ... no I will sit back and wait for the ritualistic spitting, cursing, and attacking by the anti-science trolls
Yes let recap. It has been explained to SFB that comparing DNA to a computer program in a literal way is useless. It has been explained that morphology is a complex interaction of many biochemical processes SFB has been shown to outright lie numerous times and when he is exposed he either ignores it or says that he can’t believe anyone would waste their time in exposing his lies. SFB has been provided numerous papers, as he requested, explaining many of these process and he then refuses to read any of them. SFB has made numerous other scientific claims which have been showned to be false with references SFB claims he is right without ever providing any evidence. SFB tries to get PT posters to post answers to leading questions of his so that he can twist the words and quote mine. Then when it is pointed out that this is a well known common creationist technique he claims that we saying questions can’t be asked. SFB finally makes some testable claims about his idea and has been shown that his own ideas are not even self consistent to even a child in primary school. SFB claims persecution of ideas that he has apparently pulled out of his ass and expects to be treated with respect. SFB thinks that when I label him as an arrogant, deceitful, lying and wilfully ignorant troll that it is unjustified. So SFB, how does your holographic system work? Why doesn’t it work in the dark? Is having sex in the dark a method of birth control?
.... yet another childish response.

DS · 29 October 2008

Somehow that seems strangly appropriate for comment 1984.

fnxtr · 29 October 2008

To paraphrase Arthur Dent, is this some new usage of the word 'childish' I wasn't previously familiar with?

I never knew 'childish' meant 'accurate/pithy' before.

SWT · 29 October 2008

Wayne Francis said:
SWT said:
SFB a.k.a. cobby said: ... trying to explain anything other than the simplest concepts here is like trying to teach my dog algebra. a truly brainless bunch. nothing but jeers and gibberish
Why don't you start by explaining why you think the Sater and Jacobson you cited is in any way supportive of any point you've tried to make here? If you've read the paper and it really does support any point you've tried to make, that shouldn't be too difficult. No jeers or gibberish, just a question about an article you cited.
I predict SFB will do one of the following
  1. Ignore your post full stop
  2. Insult you without addressing your post
  3. Throw out a line from the paper that doesn't support anything he has said in hopes that lurkers will just believe that it some how supports SFB side
I'm doubtful on #3 though. It would require him to look at the paper long enough to cut and paste.
Well ... so far, it would appear that you have a good model to predict the behavior of "cobby."

cobby · 29 October 2008

... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.

SWT · 29 October 2008

cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I've been asking for such a discussion. You suggested a paper by Sater and Jacobson would be worth reading and discussing. I read the paper and have entreated you -- multiple times! -- to explain why you think the paper supports any of your arguments. The ball's in your court -- put up or shut up.

PvM · 29 October 2008

Oh, the amount of irony and projection is just killing me... Remember that Bobby so far has refuse to discuss with any apparent intelligence or knowledge the various statements he has made about DNA, the genome and other aspects of biology. Worse, Bobby has violated the terms of this board and is in no position to make any demands...
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.

PvM · 29 October 2008

I guess, that's not exactly what Bobby had in mind when he made his claims. Why would he discuss something that shows how science contradicts his faith?
SWT said:
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I've been asking for such a discussion. You suggested a paper by Sater and Jacobson would be worth reading and discussing. I read the paper and have entreated you -- multiple times! -- to explain why you think the paper supports any of your arguments. The ball's in your court -- put up or shut up.

PvM · 29 October 2008

But again thru all their obfuscations the trolls still cannot explain how all that info can be contained in 750 MB.

— Jobby
That of course is a now oft repeated misrepresentation of fact.

cobby · 29 October 2008

PvM said: Oh, the amount of irony and projection is just killing me... Remember that Bobby so far has refuse to discuss with any apparent intelligence or knowledge the various statements he has made about DNA, the genome and other aspects of biology. Worse, Bobby has violated the terms of this board and is in no position to make any demands...
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
...PvM, I asked politely for trolls not to respond. Why did you?

Saddlebred · 29 October 2008

cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I would like to seriously discuss this. 1.) Did your hologram hypothesis come from the TV series Bones, or from the late 90's movie The Fifth Element, or is it from a third source which you could name here?

cobby · 29 October 2008

Saddlebred said:
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I would like to seriously discuss this. 1.) Did your hologram hypothesis come from the TV series Bones, or from the late 90's movie The Fifth Element, or is it from a third source which you could name here?
... go back to your room until you grow up.

cobby · 29 October 2008

SWT said:
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I've been asking for such a discussion. You suggested a paper by Sater and Jacobson would be worth reading and discussing. I read the paper and have entreated you -- multiple times! -- to explain why you think the paper supports any of your arguments. The ball's in your court -- put up or shut up.
... i have asked for things multiple times too. wait your turn, troll.

Saddlebred · 29 October 2008

cobby said: ... go back to your room until you grow up.
It was a serious question. From where is this idea drawn?

SWT · 29 October 2008

cobby said:
SWT said:
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I've been asking for such a discussion. You suggested a paper by Sater and Jacobson would be worth reading and discussing. I read the paper and have entreated you -- multiple times! -- to explain why you think the paper supports any of your arguments. The ball's in your court -- put up or shut up.
... i have asked for things multiple times too. wait your turn, troll.
And so the truth emerges: you don't want to discuss the paper after all. I'm disappointed (it's actually pretty interesting, and has some interesting references and a pretty good citation history), but I'm not surprised. I suggest the PT community keep this in mind the next time you show up here claiming you want to discuss a paper.

cobby · 29 October 2008

SWT said:
cobby said:
SWT said:
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I've been asking for such a discussion. You suggested a paper by Sater and Jacobson would be worth reading and discussing. I read the paper and have entreated you -- multiple times! -- to explain why you think the paper supports any of your arguments. The ball's in your court -- put up or shut up.
... i have asked for things multiple times too. wait your turn, troll.
And so the truth emerges: you don't want to discuss the paper after all. I'm disappointed (it's actually pretty interesting, and has some interesting references and a pretty good citation history), but I'm not surprised. I suggest the PT community keep this in mind the next time you show up here claiming you want to discuss a paper.
... sorry the demand for my comments is very high. you WILL have to wait your turn and when I have time to get to it.

DaveH · 29 October 2008

cobby said: ... sorry the demand for my comments is very high. you WILL have to wait your turn and when I have time to get to it.
Cobby, please discuss the Sater and Jacobson paper. Do the other posters agree?

Henry J · 29 October 2008

Do the other posters agree?

Does it matter whether others agree? ;)

DaveH · 29 October 2008

Henry J said: Does it matter whether others agree? ;)
Surely such an admirer of education, intelligence and the scientific method as cobby could not object to discussing a paper that he, himself, brought up? I think it would be only fair if we all agreed to focus on this one paper so that cobby can explain its significance. What do you say, folks? Just polite requests for a discussion instead of our dreadful, rude "trolling"

Saddlebred · 29 October 2008

DaveH said: Surely such an admirer of education, intelligence and the scientific method as cobby could not object to discussing a paper that he, himself, brought up? I think it would be only fair if we all agreed to focus on this one paper so that cobby can explain its significance. What do you say, folks? Just polite requests for a discussion instead of our dreadful, rude "trolling"
I am very interested in his assessment of the paper.

DS · 29 October 2008

Well we could all just discuss the paper and leave the troll out of the discussion. Sure why not? Once all the big sciency words come out it will be completely lost anyway. Of course then it couldn't complain any more about people not responding and not discussing something or other. After all, we're over 2000 posts now. Why not have a meaningful discussion that doesn't concern magic invisible holograms or pink unicorns or little blue devils?

Here, I'll get the discussion started. What proteins and genes are responsible for producing the morphogenic fields mentioned in the paper? How are these genes regulated? How did they study gene expression patterns back then before ectopic gene expression assays and genetic engineering of chimeric gene expression constructs were available? Has there been any more recent investigations of heart development using more sophisticated techniques? What progress has been made in the understanding of heart development in the last twenty years?

Corn cobby choose this reference a week ago and now claims he doesn't have time to discuss it. Who cares? We don't need it to discuss anything.

PvM · 29 October 2008

Because your behavior, which ironically matches that of a troll, indicates that you pretend to be willing to intelligently discuss a paper when history has shown that you have consistently refused to do so. As to asking politely, you demanded and as I explained, as someone who has violated the terms of this board, you have no rights to demand or even request.
cobby said: ...PvM, I asked politely for trolls not to respond. Why did you?

PvM · 29 October 2008

Of course, but bobby predictably will ignore your requests.
DaveH said:
cobby said: ... sorry the demand for my comments is very high. you WILL have to wait your turn and when I have time to get to it.
Cobby, please discuss the Sater and Jacobson paper. Do the other posters agree?

PvM · 29 October 2008

As expected, to Bobby anyone asking him to support his claims and intelligently discuss a paper must be a 'troll'. Figures.
cobby said:
SWT said:
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I've been asking for such a discussion. You suggested a paper by Sater and Jacobson would be worth reading and discussing. I read the paper and have entreated you -- multiple times! -- to explain why you think the paper supports any of your arguments. The ball's in your court -- put up or shut up.
... i have asked for things multiple times too. wait your turn, troll.

Malcolm · 29 October 2008

cobby said: ...OK the trolls were out in their usually ugly selves. But let recap thru all the crap. Well of course some how the dimensions of the pelvis could be stored in the DNA and then the 'gradients' could do their job and direct the construction of the femur. But again thru all their obfuscations the trolls still cannot explain how all that info can be contained in 750 MB. and again the science stopping trolls when presented with an idea like a morphic field that guides development which is supported by many mainstream scientists go thru their ritualistic pounding of chests, spitting and gritting their teeth. 'no new ideas here' they shout and spit. ... the anti-science trolls do not understand that somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
I think that that shows the crux of the troll's problem. It saw the term morphogenic field, and not knowing what a chemical gradient does, assumed it was some kind of hologram. Either that, or it was just quoting the invisible unicorns of as yet indeterminate colour.

Henry J · 29 October 2008

It saw the term morphogenic field, and not knowing what a chemical gradient does, assumed it was some kind of hologram.

Well, then we should be looking for signs of lasers and mirrors in or around the cells? :)

DS · 29 October 2008

The abstract:

We have examined the spatial restriction of heart-forming potency in Xenopus laevis embryos, using an assay system in which explants or explant recombinates are cultured
in hanging drops and scored for the formation of a beating heart. At the end of neurulation at stage 20, the heart morphogenetic field, i.e., the area that is capable of heart formation when cultured in isolation, includes anterior ventral and ventrolateral mesoderm. This area of developmental potency does not extent into more posterior regions. Between postneurula stage 23 and the onset of heart morphogenesis at stage 28, the heart morphogenetic field becomes spatially restricted to the anterior ventral region. The restriction of the heart morphogenetic field during postneurula stages results from a loss of developmental potency in the lateral mesoderm, rather than from ventrally directed morphogenetic movements of the lateral mesoderm. This loss of potency is not due to the inhibition of heart formation by migrating neural crest cells. During postneurula stages, tissue interactions between the lateral mesoderm and the underlying anterior endoderm support the heart-forming potency in the lateral mesoderm. The lateral mesoderm loses the ability to respond to this tissue interaction by stages 27-28. We speculate that either formation of the third pharyngeal pouch during stages 23-27 or lateral inhibition by ventral mesoderm may contribute to the spatial restriction of the heart morphogenetic field.

PvM · 29 October 2008

the anti-science trolls do not understand that somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.

— Bobby
What a fascinating display of ignorance compounded by Bobby's reluctance to familiarize himself with how science explains these issues. Ignorance surely leads to more and more foolish claims. Fascinating

PvM · 29 October 2008

Again Bobby shows that he is, contrary to his claims, unwilling to discuss the paper.
cobby said: cobby, you must have missed this response. Have you read this paper? If so, why do you think that it is in any way supportive of anything you’ve posted here? Inquiring minds want to know! ... have YOU read the paper??

DS · 29 October 2008

Sorry, forgot the reference for the above abstract:

Dev. Bio. (1990) 140:328-336

Of course we have learned a great deal about vertebrate heart development since then. It is after all a rather important topic, medically speaking. For anyone who is really interested, here are a few more references from more recent articles on frog heart development:

Dev. Bio. (1994) 165:432-441
Dev. Genet. (1998) 22:230-238
Devlopment (1999) 126:1739-1751
Dev. Bio. (2000) 218:74-88
Sem. Cell Dev. Bio. (2007) 18:46-53

Funny. all of these seem to concern protein gradients created by cascades of gene expression. No mentoion of holograms, unicorns or blue devils. And they all seem to work in the dark. Go figure.

PvM · 29 October 2008

Just google holograph and morphogenetic and you can see how Bobby got 'confused' Fascinating...
DS said: Sorry, forgot the reference for the above abstract: Dev. Bio. (1990) 140:328-336 Of course we have learned a great deal about vertebrate heart development since then. It is after all a rather important topic, medically speaking. For anyone who is really interested, here are a few more references from more recent articles on frog heart development: Dev. Bio. (1994) 165:432-441 Dev. Genet. (1998) 22:230-238 Devlopment (1999) 126:1739-1751 Dev. Bio. (2000) 218:74-88 Sem. Cell Dev. Bio. (2007) 18:46-53 Funny. all of these seem to concern protein gradients created by cascades of gene expression. No mentoion of holograms, unicorns or blue devils. And they all seem to work in the dark. Go figure.

SWT · 29 October 2008

DS said: ... Funny. all of these seem to concern protein gradients created by cascades of gene expression. No mentoion of holograms, unicorns or blue devils. And they all seem to work in the dark. Go figure.
Shocking, isn't it? Who could have anticipated that development appears to be controlled by gene expression?

cobby · 29 October 2008

I can walk you thru all of this if you have the patience. Go to my first mention of the word holograph etc. And read carefully! Actually I do not think any one is really trying to have an academic conversation. Really seems like trolls with too much time on their hands. The new literature supports what I am getting at. The trolls have still not come up with studies to support their claims. If the trolls could read well they would see that I did not claim that holograms store info. Trolls go back and read very slowly what I said. I think if you read it several times you might be able to understand it.

DS · 29 October 2008

Just be patient guys. In another month and another 2000 posts the troll of many names will definately:

stop making jumping monkey jokes

stop complaining about foul language

stop accusing total strangers of being pedophiles and alcoholics

read all papers recommended (even the ones it recommended)

come up with at least one reference that acutally supports it's claims

stop making up self-contridictory nonsense with no evidence whatsoever

admit that proteins aren't just "bricks"

admit that chemicals gradients are measurable and testable

quit yanking your chain and admit it really doesn't have a clue

After it does all that, I guess someone might be interested in something it tries to explain, but I know it won't be me. Destroying your credibility has consequences. TIme for the troll to pay.

cobby · 29 October 2008

DS said: Just be patient guys. In another month and another 2000 posts the troll of many names will definately: stop making jumping monkey jokes stop complaining about foul language stop accusing total strangers of being pedophiles and alcoholics read all papers recommended (even the ones it recommended) come up with at least one reference that acutally supports it's claims stop making up self-contridictory nonsense with no evidence whatsoever admit that proteins aren't just "bricks" admit that chemicals gradients are measurable and testable quit yanking your chain and admit it really doesn't have a clue After it does all that, I guess someone might be interested in something it tries to explain, but I know it won't be me. Destroying your credibility has consequences. TIme for the troll to pay.
... you sound very bitter. why do you waste you precious time tearing me down?

cobby · 29 October 2008

... again if anyone wants to intelligently talk about these things please respond. trolls please do not respond. thank you.

cobby · 29 October 2008

Spectrin and ankyrin are two essential proteins acting like bricks and mortar to shape and fortify cell membranes. But distinguishing which protein is the brick and which is the mortar has turned out to be difficult. New evidence suggests that spectrin can do both jobs at once.

Ron Dubreuil, associate professor of biological sciences at the University of Illinois at Chicago, reports the finding in the Oct. 23 issue of the Journal of Cell Biology.

... someelse thinks proteins are 'bricks'. you trolls looks so petty and foolish!

cobby · 29 October 2008

.. I have to admit. I am a bit guilty in feeling so much smarter than these trolls. its a bit of a guilty indulgence. but its just so easy. i wish one could give me a little challenge. oh well

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: .... But let recap thru all the crap. ....
Yes let recap. It has been explained to SFB that comparing DNA to a computer program in a literal way is useless. It has been explained that morphology is a complex interaction of many biochemical processes SFB has been shown to outright lie numerous times and when he is exposed he either ignores it or says that he can’t believe anyone would waste their time in exposing his lies. SFB has been provided numerous papers, as he requested, explaining many of these process and he then refuses to read any of them. SFB has made numerous other scientific claims which have been showned to be false with references SFB claims he is right without ever providing any evidence. SFB tries to get PT posters to post answers to leading questions of his so that he can twist the words and quote mine. Then when it is pointed out that this is a well known common creationist technique he claims that we saying questions can’t be asked. SFB finally makes some testable claims about his idea and has been shown that his own ideas are not even self consistent to even a child in primary school. SFB claims persecution of ideas that he has apparently pulled out of his ass and expects to be treated with respect. SFB thinks that when I label him as an arrogant, deceitful, lying and wilfully ignorant troll that it is unjustified. So SFB, how does your holographic system work? Why doesn’t it work in the dark? Is having sex in the dark a method of birth control?
.... yet another childish response.
SFB here shows that he feels that accurate portrayal off events is childish. SFB expect people to ignore his past behavior and treat him with the utmost respect every time he asks a question but has never shown anyone any respect in the past and shows no sign of treating anyone with any respect in the future. Notice how SFB ignored my questions. SFB finally made some claims that where not so vague that they could be addressed easily. Unfortunately for SFB when he does not understand a topic and pull conflicting ideas from his posterior region and start throwing them around he has to expect people to call him on it. Not only have we called him on it we've explained why his own idea are internally inconsistent. So for pointing his mistakes out he thinks we are childish trolls.

cobby · 29 October 2008

So for pointing his mistakes out he thinks we are childish trolls.

... no i think you are childish for not sticking to the subject and having these tantrums. why would a grown man waste so much time just tearing apart another person

... lets stick to debating the issue. can you do that, troll?

cobby · 29 October 2008

Is having sex in the dark a method of birth control?

... here is an example of the childishness. really sounds so junior high

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
Translation : ... if there is anyone posting here that is as ignorant of science and arrogant as I am, that would not disagree with anything I say please respond here. Intellectuals : please go else where and $&*# off.
The facts are SFB has been asked to discuss topic he himself has brought up time and time again. But when he either realizes that he's been fully refuted or when he just can't shovel the bovine excrement any more he either ignores the posters or tells them he doesn't have the time. So SFB:
  1. Why does your "Magical Hologram Hypothesis" not work in the dark?
  2. Does this mean that if I have sex with my girlfriend in a dark room she can not get pregnant?
  3. Why do you think that protein gradients do not work in 3d?
  4. Why have you never been willing to discuss any scientific paper, including ones that you, yourself, have picked?
  5. Why do you make claims then in later posts claim that you never said those claims?
I, of coarse, don't expect you to answer any of these questions because they expose your ignorance, arrogance and lying behavior. I fully expect you to either call me an alcoholic or just ignore me. Come on and surprise me and answer just one of the questions and back up your answer.

Wayne Francis · 29 October 2008

cobby said:
PvM said: Oh, the amount of irony and projection is just killing me... Remember that Bobby so far has refuse to discuss with any apparent intelligence or knowledge the various statements he has made about DNA, the genome and other aspects of biology. Worse, Bobby has violated the terms of this board and is in no position to make any demands...
SFB a.k.a. cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
...PvM, I asked politely for trolls not to respond. Why did you?
Prediction of my born true. SFB doesn't want anyone that can and will show him to be wrong to speak.

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said:
SWT said:
SFB a.k.a. cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
I've been asking for such a discussion. You suggested a paper by Sater and Jacobson would be worth reading and discussing. I read the paper and have entreated you -- multiple times! -- to explain why you think the paper supports any of your arguments. The ball's in your court -- put up or shut up.
... i have asked for things multiple times too. wait your turn, troll.
Translation ... I have asked for things multiple time too, been answered and had my ignorance shown to the world. I'll avoid talking to you because you'll do the same to me.

Wayne Francis · 29 October 2008

Saddlebred said:
SFB a.k.a. cobby said: ... go back to your room until you grow up.
It was a serious question. From where is this idea drawn?
Ah see his definitions of words are not the same as the rest of the English speaking world Saddlebred. He expects respect not only without earning it but despite the fact that he has never shown anyone any respect. Anyone asking him any question about his idea that doesn't agree with him and shows his logic to be faulty will be treated in the manner shown above. SFB really would fit in with the likes of JAD, DaveScot and others. Maybe he should go over to UD. They might accept him more.

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said: ... sorry the demand for my comments is very high. you WILL have to wait your turn and when I have time to get to it.
Translation ... sorry the risk of me further exposing myself as an ignorant troll is to high. You'll have to wait forever as I fool myself into believing that I understand science better then all the scientist in the world combined.

cobby · 29 October 2008

1. Why does your “Magical Hologram Hypothesis” not work in the dark?

... i have not such theory
2. Does this mean that if I have sex with my girlfriend in a dark room she can not get pregnant?

... wow that was really beavis

3. Why do you think that protein gradients do not work in 3d?

... beavis when did i say that?
4. Why have you never been willing to discuss any scientific paper, including ones that you, yourself, have picked?

... lets discuss. you are the one making the beavisesque slams

5. Why do you make claims then in later posts claim that you never said those claims?

... well just cut and paste what i said.

( sounds like hes been drinking again. )

cobby · 29 October 2008

Wayne Francis said:
SFB a.k.a. cobby said: ... sorry the demand for my comments is very high. you WILL have to wait your turn and when I have time to get to it.
Translation ... sorry the risk of me further exposing myself as an ignorant troll is to high. You'll have to wait forever as I fool myself into believing that I understand science better then all the scientist in the world combined.
... he even had to cop my 'translation' schtick. no original thought. hes a burnout.

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said: I can walk you thru all of this if you have the patience. Go to my first mention of the word holograph etc. And read carefully! Actually I do not think any one is really trying to have an academic conversation. Really seems like trolls with too much time on their hands. The new literature supports what I am getting at. The trolls have still not come up with studies to support their claims. If the trolls could read well they would see that I did not claim that holograms store info. Trolls go back and read very slowly what I said. I think if you read it several times you might be able to understand it.
We understand what you wrote SFB. We don't agree with it. We've explained why we don't and you refuse to address it. Your idea is internally inconsistent and doesn't even match the real world in any way. We understand that your "hologram" isn't a storage medium but a "mold" projected from some other location. We've shown how your "hologram hypothesis" is lacking any merit. We can "read" it a million times. It will not become true on the second time we read it or the one millionth time we read it.

cobby · 29 October 2008

We’ve shown how your “hologram hypothesis” is lacking any merit.

... so what. dummy you missed the whole point. i DONT have a “hologram hypothesis”.

that was yet another invention of your pickled brain. you really ought to get off the sauce because it is ruining you ability to read. put the beer down and go back to my original statement on hologr* and pasted it here and lets talk about it.

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said:
DS said: Just be patient guys. In another month and another 2000 posts the troll of many names will definately: stop making jumping monkey jokes stop complaining about foul language stop accusing total strangers of being pedophiles and alcoholics read all papers recommended (even the ones it recommended) come up with at least one reference that acutally supports it's claims stop making up self-contridictory nonsense with no evidence whatsoever admit that proteins aren't just "bricks" admit that chemicals gradients are measurable and testable quit yanking your chain and admit it really doesn't have a clue After it does all that, I guess someone might be interested in something it tries to explain, but I know it won't be me. Destroying your credibility has consequences. TIme for the troll to pay.
... you sound very bitter. why do you waste you precious time tearing me down?
SFB seems to lack the ability to understand humor and sarcasm. Because you're little brain couldn't understand the joke above SFB I'll explain it in tiny words. We are laughing at you. Sorry I had to use a word over 3 letters in that sentence. It is not a waste of time tearing you down. Shedding light on the darkness of ignorance is a noble act and I'll gladly continue doing it.

cobby · 29 October 2008

Because you’re little brain couldn’t understand the joke above SFB I’ll explain it in tiny words.

... well you had to copy my 'translation' schtick. imitation is the sincerest form of flattery. you dont seem me imitating any thing clever that you do. well i guess that is impossible since you DONT do anything clever.

... go ahead try!

cobby · 29 October 2008

It is not a waste of time tearing you down. Shedding light on the darkness of ignorance is a noble act and I’ll gladly continue doing it.

... dummy you dont shed light by going into a rant. use some logic! ( his brain is pickled. )

cobby · 29 October 2008

.. i think i do this the same reason chess masters play 20 people at once. its hard to find good competition and doing 7 or 8 of these guys at once is the only way to make a level playing field here. of course i doing computer work in the interim.

cobby · 29 October 2008

i think wayne finally passed out. he doesnt have a tag team buddy tonite and he cant keep up

cobby · 29 October 2008

poor sot!

tresmal · 29 October 2008

Thanks for the abstract DS. I don't suppose that the paper itself is online? Anyway from the abstract I see nothing that supports jobby's views and much that is consistent with everybody elses. The hypothesis that jobby picked up on the term "morphogenetic field" and wrongly assumed it was some sort of unworldly entity supportive of his position seems to be confirmed. The fact that he won't explain why he thought this paper supported his claims or even acknowledge that other people here have read it also supports the hypothesis.
He seems to be getting a bit colicky. It must be time for his evening Thunderbird.

Wayne Francis · 29 October 2008

SFB a.k.a cobby said:
Ghost Protein Leaves Fresh Tracks In The Cell Spectrin and ankyrin are two essential proteins acting like bricks and mortar to shape and fortify cell membranes. But distinguishing which protein is the brick and which is the mortar has turned out to be difficult. New evidence suggests that spectrin can do both jobs at once. Ron Dubreuil, associate professor of biological sciences at the University of Illinois at Chicago, reports the finding in the Oct. 23 issue of the Journal of Cell Biology.
... someelse thinks proteins are 'bricks'. you trolls looks so petty and foolish!
SFB, who said proteins are can't be referred to as 'bricks'. What was said is that proteins are not only bricks but the mortar, builder, foreman, lumber mill, nail manufacturer and architect as well. Did you read the article at all. The article is saying it isn't as simple as just 'bricks' and 'mortar'. All it is saying is that when the the Spectrin protein was genetically altered to no stick to ankyrin it still worked as the frame of the cell walls. This is do to the fact that while ankyrin makes the bonds stronger it is a) not really needed and b) there are other proteins that can perform this function. I've told you before SFB, scientist use analogies all the time when talking to others. Analogies are a great tool in teaching. It seems to be only you that always have to take the analogy to far. For example typically builders lay bricks in a header bond pattern (brickwork bond composed entirely of overlapping headers.) Spectrin forms a hexagonal pattern. It is easier to say, when not talking to people in the field
Spectrin works like bricks on the inside of the cell wall and ankyrin works a bit like mortar and allows for doors and windows to be put in the cell wall.
rather then
In Spectrin binding, actin can bind to the ends of the spectrin tetramers allowing further binding to other spectrin molecules forming a hexagonal mesh on the inside of the plasma membrane . This membrane skeleton is bound to the plasma membrane via the adapter protein ankyrin which allows formation of ion channels, ion exchangers and ion transporters within the plasma membranes.
Just like when we say a flagellum is like motor. Yes it preforms the same function but the difference is in the details. Don't feel to bad SFB. Even people like Behe get analogies screwed up.
Kitzmiller v. Dover Area School District Trial transcript: Day 10 (October 17), AM Session, Part 2 .... The bacterial flagellum is quite literally an outboard motor that bacteria use to swim. ...
No it is not quite literally an outboard motor. The filament and hook are the only parts of the flagellum that are outside the cell. So the flagellum is more akin to a inboard motor. Does this really matter? Not when talking to a layman. They won't make that distinction. If you go read his whole explanation you'll also see he claims it could have no other purpose but he has been shown that most of the parts of the flagellum are found in other excretory system within cells. It is just that these systems ended up being used for motility. The point is you take the analogies to far.

Wayne Francis · 29 October 2008

cobby said: .. I have to admit. I am a bit guilty in feeling so much smarter than these trolls. its a bit of a guilty indulgence. but its just so easy. i wish one could give me a little challenge. oh well
Delusions of grandeur. It is like the idiot kid in 5th grade try to claim he plays foot ball better the a member of the Berkeley Bears.

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said:
I said: So for pointing his mistakes out he thinks we are childish trolls.
... no i think you are childish for not sticking to the subject and having these tantrums. why would a grown man waste so much time just tearing apart another person ... lets stick to debating the issue. can you do that, troll?
Because the issues include the fact that SFB keeps shoveling shit and when it gets up to his eyes he tries to climb out and start a new pile all while claiming he doesn't still smell like shit. How is that for an analogy for you SFB? We have all tried to stick to the issue but every time we show you to be wrong you just try to change the subject. So Please tell us why your "magical hologram hypothesis" does not work in the dark?

Wayne Francis · 29 October 2008

cobby said: Is having sex in the dark a method of birth control? ... here is an example of the childishness. really sounds so junior high
Why is this childish? It falls out from your claim that your magical hologram hypothesis is responsible for developmental biology and that your magical hologram hypothesis does not work in the dark. Are you just afraid of the subject of birth control and sex? Adults can talk about this stuff without giggling you know.

Stanton · 29 October 2008

Wayne Francis said:
cobby said: Is having sex in the dark a method of birth control? ... here is an example of the childishness. really sounds so junior high
Why is this childish? It falls out from your claim that your magical hologram hypothesis is responsible for developmental biology and that your magical hologram hypothesis does not work in the dark. Are you just afraid of the subject of birth control and sex? Adults can talk about this stuff without giggling you know.
He says you're childish, and yet, he's the one who thinks that shouting "jump, monkeys" is intelligent discourse.

PvM · 29 October 2008

Can you stick to debating the issues Bobby? So far the data point to a resounding 'NO'
cobby said: So for pointing his mistakes out he thinks we are childish trolls. ... no i think you are childish for not sticking to the subject and having these tantrums. why would a grown man waste so much time just tearing apart another person ... lets stick to debating the issue. can you do that, troll?

PvM · 29 October 2008

Does this mean Bobby is leaving the forum (ROTFL)
cobby said: ... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.

PvM · 29 October 2008

Chess masters who lose all their games do not last long Bobby...
cobby said: .. i think i do this the same reason chess masters play 20 people at once. its hard to find good competition and doing 7 or 8 of these guys at once is the only way to make a level playing field here. of course i doing computer work in the interim.

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said: 1. Why does your “Magical Hologram Hypothesis” not work in the dark? ... i have not such theory
SFB you do realize we can point others to your posts like
SFB says here … no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape.
SFB a.k.a. cobby said: 2. Does this mean that if I have sex with my girlfriend in a dark room she can not get pregnant? ... wow that was really beavis
You are avoiding the question.
SFB says here Does the hologram work in the dark? … no
My question just flows from your answer. If the hologram that controls development doesn't work in the dark then it logically follows that the dark would be a form of birth control unless you can come up with an exception to your hypothesis.
SFB a.k.a. cobby said: 3. Why do you think that protein gradients do not work in 3d? ... beavis when did i say that?
Well you claim that protein gradients can't control the shapes of organs. We say protein gradients control the shape of organs. You say they can't and that some holographic thing from an unknown source has to do it.
SFB a.k.a. cobby said: 4. Why have you never been willing to discuss any scientific paper, including ones that you, yourself, have picked? ... lets discuss. you are the one making the beavisesque slams
SFB is still avoiding talking about any paper including ones he has brought up because he keeps being shown to be wrong.
SFB a.k.a. cobby said: 5. Why do you make claims then in later posts claim that you never said those claims? ... well just cut and paste what i said. ( sounds like hes been drinking again. )
Everyone can go here where I first exposed you as being a liar, with over a dozen of your post, when you made the claim
SFB said … you must be hallucintating. where did I claim the storage was insufficient?

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said: We’ve shown how your “hologram hypothesis” is lacking any merit. ... so what. dummy you missed the whole point. i DONT have a “hologram hypothesis”. that was yet another invention of your pickled brain. you really ought to get off the sauce because it is ruining you ability to read. put the beer down and go back to my original statement on hologr* and pasted it here and lets talk about it.
I'm not sure what SFB thinks happens to his posts after he posts them. Does he think they magically turn into posts that make sense?
SFB says here … no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape.
SFB is the one that first brought up the hologram hypothesis and then stuck his foot in his mouth by making comments like
SFB says here Does the hologram work in the dark? … no
Now when people call him on his comments that are not even internally consistent, let alone how they are inconsistent with the real world, he gets all upset and claims we won't "discuss" the topic. We are, we are just not agreeing with him and we provide real reasons why.

Wayne Francis · 29 October 2008

SFB a.k.a. cobby said: i think wayne finally passed out. he doesnt have a tag team buddy tonite and he cant keep up
SFB shows he can't tell time anymore. That or he forgot in the last 5 days that I live on the other side of the world and that it is about noon here. Still waiting for SFB to actually discuss the problems with his hypothesis. My "rants" that explain in detail why his thought process is faulty are not being addressed by SFB. All we see is him waving his hands and claiming his greatness while everyone else just points and laughs at him.

Wayne Francis · 29 October 2008

PvM said: Chess masters who lose all their games do not last long Bobby...
cobby said: .. i think i do this the same reason chess masters play 20 people at once. its hard to find good competition and doing 7 or 8 of these guys at once is the only way to make a level playing field here. of course i doing computer work in the interim.
He is the kind of chess player that gets checkmated in 3 moves then when the winning player leaves he yells "See he's leaving because I'm to good of a player". You know I love analogies, they really help to deliver a point. If only SFB aka Jobby/bobby/cobby/jacob/etc could understand when the analogy actually breaks down when comparing it to the reals topic.

Wayne Francis · 29 October 2008

tresmal said: Thanks for the abstract DS. I don't suppose that the paper itself is online? Anyway from the abstract I see nothing that supports jobby's views and much that is consistent with everybody elses. The hypothesis that jobby picked up on the term "morphogenetic field" and wrongly assumed it was some sort of unworldly entity supportive of his position seems to be confirmed. The fact that he won't explain why he thought this paper supported his claims or even acknowledge that other people here have read it also supports the hypothesis.
He seems to be getting a bit colicky. It must be time for his evening Thunderbird.
I wouldn't mind looking at the paper also but it would be a few days before I could get to the uni library to look the paper up. Sadly I no longer work for a hospital and have access to all these journals online at my desk.

DS · 29 October 2008

So someone refers to two proteins as "bricks" and therefore, by the logic of the troll of many names, presto, all proteins thus become "bricks". Just priceless. What a waste of protoplasm this jerk is. It is truly a legend in it's own mind. No wonder no one here is intelligent enough to understand his imaginary hypothesis.

It also seems to be suffering from some advanced form of schizophrenia. I guess we could have deduced that from the number of times it has changed it's name. It can't seem to remember which side of the argument it is supposed to be on or to distiinguish analogy from reality. Of well, it was amusing for a while. Thanks to Wayne for documenting what a lying hypocrite it really is. Why does it think that everyone will forget everything it posted over the last month, just because it did?

I don't know if that entire article is available on line for free. Who cares? The troll hasn't read it and no one else needs to. We can all tell from the abstract that it is the same as all the other papers that describe the different genes that create the morphogenic gradients. Still, sex in the dark might not be a bad idea. At least if you don't try to use it as a method of birth control.

Henry J · 29 October 2008

Well, a few interesting things did manage to come up in the thread: gradients; morphogenetic fields; the mechanism that initiates puberty. On that last one, I wonder how that trigger is affected by differences in build (bone thickness)? Another question, do heavy kids tend to hit puberty earlier than thin kids?

Henry

Wayne Francis · 29 October 2008

Henry J said: Well, a few interesting things did manage to come up in the thread: gradients; morphogenetic fields; the mechanism that initiates puberty. On that last one, I wonder how that trigger is affected by differences in build (bone thickness)? Another question, do heavy kids tend to hit puberty earlier than thin kids? Henry
According to SFB aka Jobby they would. But the kid that had a problem with chromosome 12 that caused him to be as tall as an adult by the age of 8 didn't hit puberty. They had to induce it for him. Guess the Cobby's magic hologram couldn't focus on him when he hit the right weight.

PvM · 29 October 2008

Yes, Bobby seems to be easily confused by words rather than appreciate the paragraphs. Metaphors are just that...
DS said: So someone refers to two proteins as "bricks" and therefore, by the logic of the troll of many names, presto, all proteins thus become "bricks". Just priceless. What a waste of protoplasm this jerk is. It is truly a legend in it's own mind. No wonder no one here is intelligent enough to understand his imaginary hypothesis.

fnxtr · 29 October 2008

Another question, do heavy kids tend to hit puberty earlier than thin kids?
Yeah, that's what I started wondering too, Henry J. If not, why not? Or is it just correlation: kids tend to enter the weight range in question around the age of puberty? Is a puzzlement, as Yul Brynner would say. I was a *really* skinny kid but I don't think I developed any more slowly than my buddies. We never really discussed it, y'know...

Malcolm · 30 October 2008

I wonder what the troll thinks puts the bricks together, given that DNA only codes for proteins.

Maybe unseen monohorned ungulates of indeterminate colour put them together.

DaveH · 30 October 2008

fnxtr said:
Another question, do heavy kids tend to hit puberty earlier than thin kids?
Yeah, that's what I started wondering too, Henry J. If not, why not? Or is it just correlation: kids tend to enter the weight range in question around the age of puberty? Is a puzzlement, as Yul Brynner would say. I was a *really* skinny kid but I don't think I developed any more slowly than my buddies. We never really discussed it, y'know...
Although I don't have time to look up the references at the moment, IIRC it's more about amount of fat stored in adipose tissue - more leptin in circulation. Weight is just average, since all kids in a population are roughly the same size at the same age. So yes, obese kids hit puberty earlier. It's becoming quite noticeable in Western society

cobby · 30 October 2008

Well you claim that protein gradients can’t control the shapes of organs.

.... when did I claim that??

cobby · 30 October 2008

Still waiting for SFB to actually discuss the problems with his hypothesis

... what hypothesis is that? you really need to read things about 3 or 4 times so you do not get confused

cobby · 30 October 2008

I wonder what the troll thinks puts the bricks together, given that DNA only codes for proteins.

.... YOU tell ME.

cobby · 30 October 2008

… no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape.

.... so THIS is my 'theory'?? you trolls are pitiful!

Malcolm · 30 October 2008

cobby said: I wonder what the troll thinks puts the bricks together, given that DNA only codes for proteins. .... YOU tell ME.
You're the one making the claim that DNA is insufficient and that proteins are just bricks.

Wayne Francis · 30 October 2008

SFB a.k.a. cobby said: … no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape. .... so THIS is my 'theory'?? you trolls are pitiful!
Well you are the only person that is making this claim. You don't even see this claim on crack pot sites. So SFB, if you say something like the first part of that post and NO one else says it then yes, you win, it is your "hypothesis" let us not call it a theory.

cobby · 30 October 2008

and that proteins are just bricks.

... you are saying the proteins determine the shapes of organs? or are they just building blocks arranged by another method?

fnxtr · 30 October 2008

As I've noticed before, Yobbo, you are very careful never to clearly explain your theory/hypothesis/neurosis. That way you can still claim "I never said that".

...and responding to this with an "I know you are but what am I" won't change the above fact. I'm not arguing against the current standard model, you are. You need to present your perspective, clearly and completely. If you have the balls, which I doubt.

DS · 30 October 2008

Well if corn cobby disavows any knowledge of the hologram hypothesis, perhaps it can demonstrate where it stold the idea from. Then we can all evaluate the merits of this ground breaking hypothesis. It certainly can't claim that it never advanced the idea, since the peskly evidence is there for all to see.

Oh well, just another round of insanity from the schizophrenic, microcephalic, feces slinging chimpanzee. Perhaps there are really four or five posters using the cobby persona. If so, they really should read what the other ones write. Self contradiction is not a very good style of argumentation. Denying that you made claims on a thread with 70 pages of evidence is not going to work and reasking questions that have already been answered one hundred times is not going to fool anyone either. If it really wants an education, perhaps it should start by reading the recommended references.

Of course it could be the one that has the problems with alcoholism. I hear that does cause problems with short term memory loss in the advanced stages. Maybe Wayne will have the patience to find and repost all of the explanations and references for morphogenic fields that have been offered to the troll, I know I don't.

DaveH · 30 October 2008

http://www.ncbi.nlm.nih.gov/pubmed/16989801 http://www.ncbi.nlm.nih.gov/pubmed/18579682 Dear me, it still seems to be all gene interactions in limb development. Not one of these professional researchers into the question has even come close to the brilliant deduction of the ex-JHS teacher that
somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
Wow, 3 "somehow"s and a "somewhere"! Way to blind us with detail there, jobbie.

cobby · 30 October 2008

DS said: Well if corn cobby disavows any knowledge of the hologram hypothesis, perhaps it can demonstrate where it stold the idea from. Then we can all evaluate the merits of this ground breaking hypothesis. It certainly can't claim that it never advanced the idea, since the peskly evidence is there for all to see. Oh well, just another round of insanity from the schizophrenic, microcephalic, feces slinging chimpanzee. Perhaps there are really four or five posters using the cobby persona. If so, they really should read what the other ones write. Self contradiction is not a very good style of argumentation. Denying that you made claims on a thread with 70 pages of evidence is not going to work and reasking questions that have already been answered one hundred times is not going to fool anyone either. If it really wants an education, perhaps it should start by reading the recommended references. Of course it could be the one that has the problems with alcoholism. I hear that does cause problems with short term memory loss in the advanced stages. Maybe Wayne will have the patience to find and repost all of the explanations and references for morphogenic fields that have been offered to the troll, I know I don't.
... Dave, why do you waste so much time here?

PvM · 30 October 2008

Oh the irony...
cobby said: ... Dave, why do you waste so much time here?

PvM · 30 October 2008

Still struggling with science I notice. Why not read up on it during your time in front of your computer?
cobby said: and that proteins are just bricks. ... you are saying the proteins determine the shapes of organs? or are they just building blocks arranged by another method?

PvM · 30 October 2008

That's true, you have said a lot which you quickly seem to forget. It's ok...
cobby said: Well you claim that protein gradients can’t control the shapes of organs. .... when did I claim that??

PvM · 30 October 2008

Afraid to having any opinion of your own now that we have disproven most of your earlier positions as foolish ignorance?
cobby said: I wonder what the troll thinks puts the bricks together, given that DNA only codes for proteins. .... YOU tell ME.

cobby · 30 October 2008

PvM said: Oh the irony...
cobby said: ... Dave, why do you waste so much time here?
... you monkey trolls write more than me and spend more time here than I do x 10 just on this thread. you must have impovershed lives. i just write a quick quip here and there you trolls make this a part time job for yourselves. ...pvm. you simply cannot have a job

PvM · 30 October 2008

ROTFL, oh the irony...
cobby said:
PvM said: Oh the irony...
cobby said: ... Dave, why do you waste so much time here?
... you monkey trolls write more than me and spend more time here than I do x 10 just on this thread. you must have impovershed lives. i just write a quick quip here and there you trolls make this a part time job for yourselves. ...pvm. you simply cannot have a job

Henry J · 30 October 2008

Conclusion: people who know stuff sometimes talk more than people who don't actually have anything to say.

DS · 30 October 2008

Well I guess when you're schizophrenic you can demand that people have patience and then accuse them of spending too much time here. Oh well.

If anyone is still interested, here are two more articles with lots of pretty pctures of the "bricks" that control the shape of fruit fly wings:

Development (1993) 117:597-608

Genetics (2005) 171:625-638

These articles are freely available through pubmed. The troll could educate itself, but that seems highly unlikely. No evidence of any holograms, pink unicorns or blue devils, too bad.

cobby · 30 October 2008

Henry J said: Conclusion: people who know stuff sometimes talk more than people who don't actually have anything to say.
... empty barrels make the most noise?

cobby · 30 October 2008

DS said: Well I guess when you're schizophrenic you can demand that people have patience and then accuse them of spending too much time here. Oh well. If anyone is still interested, here are two more articles with lots of pretty pctures of the "bricks" that control the shape of fruit fly wings: Development (1993) 117:597-608 Genetics (2005) 171:625-638 These articles are freely available through pubmed. The troll could educate itself, but that seems highly unlikely. No evidence of any holograms, pink unicorns or blue devils, too bad.
... again altho a protein is a complex and amazing molecule it still is just a 'building block' or 'brick' in the whole body plan. of course you are just trolling.

Malcolm · 30 October 2008

cobby said:
DS said: Well I guess when you're schizophrenic you can demand that people have patience and then accuse them of spending too much time here. Oh well. If anyone is still interested, here are two more articles with lots of pretty pctures of the "bricks" that control the shape of fruit fly wings: Development (1993) 117:597-608 Genetics (2005) 171:625-638 These articles are freely available through pubmed. The troll could educate itself, but that seems highly unlikely. No evidence of any holograms, pink unicorns or blue devils, too bad.
... again altho a protein is a complex and amazing molecule it still is just a 'building block' or 'brick' in the whole body plan. of course you are just trolling.
I'm curious, troll, would you classify a caspase as a 'building block' or a 'brick'?

PvM · 30 October 2008

Still confused about biological science?
cobby said: ... again altho a protein is a complex and amazing molecule it still is just a 'building block' or 'brick' in the whole body plan. of course you are just trolling.

PvM · 30 October 2008

Now that is irony for yah
cobby said:
Henry J said: Conclusion: people who know stuff sometimes talk more than people who don't actually have anything to say.
... empty barrels make the most noise?

DS · 30 October 2008

Yea, transcription factors are just "bricks". Hox gene products are just "bricks". Enzymes are just "bricks". DNA polymerases and transposases and reverse transcriptases are just "bricks". Gated ion channels are just "bricks". Electron transport chains are just "bricks". Only someone with just "bricks" for brains would try to claim that. I guess the troll never read that textbook I recommended. Who would have thunk it?

Man, those pictures in those papers sure don't look like "bricks". Nothing that looks like a hologram either. The troll seems to have gone into the manic jumping monkey phase of it's bipolar disorder again. No longer desperate to explain it's nonexistent hypothesis, it now resorts again to taunting and name calling, accusing others of the behavior it alone exhibits.

Wayne Francis · 30 October 2008

DaveH said: http://www.ncbi.nlm.nih.gov/pubmed/16989801 http://www.ncbi.nlm.nih.gov/pubmed/18579682 Dear me, it still seems to be all gene interactions in limb development. Not one of these professional researchers into the question has even come close to the brilliant deduction of the ex-JHS teacher that
somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
Wow, 3 "somehow"s and a "somewhere"! Way to blind us with detail there, jobbie.
Thanks DaveH, going to listen to them now.

Wayne Francis · 30 October 2008

SFB a.k.a. cobby said:
PvM said: Oh the irony...
SFB a.k.a. cobby said: ... Dave, why do you waste so much time here?
... you monkey trolls write more than me and spend more time here than I do x 10 just on this thread. you must have impovershed lives. i just write a quick quip here and there you trolls make this a part time job for yourselves. ...pvm. you simply cannot have a job
We can see here how SFB tries the tactics of a 6 year old to try to stop people from exposing him as a arrogant deceitful willfully ignorant lying troll. SFB might write incomplete sentences with poor grammar but honestly it only takes a minute or 2 to reply to your posts. I very happily do my normal work while listening to music and science and psychology related material in the back ground. Maybe SFB struggles for so long to write a single sentence that he thinks it take 6 hours for one of us to write a reply. Why does SFB think it is a waste of time continually exposing SFB for the arrogant deceitful willfully ignorant lying troll that he is? It a bit like saying cleaning up the environment is a waste of time. To boot I'm sure almost all of us get a chuckle when you come out with some new idea that is not even self consistent let alone consistent with the real world. Keep it up SFB. Let us here you lie for Jesus again.
SFB a.k.a. cobby said:
DS said: Well I guess when you're schizophrenic you can demand that people have patience and then accuse them of spending too much time here. Oh well. If anyone is still interested, here are two more articles with lots of pretty pctures of the "bricks" that control the shape of fruit fly wings: Development (1993) 117:597-608 Genetics (2005) 171:625-638 These articles are freely available through pubmed. The troll could educate itself, but that seems highly unlikely. No evidence of any holograms, pink unicorns or blue devils, too bad.
... again altho a protein is a complex and amazing molecule it still is just a 'building block' or 'brick' in the whole body plan. of course you are just trolling.
Here is SFB's number one problem. He just can't get it through his head that proteins are more then just 'bricks' They are the concrete slab, the plumbing, the wiring, the builders, the nail gun, the steel frame, the foreman, the architect, the doors, the windows and even the people living in the house. SFB can't see how some proteins are responsible for binding, biogenesis, biological process regulation, cell adhesion, cell death, cell communication, cell motility, cytoskeleton, development, extracellular structure, nucleic acid binding, stimulus response, pathogenesis, translation and transcription regulator activity and transport. And these are just the ones I can rattle off the top of my head. Because SFB is locked in the mind of an intellectually handicapped child he won't ever get around his head that the analogies used by scientist are just teaching aids an that those analogies don't actually limit biological processes to just that analogy.

Wayne Francis · 30 October 2008

DS said: Yea, transcription factors are just "bricks". Hox gene products are just "bricks". Enzymes are just "bricks". DNA polymerases and transposases and reverse transcriptases are just "bricks". Gated ion channels are just "bricks". Electron transport chains are just "bricks". Only someone with just "bricks" for brains would try to claim that. I guess the troll never read that textbook I recommended. Who would have thunk it? Man, those pictures in those papers sure don't look like "bricks". Nothing that looks like a hologram either. The troll seems to have gone into the manic jumping monkey phase of it's bipolar disorder again. No longer desperate to explain it's nonexistent hypothesis, it now resorts again to taunting and name calling, accusing others of the behavior it alone exhibits.
Seems DS and I said the same think at the same time almost. I was just slightly slower. Well put DS but you know that there is a high probability that SFB is going to now quote mine you and say you claim proteins are 'just bricks'. Thankfully lurkers can read and won't be fooled by SFB's creationist tactics.

DS · 30 October 2008

Thanks for the links DaveH. I guess real scientists really do understand what controls bone shape after all, amazing. Just gene regualtion creating morphogenic fields after all.

Now, if the troll can explain how all the proteins involved are just "bricks" then I guess someone might take it seriously. Of course, this is the nut job that stated that "chemical gradients are only marginally effective" at determining the shape of structures. So I guess all the Hox gene products are just "bricks" as well. When it has demonstrated that it understands protein structure and function perhaps someone will care about what it has to say, but it won't be me.

cobby · 31 October 2008

DS said: Thanks for the links DaveH. I guess real scientists really do understand what controls bone shape after all, amazing. Just gene regualtion creating morphogenic fields after all. Now, if the troll can explain how all the proteins involved are just "bricks" then I guess someone might take it seriously. Of course, this is the nut job that stated that "chemical gradients are only marginally effective" at determining the shape of structures. So I guess all the Hox gene products are just "bricks" as well. When it has demonstrated that it understands protein structure and function perhaps someone will care about what it has to say, but it won't be me.
... yes Dave Stanton, proteins are just bricks: in this sense. a bottle full of proteins are not a human body anymore that a pile of bricks are a building. the point was that these building blocks have to be arranged in the correct pattern to function. it was an ANALOGY!. intelligence tests are based much on the ability of people to understand analogies. obviously you think when some one says ' the sun is the furnace of the solar system' you actually think the person means a furnace like in someones basement. you are an embarrassment

cobby · 31 October 2008

Stanton said: So, do you plan on ever producing any example where Creationists, Intelligent Design proponents or any other assorted evolution-denier groups, were able use the Scientific Method to put forth alternative scientific hypotheses that could explain biological, paleontological and or geological phenomena better than current scientific theories, or are you just going to continue on with your useless, yet snide babbling?

.... can you put forth a TESTABLE hypothesis for Darwinism??

DS · 31 October 2008

Once again the schizophrenic troll apes the behavior or real scientists, never realizing that it is displaying exactly the type of unsound reasoning that it ridicules. So "bricks" is an analogy huh? Yea, sure. And here I thought it meant that proteins were literally made of rock, no wonder no one can understand the ravings of this deranged lunatic, after all, it's just so much smarter than all the rest of humanity.

For anyone who has been paying attention, the point is that the analogy is fundamentally flawed and has led to an erroneous conclusion on the part of the troll of many names. Proteins are not a homogeneous asemblage of molecules. There ia an almost infinite variety of shapes sizes and functions for proteins. To try to pretend that they are all just "bricks" is like saying that insects are all "bad". If the troll ever gets around to reading the textbook I recommended, it is in for a big surprise.

I grow weary of wrestling with a mental midget, so here is a challenge for the troll. If it can describe in detail what transciption factors are, where they come from, how they are produced, what their structure is, what their function is and how they can reasonably be described as "bricks" in any meaningful sense of the word, then I will read every scientific reference on the hologram hypothesis. Until then, it can take it's flawed and simplistic analogy and it's delusions of grandeur and shove them up it's favorite orifice.

In the meantime, just ask yourself, why hasn't this genius explained how changes in DNA affect the hologram, or how it can work in the uterus if it doesn't work in the dark? This nut is truly a legend it it's own mind. I think it spends way too much time here trying to explain things it knows nothing about. That can't be healthy.

rog · 31 October 2008

Just a reminder, Cobby…Jacob has passive-aggressive disorder and should get some professional help.

Passive-aggressive behavior traits: Ambiguity, Avoiding responsibility by claiming forgetfulness, Blaming others, Chronic lateness and forgetfulness, Complaining, Does not express hostility or anger openly (e.g., expresses it instead by leaving notes), Fear of authority, Fear of competition, Fear of dependency, Fear of intimacy (infidelity as a means to act out anger): The passive aggressive often can’t trust. Because of this, they guard themselves against becoming intimately attached to someone., Fosters chaos, Intentional inefficiency, Making excuses, Losing things, Lying, Obstructionism, Procrastination, Resentment, Resists suggestions from others, Sarcasm, Stubbornness, Sullenness, Willful withholding of understanding

The last trait is especially diagnostic.

This thread has been confirmed that communication with him will be fruitless until he gets the help he needs.

PvM · 31 October 2008

Yes I am amazed that you are not familiar with the science involved.
cobby said: Stanton said: So, do you plan on ever producing any example where Creationists, Intelligent Design proponents or any other assorted evolution-denier groups, were able use the Scientific Method to put forth alternative scientific hypotheses that could explain biological, paleontological and or geological phenomena better than current scientific theories, or are you just going to continue on with your useless, yet snide babbling? .... can you put forth a TESTABLE hypothesis for Darwinism??

cobby · 31 October 2008

PvM said: Yes I am amazed that you are not familiar with the science involved.
cobby said: Stanton said: So, do you plan on ever producing any example where Creationists, Intelligent Design proponents or any other assorted evolution-denier groups, were able use the Scientific Method to put forth alternative scientific hypotheses that could explain biological, paleontological and or geological phenomena better than current scientific theories, or are you just going to continue on with your useless, yet snide babbling? .... can you put forth a TESTABLE hypothesis for Darwinism??
... well I feel I am. any testable hypotheses?? let the world know!

cobby · 31 October 2008

DS said: Once again the schizophrenic troll apes the behavior or real scientists, never realizing that it is displaying exactly the type of unsound reasoning that it ridicules. So "bricks" is an analogy huh? Yea, sure. And here I thought it meant that proteins were literally made of rock, no wonder no one can understand the ravings of this deranged lunatic, after all, it's just so much smarter than all the rest of humanity. For anyone who has been paying attention, the point is that the analogy is fundamentally flawed and has led to an erroneous conclusion on the part of the troll of many names. Proteins are not a homogeneous asemblage of molecules. There ia an almost infinite variety of shapes sizes and functions for proteins. To try to pretend that they are all just "bricks" is like saying that insects are all "bad". If the troll ever gets around to reading the textbook I recommended, it is in for a big surprise. I grow weary of wrestling with a mental midget, so here is a challenge for the troll. If it can describe in detail what transciption factors are, where they come from, how they are produced, what their structure is, what their function is and how they can reasonably be described as "bricks" in any meaningful sense of the word, then I will read every scientific reference on the hologram hypothesis. Until then, it can take it's flawed and simplistic analogy and it's delusions of grandeur and shove them up it's favorite orifice. In the meantime, just ask yourself, why hasn't this genius explained how changes in DNA affect the hologram, or how it can work in the uterus if it doesn't work in the dark? This nut is truly a legend it it's own mind. I think it spends way too much time here trying to explain things it knows nothing about. That can't be healthy.
... I read a few sentences of this and realized it was gibberish and moved on.

cobby · 31 October 2008

rog said: Just a reminder, Cobby…Jacob has passive-aggressive disorder and should get some professional help. Passive-aggressive behavior traits: Ambiguity, Avoiding responsibility by claiming forgetfulness, Blaming others, Chronic lateness and forgetfulness, Complaining, Does not express hostility or anger openly (e.g., expresses it instead by leaving notes), Fear of authority, Fear of competition, Fear of dependency, Fear of intimacy (infidelity as a means to act out anger): The passive aggressive often can’t trust. Because of this, they guard themselves against becoming intimately attached to someone., Fosters chaos, Intentional inefficiency, Making excuses, Losing things, Lying, Obstructionism, Procrastination, Resentment, Resists suggestions from others, Sarcasm, Stubbornness, Sullenness, Willful withholding of understanding The last trait is especially diagnostic. This thread has been confirmed that communication with him will be fruitless until he gets the help he needs.
... well I do waste hours responding to someone I think is a troll like the trolls here do. so who needs 'help'??

PvM · 31 October 2008

The world already knows. What a bummer to be left out isn't it. Especially when it is trivial to find examples of predictions by Darwinian theory. Ignorance of science cannot be an excuse. And while you may feel to be 'familiar with science', your history shows quite the opposite and not just that but also an unwillingness to familiarize yourself with the science involved. Instead, you are quick to reject any paper based on your non-understanding rather than on a careful analysis of its content.
cobby said:
PvM said: Yes I am amazed that you are not familiar with the science involved.
... well I feel I am. any testable hypotheses?? let the world know!

PvM · 31 October 2008

And thus Bobby accurately describes his position towards science.
cobby said: ... I read a few sentences of this and realized it was gibberish and moved on.

DS · 31 October 2008

TRANSLATION: I DON"T KNOW AND I DON'T WANT TO KNOW.

Well, if the troll can't even be bothered to learn what transcription factors are then perhaps it should just go away. After all, an uninformed opinon is worthless.

If anyone is really interested and doesn't already know, transcription factors are proteins that control the expression of genes. So, in the analogy they are not bricks, since they are not structural components. In the analogy they are the instructions for when to make which types of bricks and where. Other proteins are the brick makers and the brick transporters. Proteins control the brick makers and the brick layers. They direct the construction and assembly of the structural components.

Take heat shock proiteins for example. They are not produced until the organism undergoes heat stress. Then, certain transcription factors are produced that induce the production of proteins that are resistant to heat denaturation. The transcription factors are not structural components of the cell, indeed they are only produced under certain circumstances as a adaptive response. They are not "bricks" in any meaningful sense.

Of course the troll is incapable of reading any post over two sentences in length, even though it begs everyone to read it's deranged rantings over and over. No wonder it can't read an scientific paper. No wonder it doesn't know what transcription factors are. More is the pity. Oh well, at least some people are learning some things here.

Henry J · 31 October 2008

If I thought there was a chance somebody actually wanted a testable prediction of "Darwinism", I'd say something about nested hierarchies from multiple sources, geographic distribution of species, distribution of species in time, and maybe even correlations between genetic "distance" with fossil time lines, or that most traits (and proteins) are known to exist in a variety of forms in various species. But what would be the point?

Stanton · 31 October 2008

Henry J said: If I thought there was a chance somebody actually wanted a testable prediction of "Darwinism", I'd say something about nested hierarchies from multiple sources, geographic distribution of species, distribution of species in time, and maybe even correlations between genetic "distance" with fossil time lines, or that most traits (and proteins) are known to exist in a variety of forms in various species. But what would be the point?
Yes, especially since cobby/jobby/bobby/jacob/balanced/hamstrung/goff has already ignored/dismissed/illegally disqualified all of the other hundred+ examples we've already shown him in the past 7 to 8 months he's been infesting the site.

Robin · 31 October 2008

cobby said: ... well you had to copy my 'translation' schtick. imitation is the sincerest form of flattery. you dont seem me imitating any thing clever that you do. well i guess that is impossible since you DONT do anything clever.
Actually, it was my translation schtick that youcopied. Thanks for the flattery. And yes, we do see you imitating other people's clever things. It seems you have nothing clever (nevermind valid) to offer.

cobby · 31 October 2008

Robin said:
cobby said: ... well you had to copy my 'translation' schtick. imitation is the sincerest form of flattery. you dont seem me imitating any thing clever that you do. well i guess that is impossible since you DONT do anything clever.
Actually, it was my translation schtick that youcopied. Thanks for the flattery. And yes, we do see you imitating other people's clever things. It seems you have nothing clever (nevermind valid) to offer.
... no sorry, honey. it was my schtick! look it up.

cobby · 31 October 2008

nested hierarchies from multiple sources,

.... those prove natural selection can cause new phyla?? dont think so!

Robin · 31 October 2008

cobby said:
Robin said:
cobby said: ... well you had to copy my 'translation' schtick. imitation is the sincerest form of flattery. you dont seem me imitating any thing clever that you do. well i guess that is impossible since you DONT do anything clever.
Actually, it was my translation schtick that youcopied. Thanks for the flattery. And yes, we do see you imitating other people's clever things. It seems you have nothing clever (nevermind valid) to offer.
... no sorry, honey. it was my schtick! look it up.
LOL! First referenced used is by me on page 9 of this thread: Robin replied to comment from jobby | September 25, 2008 11:11 AM | Reply jobby said: The fact is, the information could be 1 byte in size. You don’t know, Jobo, so quit pretending that you know something that real scientists don’t. … one byte, one letter of the alphabet is enough info for even the design of a fingernail? you are totally ignorant. Translation: “I don’t have a rebuttal so I’ll just toss out the usual litany of insults and nonsensical statements.” Robin replied to comment from jobby | September 25, 2008 11:15 AM | Reply jobby said: Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development. .….feel free to post the names of real who are scientists who are studying the information space requirements for biological development. Translation: “I’ll toss out a burden of proof fallacy because I don’t have any evidence for my claim.” Yaaawwwnn. Clearly Jobob, your claim is erroneous.

PvM · 31 October 2008

They show how a nested hierarchy is an expected outcome of a Darwinian process. Nice to know that you, as expected, will, once again, move the goalposts. Of course, you have also been advised that science does not prove... Finally you may be interested in the opinion of Cambrian Expert Valentine who wrote "On the Origin of Phyla":

The title of this book, modeled on that of the greatest biological work ever written, is in homage to the greatest biologist who has ever lived. Darwin himself puzzled over but could not cover the ground that is reviewed here, simply because the relevant fossils, genes, and their molecules, end even the body plans of many of the phyla, were quite unknown in his day. Nevertheless, the evidence from these many additional sources of data simply confirm that Darwin was correct in his conclusions that all living things have descended from a common ancestor and can be placed within a tree of life, and that the principle process guiding their descent has been natural selection.

— Valentine
Always glad to be of service....
cobby said: nested hierarchies from multiple sources, .... those prove natural selection can cause new phyla?? dont think so!

fnxtr · 31 October 2008

Ya, but Yobbo's all about the "natural selection isn't enough" evasive tactic(never mind that his concrete skull is immune to the drilling everyone's been trying to deliver that no-one (currently here at least) said it was), without actually having the guts to say what he thinks does create new phyla. We've had hints of space aliens and holographic fields (probably from another dimension... maybe it's The Old Ones? Cthulhu?), but nothing you could actually call, say, an idea.

Henry J · 31 October 2008

One thing about "new phyla" - people stuck the label "phyla" on large taxonomic groups that have had on the order of a half billion years to diverge from each other. Had there been scientists to study them at the end of the Cambrian, they would probably have called them something equivalent to family or order, with "animal" being at that point a class in a phylum within the eukaryote domain.

That illustrates one major drawback to having an absolute rank system applied to clades; it obscures the fact that the beginning of a taxonomic group (below domain rank, anyway) was simply a speciation event, and at the time it happened it was no more dramatic than any speciation event today.

Henry

(Btw, "clades" and "speciation" aren't in the spell checker.)

Malcolm · 31 October 2008

Henry J said: One thing about "new phyla" - people stuck the label "phyla" on large taxonomic groups that have had on the order of a half billion years to diverge from each other. Had there been scientists to study them at the end of the Cambrian, they would probably have called them something equivalent to family or order, with "animal" being at that point a class in a phylum within the eukaryote domain. That illustrates one major drawback to having an absolute rank system applied to clades; it obscures the fact that the beginning of a taxonomic group (below domain rank, anyway) was simply a speciation event, and at the time it happened it was no more dramatic than any speciation event today. Henry (Btw, "clades" and "speciation" aren't in the spell checker.)
But Henry, to a creationist speciation is a dramatic event: Cats giving birth to dogs and all that.

cobby · 31 October 2008

Nevertheless, the evidence from these many additional sources of data simply confirm that Darwin was correct in his conclusions that all living things have descended from a common ancestor and can be placed within a tree of life, and that the principle process guiding their descent has been natural selection.

... again there is plenty of evidence that confirms the 'everything was created last thursday' hypothesis. you need a TEST that could possibly falsify. got one??

cobby · 31 October 2008

First referenced used is by me on page 9 of this thread:

... well that proves my point. i have used it long before this thread. nice try at deception!

Malcolm · 31 October 2008

cobby said:
DS said: Thanks for the links DaveH. I guess real scientists really do understand what controls bone shape after all, amazing. Just gene regualtion creating morphogenic fields after all. Now, if the troll can explain how all the proteins involved are just "bricks" then I guess someone might take it seriously. Of course, this is the nut job that stated that "chemical gradients are only marginally effective" at determining the shape of structures. So I guess all the Hox gene products are just "bricks" as well. When it has demonstrated that it understands protein structure and function perhaps someone will care about what it has to say, but it won't be me.
... yes Dave Stanton, proteins are just bricks: in this sense. a bottle full of proteins are not a human body anymore that a pile of bricks are a building. the point was that these building blocks have to be arranged in the correct pattern to function. it was an ANALOGY!.
Do you actually understand what an enzyme is?

cobby · 31 October 2008

… one byte, one letter of the alphabet is enough info for even the design of a fingernail? you are totally ignorant.

Translation: “I don’t have a rebuttal so I’ll just toss out the usual litany of insults and nonsensical statements.”

Robin replied to comment from jobby | September 25, 2008 11:15 AM | Reply jobby said:

... robin, you really need to get a life. i cant believe you would look up that and quote it to prove such a petty point. i have better things to do.

cobby · 31 October 2008

Do you actually understand what an enzyme is?

... get off of it. you are making yourself look obsessed and stupid.

Malcolm · 31 October 2008

cobby said:
DS said: Thanks for the links DaveH. I guess real scientists really do understand what controls bone shape after all, amazing. Just gene regualtion creating morphogenic fields after all. Now, if the troll can explain how all the proteins involved are just "bricks" then I guess someone might take it seriously. Of course, this is the nut job that stated that "chemical gradients are only marginally effective" at determining the shape of structures. So I guess all the Hox gene products are just "bricks" as well. When it has demonstrated that it understands protein structure and function perhaps someone will care about what it has to say, but it won't be me.
... yes Dave Stanton, proteins are just bricks: in this sense. a bottle full of proteins are not a human body anymore that a pile of bricks are a building. the point was that these building blocks have to be arranged in the correct pattern to function. it was an ANALOGY!.
Do you actually understand what an enzyme is?

Malcolm · 31 October 2008

Sorry for the double post there.
Troll, I asked the question for a reason.
Your analogy shows that you may not understand what enzymes are or do.

cobby · 31 October 2008

Just gene regualtion creating morphogenic fields after all.

... nice hypothesis. any proof or is your FAITH strong?

cobby · 31 October 2008

Malcolm said: Sorry for the double post there. Troll, I asked the question for a reason. Your analogy shows that you may not understand what enzymes are or do.
... explain why you think that

DaveH · 31 October 2008

cobby said: ... again there is plenty of evidence that confirms the 'everything was created last thursday' hypothesis.
What evidence? The point of "last-Thursdayism" is that one could assert that "everything was created last Thursday, including all the data which contradict the hypothesis" and that that could never be falsifiable. Idiot.

cobby · 31 October 2008

fnxtr said: Ya, but Yobbo's all about the "natural selection isn't enough" evasive tactic(never mind that his concrete skull is immune to the drilling everyone's been trying to deliver that no-one (currently here at least) said it was), without actually having the guts to say what he thinks does create new phyla. We've had hints of space aliens and holographic fields (probably from another dimension... maybe it's The Old Ones? Cthulhu?), but nothing you could actually call, say, an idea.
... saying that there really is no proof for your theory. sorry charlie. its ok to have FAITH. but real science needs proof

cobby · 31 October 2008

DaveH said:
cobby said: ... again there is plenty of evidence that confirms the 'everything was created last thursday' hypothesis.
What evidence? The point of "last-Thursdayism" is that one could assert that "everything was created last Thursday, including all the data which contradict the hypothesis" and that that could never be falsifiable. Idiot.
... moron, that is what i said "last-Thursdayism" has lots of evidence supporting it. but it cannot be disproven. (whats the use? its like trying to teach my dog algebra)

DaveH · 31 October 2008

cobby said: ... moron, that is what i said "last-Thursdayism" has lots of evidence supporting it. but it cannot be disproven. (whats the use? its like trying to teach my dog algebra)
No. IDiot, the point is that there is NO actual evidence for last-Thursdayism. Point me to the evidence, if you think it's so abundant..

tresmal · 31 October 2008

Jobby said: "… moron, that is what i said “last-Thursdayism” has lots of evidence supporting it. but it cannot be disproven. (whats the use? its like trying to teach my dog algebra)"

Wow. That one broke my moronometer.

cobby · 31 October 2008

DaveH said:
cobby said: ... moron, that is what i said "last-Thursdayism" has lots of evidence supporting it. but it cannot be disproven. (whats the use? its like trying to teach my dog algebra)
No. IDiot, the point is that there is NO actual evidence for last-Thursdayism. Point me to the evidence, if you think it's so abundant..
Dummy, what does the theory say we should observe it the theory is true??

tresmal · 31 October 2008

"Dummy, what does the theory say we should observe it the theory is true?? "

Oops! There goes another one!


The point of "last-thursdayism" is that it is a priori impossible for there to be evidence for it.

DaveH · 31 October 2008

cobby said: Dummy, what does the theory say we should observe it the theory is true??
Well, that convinced me!

cobby · 31 October 2008

DaveH said:
cobby said: ... moron, that is what i said "last-Thursdayism" has lots of evidence supporting it. but it cannot be disproven. (whats the use? its like trying to teach my dog algebra)
No. IDiot, the point is that there is NO actual evidence for last-Thursdayism. Point me to the evidence, if you think it's so abundant..
... wow you sound like a Darwinist. you know i keep asking them the same thing: Point me to the evidence, if you think it's so abundant.. ... last-Thursdayism. do you know what this theory states?

DS · 31 October 2008

Well anyone who really knew anything could post an eloquent description of what enzymes are and what they do, complete with references. But of course the troll with bricks for brains would just declare it "gibberish" simply because it couldn't possibly understand anything scientific. Oh well, at least it has proven that it thinks that proteins really are bricks. No evidence yet that it understands transcription factors, polymerases, gated ion channels, electron transport chains or anything else biological.

Talk about gibberish, how about that imaginary invisible hologram that can't work in the dark but still controls development. Man, it really had to smash the bricks in it's brain together really hard to come up with that crapola. Of course now that it has been exposed for the nonsense that it is, the troll will claim that it never wrote that.

Now it is going to try to claim that the universe was created last Thursday and that there is lots of evidence for that hypothesis. When asked to produce said evidence it will probably claim that it never wrote that either. Well maybe it was created last Thursday, that would explain it's complete lack of knowledge of biology. I say it that the universe was created last Wednesday, so there heretics.

Oh and by the way, the same nested hierarchy produced from different data sets is very strong evidence not only that phyla can be produced by descent with modification, but that they in fact actually were. The troll of many names has no alternative to the mechanism of natural selection, no knowledge of the evidence for it's central role in cladogenesis and no knowledge of any of the other mechanisms that have been elucidated since the time of Darwin. What can you expect from someone who thinks that proteins are bricks? Once your credibility is shot, there really is no point in making any further claims. I say, ignore it's ass into oblivion.

cobby · 31 October 2008

Oh and by the way, the same nested hierarchy produced from different data sets is very strong evidence not only that phyla can be produced by descent with modification, but that they in fact actually were.

... but Darwinism states NS did the job. just because a hierarchy exists does not necessarily dictate that it was caused by NS.

... what would we observe if NS did not cause the hierarchy? (why do i feel like i am asking rover to solve a quadratic equation? )

cobby · 31 October 2008

Now it is going to try to claim that the universe was created last Thursday and that there is lots of evidence for that hypothesis

... dummy, i never claimed the universe was create last thur. (woof rover, what is a + b rover, woof woof)

cobby · 31 October 2008

...did you ever play the game where you throw the ball for your dog to run after then you pretend you throw it (but dont) and he runs after it and cant find it and looks so confused.

..why do we enjoy doing that? i dont know but here i go:

woof woof trolls here i am throwing the ball. go chase (hahaha i didnt throw it but still they run and look back so, so confused)

PvM · 31 October 2008

Common descent is a prediction of Darwinism, now whether or not NS was involved is another issue. In fact, NS has been detected as a force in nature. In other words, we have well established mechanism. That Jobby is too lazy to read up on science is no excuse. Notice once again the vacuity in Cobby's position. If it weren't halloween it would almost be scary. Now it's just par for the course
cobby said: Oh and by the way, the same nested hierarchy produced from different data sets is very strong evidence not only that phyla can be produced by descent with modification, but that they in fact actually were. ... but Darwinism states NS did the job. just because a hierarchy exists does not necessarily dictate that it was caused by NS. ... what would we observe if NS did not cause the hierarchy? (why do i feel like i am asking rover to solve a quadratic equation? )

PvM · 31 October 2008

Yes, such a claim would at least show an attempt at presenting an argument. Silly us, we should know better than to expect Bobby to apply reason and logic.
cobby said: Now it is going to try to claim that the universe was created last Thursday and that there is lots of evidence for that hypothesis ... dummy, i never claimed the universe was create last thur. (woof rover, what is a + b rover, woof woof)

cobby · 31 October 2008

... trolls, im throwing another ball. go chase. go chase (too funny)

... did wayne go on a bender. maybe i was a little to harsh with him. but hes got to get off the sauce but sometimes when alcs are confronted they go on a bender

PvM · 31 October 2008

Again the irony is killing me. Do you enjoy making a 'fool' of yourself?
cobby said: ... trolls, im throwing another ball. go chase. go chase (too funny) ... did wayne go on a bender. maybe i was a little to harsh with him. but hes got to get off the sauce but sometimes when alcs are confronted they go on a bender

DS · 31 October 2008

Here comes another manic jumping monkey spasm, feces flying everywhere. I guess it thinks this helps it's credibility. Just ignore it and it will go away.

And oh yea, I told you so.

Henry J · 31 October 2008

I hate to say this, but "what would we observe if NS did not cause the hierarchy?" does strike me as a legitimate question, if the question is altered to also include all the other genetic change processes (e.g., genetic drift, horizontal transfer).

The known genetic change mechanisms are expected to produce increasing differences over the whole genomes of genetically isolated populations, slower in the parts of the DNA affected by selection, and faster in parts not conserved by selection.

But something other than selection? It might or might not follow that pattern, though to actually predict what we'd observe in such a case, one would need a hypothesis on what the something else might be.

Henry

Malcolm · 31 October 2008

Sorry for the double post there. Troll, I asked the question for a reason. Your analogy shows that you may not understand what enzymes are or do.
cobby said:
Malcolm said: Sorry for the double post there. Troll, I asked the question for a reason. Your analogy shows that you may not understand what enzymes are or do.
... explain why you think that
Because your analogy is total crap. No one here has argued that a bottle of protein can form a human. Why would we? The whole point is that the embryo requires the appropriate signals and environment provided by the womb to grow. Once it has those conditions are present, development is controlled by protein gradients. As has been shown by the numerous studies that you have been avoiding for the last few weeks. In terms of your analogy, proteins don't just represent bricks, but also, as has already been pointed out to you, the builders, their parents, the tools they will use, the factories that made those tools, the wiring, the plumbing, the concrete, the mortar, the planning consent, the local council who gave the planning consent, the plans, the painters and decorators, and even the furniture. That's why I don't think that you understand what an enzyme is. If you feel that that is unfair, feel free to explain what a tyrosine kinase domain is, and why it is relevant to a discussion of morphogenesis.

cobby · 1 November 2008

he whole point is that the embryo requires the appropriate signals and environment provided by the womb to grow.

.... any proof? or just FAITH??

cobby · 1 November 2008

the planning consent,

... there was a planner??

cobby · 1 November 2008

one would need a hypothesis on what the something else might be.

.... design for one.

DaveH · 1 November 2008

somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
Any proof?? or just FAITH?

PvM · 1 November 2008

Design is not a hypothesis, design is a method.
cobby said: one would need a hypothesis on what the something else might be. .... design for one.

PvM · 1 November 2008

And once again Bobby shows his enormous level of ignorance with scientific fact and knowledge. And once again inappropriately uses the word 'proof'. How sad
cobby said: he whole point is that the embryo requires the appropriate signals and environment provided by the womb to grow. .... any proof? or just FAITH??

PvM · 1 November 2008

ROTFL, do not ask Bobby to support his claims, he is utterly unable to use logic and reason required to do so. Of course, few would be willing to defend Bobby's 'thesis' of holographic-like field. What an ignorant position that one is.
DaveH said:
somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
Any proof?? or just FAITH?

SWT · 1 November 2008

cobby said: he whole point is that the embryo requires the appropriate signals and environment provided by the womb to grow. .... any proof? or just FAITH??
A number of papers have been cited providing supporting evidence for this. Heck, you even cited a paper that provides supporting evidence for this.

SWT · 1 November 2008

Henry J said: I hate to say this, but "what would we observe if NS did not cause the hierarchy?" does strike me as a legitimate question, if the question is altered to also include all the other genetic change processes (e.g., genetic drift, horizontal transfer). The known genetic change mechanisms are expected to produce increasing differences over the whole genomes of genetically isolated populations, slower in the parts of the DNA affected by selection, and faster in parts not conserved by selection. But something other than selection? It might or might not follow that pattern, though to actually predict what we'd observe in such a case, one would need a hypothesis on what the something else might be. Henry
"What would we observe if the mechanisms posited by MET did not cause the hierarchy?" is indeed a legitimate question, that can be answered in a couple of ways. At the most simplistic level, if the mechanisms posited by MET did not cause the hierarchy, we would expect to see data inconsistent with the predictions of MET. As you note, beyond this simplistic answer, you'd need a set of predictions that follow from a specific alternative hypothesis. Which brings me to this:
cobby said: one would need a hypothesis on what the something else might be. .... design for one.
I have yet to see anyone propose a set of predictions from any sort of "design hypothesis" intended to explain biological phenomena that would allow possible falsification of the hypothesis.

Wayne Francis · 1 November 2008

Robin said:
cobby said:
Robin said:
cobby said: ... well you had to copy my 'translation' schtick. imitation is the sincerest form of flattery. you dont seem me imitating any thing clever that you do. well i guess that is impossible since you DONT do anything clever.
Actually, it was my translation schtick that youcopied. Thanks for the flattery. And yes, we do see you imitating other people's clever things. It seems you have nothing clever (nevermind valid) to offer.
... no sorry, honey. it was my schtick! look it up.
LOL! First referenced used is by me on page 9 of this thread: Robin replied to comment from jobby | September 25, 2008 11:11 AM | Reply jobby said: The fact is, the information could be 1 byte in size. You don’t know, Jobo, so quit pretending that you know something that real scientists don’t. … one byte, one letter of the alphabet is enough info for even the design of a fingernail? you are totally ignorant. Translation: “I don’t have a rebuttal so I’ll just toss out the usual litany of insults and nonsensical statements.” Robin replied to comment from jobby | September 25, 2008 11:15 AM | Reply jobby said: Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development. .….feel free to post the names of real who are scientists who are studying the information space requirements for biological development. Translation: “I’ll toss out a burden of proof fallacy because I don’t have any evidence for my claim.” Yaaawwwnn. Clearly Jobob, your claim is erroneous.
Hope you don't mind me coping you Robin! :) Nice work, of course now SFB here will ignore this.

DS · 1 November 2008

Henry wrote:

"I hate to say this, but “what would we observe if NS did not cause the hierarchy?” does strike me as a legitimate question, if the question is altered to also include all the other genetic change processes (e.g., genetic drift, horizontal transfer)."

Good point Henry. Of course others have considered this scenario. Kimura developed the Neutral Theory to predict what one would expect at the population level if the effects of selection are minimal. The theory adequately describes much of molecular evolution but of course it cannot account for adaptive change. It shows that changes in allele frequency are dominated by processes of random mutation and genetic drift in the absence of selection.

At the level of speciation, reproductive isolation is often produced, or at least reinforced, by some form of selection, so rates of speciation would no doubt be much lower if no selection were operating.

At the level of macroevolution, a nested hierarchy would still be produced, but if selection were not operating, the pattern would probably appear quite different. No one has modeled this, since selection has obviously been important in macroevolution. However, there would probably be fewer lineages, smaller discontinuities between lineages and lower variance in lineage size and persistence. For example, in the absence of selection, there might be no good reasaon for the trilobite liineage to go extinct and the insect lineage to evolve to dominate the terrestrial habitat.

Of course, as you correctly point out, in the absence of a hypothesis about another force, it is impossible to say what the hierarchy might look like. Design cannot be the answer since it would not preclude selection. One could speculate that if all species were designed fixed and perfect that there would be no selection, but then again that would not produce the nested hieraracy, so that scenario ia conclusively falsified.

Wayne Francis · 1 November 2008

SFB a.k.a. cobby said: Nevertheless, the evidence from these many additional sources of data simply confirm that Darwin was correct in his conclusions that all living things have descended from a common ancestor and can be placed within a tree of life, and that the principle process guiding their descent has been natural selection. ... again there is plenty of evidence that confirms the 'everything was created last thursday' hypothesis. you need a TEST that could possibly falsify. got one??
You are truly an idiot SFB. There is no evidence of "last thursdayism". You can't prove that "last thurdsayism" didn't happen because it is unverifiable and unfalsifiable. It falls out of the omphalos hypothesis. Creationist claim that "God" created the world 6 thousand years old "with history". These ideas mean nothing because they don't add anything to our knowledge and understanding of the world. The problem of falsifying evolution is like falsifying atomic theory. One piece of evidence can’t falsify these theories because the theories are backed up by so much. It would talk multiple instances of multiple events to chisel these theories away. New theories have to not only explain one thing differently but have to explain almost everything that the existing theory explains. For example the standard model of physics could be shown to be wrong if we detect many particles that can’t be accounted for in the standard model. Not finding a particle like the graviton doesn’t disprove the standard model but with projects like the LHC if we don’t start seeing the signature of the graviton then we can start revising the standard model and spend more effort looking for the cause of gravity else where. If you can show one piece of evidence that the world was created last Thursday then you can win the Nobel Prize. Back to falsifying Evolution via natural selection, you would have to explain, with evidence, almost everything ToE via NS explains. The thing is you have no other explanation that has any evidence. You ignoring evidence of ToE doesn’t mean it isn’t there either SFB. Go bury your head in your bible and chant “God is good” because it is about all you will be good for in your life.

Wayne Francis · 1 November 2008

cobby said: First referenced used is by me on page 9 of this thread: ... well that proves my point. i have used it long before this thread. nice try at deception!
And you think this literary device is your invention? That no one has ever used this before? Man you really can’t get any more arrogant.

Wayne Francis · 1 November 2008

SFB a.k.a. cobby said: First referenced used is by me on page 9 of this thread: ... well that proves my point. i have used it long before this thread. nice try at deception!
You better say sorry to DragonScholar because he used it back on June 9th, 2006 here and I'm sure he wasn't the first. That took me all of 20 seconds to find. SFB shows himself, once again, to be an arrogant, deceitful, lying, willfully ignorant troll.

Wayne Francis · 1 November 2008

SFB a.k.a. cobby said:
DaveH said:
SFB a.k.a. cobby said: ... again there is plenty of evidence that confirms the 'everything was created last thursday' hypothesis.
What evidence? The point of "last-Thursdayism" is that one could assert that "everything was created last Thursday, including all the data which contradict the hypothesis" and that that could never be falsifiable. Idiot.
... moron, that is what i said "last-Thursdayism" has lots of evidence supporting it. but it cannot be disproven. (whats the use? its like trying to teach my dog algebra)
SFB you are an idiot. It is unverifiable and unfalsifiable. IE no evidence oh wait SFB has different definitions for everything then the rest of us do.

Wayne Francis · 1 November 2008

cobby said: he whole point is that the embryo requires the appropriate signals and environment provided by the womb to grow. .... any proof? or just FAITH??
Have you seen any babies develop outside of the womb? Sceintist do tests all the time that disrupt signal graidiants and observe embryo's not developing properly.

Wayne Francis · 1 November 2008

SFB a.k.a. cobby said: the planning consent, ... there was a planner??
SFB again shows he has no concept of what an analogy is and takes it to far.

PvM · 1 November 2008

Of course, Bobby's short term memory surely has failed him once again and he will respond by 'have you read them' when obviously Bobby has refused to familiarize himself with the actual science involved Once again I thank Bobby for exposing the vacuity of his position
SWT said:
cobby said: he whole point is that the embryo requires the appropriate signals and environment provided by the womb to grow. .... any proof? or just FAITH??
A number of papers have been cited providing supporting evidence for this. Heck, you even cited a paper that provides supporting evidence for this.

Malcolm · 1 November 2008

cobby said: the planning consent, ... there was a planner??
So not only do you have absolutely no understanding of what a protein is, or does, you have no idea what it takes to get a house built either. Still waiting for any evidence that you have any biological knowledge whatsoever.

PvM · 2 November 2008

Sure, Bobby ridicules that which he does not understand, which seems to include much of biological science. That Bobby has a somewhat limited understanding of proteins and how the interact with development comes thus as no big surprise to me.
Malcolm said:
cobby said: the planning consent, ... there was a planner??
So not only do you have absolutely no understanding of what a protein is, or does, you have no idea what it takes to get a house built either. Still waiting for any evidence that you have any biological knowledge whatsoever.

cobby · 2 November 2008

It would talk multiple instances of multiple events to chisel these theories away

... wrong. or are you saying Darwinism is not falsifiable and hence not science?

cobby · 2 November 2008

So not only do you have absolutely no understanding of what a protein is, or does, you have no idea what it takes to get a house built either.

... childish!

Still waiting for any evidence that you have any biological knowledge whatsoever.

... you first.

cobby · 2 November 2008

Common descent is a prediction of Darwinism

.... no sorry charlie Common descent ***via NS *** is a prediction of Darwinism. big difference. you should read about Darwin's theory. it really is quite intriguing.

cobby · 2 November 2008

DaveH said:
cobby said: Dummy, what does the theory say we should observe it the theory is true??
Well, that convinced me!
... dummy, it was NOT SUPPOSED to convince you. do you have reading problems??

cobby · 2 November 2008

But something other than selection? It might or might not follow that pattern, though to actually predict what we’d observe in such a case, one would need a hypothesis on what the something else might be.

.... so them come up with that hypothesis you need to falsify your theory or else it is not scientific.

woof, woof.

cobby · 2 November 2008

Wayne Francis said:
cobby said: First referenced used is by me on page 9 of this thread: ... well that proves my point. i have used it long before this thread. nice try at deception!
And you think this literary device is your invention? That no one has ever used this before? Man you really can’t get any more arrogant.
... were you on a bender? anyhow i was not the one that brought up this who thought of it first petty thing. why cant we talk about the subject matter instead of the childish gibberish??

cobby · 2 November 2008

And once again Bobby shows his enormous level of ignorance with scientific fact and knowledge. And once again inappropriately uses the word ‘proof’.

How sad

.... you theory cannot be proven???

cobby · 2 November 2008

and why it is relevant to a discussion of morphogenesis.

... leading question! you really dont see that? its like asking why was hitlers conquest of china relevant to the fall of berlin. but this is typical of Darwinists since their theory has so little proof. first of all YOU have to show that it IS relevant ( again woof woof. this logic is above his canine cerebrums ability )

Wayne Francis · 2 November 2008

SFB a.k.a. cobby said: It would talk multiple instances of multiple events to chisel these theories away ... wrong. or are you saying Darwinism is not falsifiable and hence not science?
I know your brain can't handle this much info but I meant just what I said. Any strongly supported theory will not be typically falsified by just one finding. To falsify theories like the standard model in physics or evolution there would need to be enough evidence to better describe the current observations then the current theory provides along with the evidence that can not be incorporated into the theory. It is only creationist trolls that believe that a theory should be unchanging. What would it mean if we found a rabbit fossil in the a Cretaceous layer? Should/can 1 finding like this overthrow all other evidence? I suspect scientist would look at what other explanation could account for the finding. Just like if during a collision in a particle accelerator they recorded energy release 3 orders of magnitude higher then expected they would not throw out E=MC^2. Now if we started finding mammals all of different types in the Cretaceous or found radically new species all over the place then we would have to start rethinking the theory of evolution. But we don't see these types of evidence. We see find evidence that most often fits very nicely into nested hierarchies. Now as far as NS. We observe this all the time. In any given environment those species which are best fit for said environment tend to bread more successfully thus passing on the traits they have to their offspring. Please don't tell me that you don't understand heritable traits?!?! If you don't look anything like your mother and father then maybe you where adopted. I can guarantee you that you do have traits from both your mother and father. If you have or ever will have kids they will have some of your traits, lets hope they don't inherit your stupidity. So no I didn't say that Evolution was not falsifiable. I said it would take more then a little piece of data to falsify it just as the standard model of physic would take more then a little piece of data to falsify it. So you are either being a deceitful creationist troll trying to quote mine me or you are just extraordinarily stupid and ignorant. I would wager on the former. You really should come up with something new. We are very familiar with your creationist tactics. How do you think Jesus would look upon your lying and deceitful tactics?

Wayne Francis · 2 November 2008

SFB a.k.a. cobby said: So not only do you have absolutely no understanding of what a protein is, or does, you have no idea what it takes to get a house built either. ... childish!
Why is it childish to point out your lack of understanding in a field that you keep claiming you have a vast knowledge in? That is like saying it is childish to report a "doctor" that repeatedly committed malpractice by performing procedures they claim they are qualified in but actually are not.
SFB a.k.a. cobby said:Still waiting for any evidence that you have any biological knowledge whatsoever. ... you first.
And SFB once again ignores everything that he asked for in the past plus tons of other posts providing references and explanations to various topics. Very funny that he considers us pointing out his lack of knowledge in the sciences childish but ignores the fact that when we show his lack of knowledge we almost always provide a detailed explanation while he just says "wrong." without any explanation. Again he is a great example of a narrow minded willfully ignorant lying and deceitful creationist troll who is happy to break the very commandments with his "God" that he should hold so dearly.

cobby · 2 November 2008

Or more generally, find cases where all genetic variations in a population produce the same average number of fertile adult offspring.

... woof woof. (have to get his attention) DUH! no one is saying NS does not exist. i want you to show that new phyla were produced by it. ( over his head again!)

cobby · 2 November 2008

wayne, youre back. were you on a bender or in detox?

Wayne Francis · 2 November 2008

SFB a.k.a. cobby said:
DaveH said:
SFB a.k.a. cobby said: Dummy, what does the theory say we should observe it the theory is true??
Well, that convinced me!
... dummy, it was NOT SUPPOSED to convince you. do you have reading problems??
No but you have a problem with grammar and the English language. Evolution via NS predicts that in any given environment the individuals that better utilize the resources should produce more offspring thus their traits will be more likely to passed down to the next generations. Now SFB is trying a creationist troll tactic again. Scientist and people that understand the concept do not make the claim that evolution is all about NS. We accept the fact that there are many factors that contribute to evolution to include but not limited to :
  • Sexual selection
  • Random mutation
  • Gene flow
  • Genetic drift
  • Speciation
Natural selection can not do much without other factors, like the ones listed above, taking place.

Wayne Francis · 2 November 2008

SFB a.k.a. cobby said: But something other than selection? It might or might not follow that pattern, though to actually predict what we’d observe in such a case, one would need a hypothesis on what the something else might be. .... so them come up with that hypothesis you need to falsify your theory or else it is not scientific. woof, woof.
SFB showing how mature he is. He also shows how he can't even use the "reply" properly so people can read part of a post he is replying to in the full context that it was made, a common creationist troll quote mining tactic. How is this for a hypothesis SFB. If we grow a population in a given environment we expect to see individuals that can utilize the resources of that environment be more successful then those that can not. And low and behold this is what we see when we do these test. The net is full of studies where scientist control the environment of a population and watch how, over many generations, these populations change. At the end of the test we see populations with new traits that are better suited to the environment then the original population. If NS was not true then we would not expect this to happen.

Wayne Francis · 2 November 2008

SFB a.k.a. cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: First referenced used is by me on page 9 of this thread: ... well that proves my point. i have used it long before this thread. nice try at deception!
And you think this literary device is your invention? That no one has ever used this before? Man you really can’t get any more arrogant.
... were you on a bender? anyhow i was not the one that brought up this who thought of it first petty thing. why cant we talk about the subject matter instead of the childish gibberish??
yes you where SFB. You brought it up by telling me I copied you here and here. You where the first to bring up this "petty thing" SFB again shows himself to be a lying and deceitful troll that uses the childish tactic of slandering people when he is lying to try to divert attention from his lies.

cobby · 2 November 2008

cobby said: wayne, youre back. were you on a bender or in detox?
.... wow hes avoiding that question! i go for the bender choice. hes too much in denial to have gone to detox.

Wayne Francis · 2 November 2008

SFB a.k.a. cobby said: And once again Bobby shows his enormous level of ignorance with scientific fact and knowledge. And once again inappropriately uses the word ‘proof’. How sad .... you theory cannot be proven???
SFB shows his limited grasp on the English language and grammar yet again. He also shows his deceitful creationist tactics here. He has been told over and over that no theory is ever proven. Theories are just the best explanation currently available given the current data. Theories are always open to being discarded if a better theory comes along. Proofs are for math not science. Now Evolution has been proven beyond a reasonable doubt. There is a difference in the terms. This is why evolution will not fall unless there is a lot of data that springs up that doesn't fit the model and the model can not be altered to incorporate it. I know there is a high probability SFB will quote mine this. Making the common creationist claim that evolution is so flexible that it can incorporate any piece of data. This is not true. Science in general changes any theory when new data comes along. It is call refining our knowledge. Very rarely do you have a completely new radical theory this is because the old theory still has weight and the new theory does not explain everything the old one has.

DS · 2 November 2008

Everyone should be sure to notice that the troll of many names has still failed to display any knowledge whatsoever of proteins, enzymes, transcription factors, developmental biology or morphogenic fields. It has still failed to demonstrate how proteins should be considered merely "bricks" in any menaingful sense or provide any evidence that the universe was created last Thursday. It still hasn't explained why the magic invisible hologram is affected by changes in DNA or why it works for human development if it can't work in the dark. In short, it made up a bunch of bull shit and failed to support any of it. Now why should anyone pay any attention to anything it has to say since it has provided ample evidence that it doesn't have a cule what it is talking about? Oh well, at least it seems to have changed from a screaming monkey into a barking dog. Still shit for brains though, too bad.

Wayne Francis · 2 November 2008

SFB a.k.a. cobby said: Or more generally, find cases where all genetic variations in a population produce the same average number of fertile adult offspring. ... woof woof. (have to get his attention) DUH! no one is saying NS does not exist. i want you to show that new phyla were produced by it. ( over his head again!)
So you are claiming unless we show a phylum, which is 5 levels higher then a species, being created then NS doesn't matter? You do realize that no one, beyond creationist, expects to see a new phylum pop into existence. Man SFB has gone way beyond the wanting a new species, that we have actually observed in the lab. All life is broken down into about 50 phyla. He might as well say that unless a new kingdom appears evolution can't be true. SFB displays his total lack of understanding on cladistics. SFB also shows how he thinks we are childish by pointing out his lack of knowledge areas like science and grammar but he thinks his kindergarten tactics of calling people dogs and drunks is excusable.

Henry J · 2 November 2008

Theories are just the best explanation currently available given the current data. Theories are always open to being discarded if a better theory comes along.

Like ether or phlogiston. But more often than not, the new theory incorporates the old one as a limiting case, like relativity does with Newton's laws.

You do realize that no one, beyond creationist, expects to see a new phylum pop into existence.

Yeah, it'd take a lot of accumulated changes to justify calling a taxonomic group a new phylum, rather than just another subset of the same phylum. On the other hand, using cladistics does away with the bookkeeping needed to maintain all those taxonomic ranks

All life is broken down into about 50 phyla.

Isn't that just animals? I thought they weren't really using the "phylum" term for one celled types. (Not sure about plants, though.) Henry

Stanton · 2 November 2008

Henry J said:

All life is broken down into about 50 phyla.

Isn't that just animals? I thought they weren't really using the "phylum" term for one celled types. (Not sure about plants, though.) Henry
It may be a little less than 50 phyla for animals, as some taxa have been, shall we say, demoted, like how Pogonophora have been demoted from phylum to order within the annelid class Polychaeta. Instead of "phylum," the analogous term in Plantae is "Division." As for the Protists/Protozoa, at first, people used the Kingdom Protista as something of a catchall for (nongreen) algae and any unicellular or mostly unicellular eukaryote that wasn't obviously related to any animal, vegetable or mineral fungus. Eventually, though, it became more and more obvious that Protista was polyphyletic, so, some researchers began cutting it up into a bunch of smaller Kingdoms. How many, I've lost count.

Malcolm · 2 November 2008

cobby said: and why it is relevant to a discussion of morphogenesis. ... leading question! you really dont see that? its like asking why was hitlers conquest of china relevant to the fall of berlin. but this is typical of Darwinists since their theory has so little proof. first of all YOU have to show that it IS relevant ( again woof woof. this logic is above his canine cerebrums ability )
If you understood what RTKs were, you would understand the relevance. You claim that enzyme gradients don't control morphology, but you obviously have no clue what enzyme gradients do.

Wayne Francis · 2 November 2008

Henry J said: ...

All life is broken down into about 50 phyla.

Isn't that just animals? I thought they weren't really using the "phylum" term for one celled types. (Not sure about plants, though.) Henry
Animals is about 35 or so from memory. Plants are classed as Divisions and there are about a dozen, again from memory. Fungus also have a similar division with a handful. I used 50 as a rough number. SFB surely will either claim that he can't believe that I spent the time looking up the information or will twist around the meaning so bad so I didn't care that I was shooting from my memory. For SFB's argument the estimate was close enough.

cobby · 3 November 2008

If you understood what RTKs were, you would understand the relevance.

... circular logic!

You claim that enzyme gradients don’t control morphology,

.... never said that. reading problems??

but you obviously have no clue what enzyme gradients do.

... false conclusions.

cobby · 3 November 2008

Wayne Francis said:
Henry J said: ...

All life is broken down into about 50 phyla.

Isn't that just animals? I thought they weren't really using the "phylum" term for one celled types. (Not sure about plants, though.) Henry
Animals is about 35 or so from memory. Plants are classed as Divisions and there are about a dozen, again from memory. Fungus also have a similar division with a handful. I used 50 as a rough number. SFB surely will either claim that he can't believe that I spent the time looking up the information or will twist around the meaning so bad so I didn't care that I was shooting from my memory. For SFB's argument the estimate was close enough.
... cant believe you would take it off topic this much

cobby · 3 November 2008

So you are claiming unless we show a phylum, which is 5 levels higher then a species, being created then NS doesn’t matter?

... are you saying new phyla are not 'created' by NS?

cobby · 3 November 2008

..trolls: woof woof! didnt you see me throw the stick?

cobby · 3 November 2008

DS said: Everyone should be sure to notice that the troll of many names has still failed to display any knowledge whatsoever of proteins, enzymes, transcription factors, developmental biology or morphogenic fields. It has still failed to demonstrate how proteins should be considered merely "bricks" in any menaingful sense or provide any evidence that the universe was created last Thursday. It still hasn't explained why the magic invisible hologram is affected by changes in DNA or why it works for human development if it can't work in the dark. In short, it made up a bunch of bull shit and failed to support any of it. Now why should anyone pay any attention to anything it has to say since it has provided ample evidence that it doesn't have a cule what it is talking about? Oh well, at least it seems to have changed from a screaming monkey into a barking dog. Still shit for brains though, too bad.
... read about a half a sentence and realized it was a schizo-gibberish rant. then moved on. dont have time to waste on that!

cobby · 3 November 2008

expects to see a new phylum pop into existence.

.... i didnt say that. try to improve your reading skills.

DS · 3 November 2008

Obviously the troll of many names also has attention deficit disorder in addition to being a bipolar schizophrenic. Funny how no one ever seems to understand what it is trying to say and yet they are always somehow the ones to blame for the poor grammar and lack of coherence. Oh well, at least everyone can see that the troll still has no answers and is still just making shit up.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: So you are claiming unless we show a phylum, which is 5 levels higher then a species, being created then NS doesn’t matter? ... are you saying new phyla are not 'created' by NS?
No SFB, your creationist tactics won't work. I meant just what I said. A phylum is at a much higher level then species. So if phylum where rigorously defined you would need a HUGE number of changes to change phylum. Saying that something can’t change phylum via evolution is like saying you can’t count to a million one number at a time. And they are not ‘Created’ unless you mean sexual or asexual reproduction as ‘Created’ even then they are not ‘Created’ in one generation. Honestly learn some new creationist troll tactics.

Stanton · 3 November 2008

Wayne Francis said: Honestly learn some new creationist troll tactics.
My beloved Wayne, If cobby/jobby/bobby/jacob/hamstrung/balanced/goff had the ability to learn anything, he wouldn't be here wasting our time by accusing us of being trolls, even though he's the only one here who thinks that saying "woof woof fetch the stick" is the height of intelligent conversation.

cobby · 3 November 2008

So if phylum where rigorously defined you would need a HUGE number of changes to change phylum.

... so that is not possible??

cobby · 3 November 2008

My beloved Wayne,

... hmmm

cobby · 3 November 2008

DS said: Obviously the troll of many names also has attention deficit disorder in addition to being a bipolar schizophrenic. Funny how no one ever seems to understand what it is trying to say and yet they are always somehow the ones to blame for the poor grammar and lack of coherence. Oh well, at least everyone can see that the troll still has no answers and is still just making shit up.
... Dave Stanton, stop it!

PvM · 3 November 2008

Oh the irony. It is clear that DS has hit a nerve.
cobby said:
DS said: Obviously the troll of many names also has attention deficit disorder in addition to being a bipolar schizophrenic. Funny how no one ever seems to understand what it is trying to say and yet they are always somehow the ones to blame for the poor grammar and lack of coherence. Oh well, at least everyone can see that the troll still has no answers and is still just making shit up.
... Dave Stanton, stop it!

PvM · 3 November 2008

How did you reach that 'conclusion'? Ignorance again?
cobby said: So if phylum where rigorously defined you would need a HUGE number of changes to change phylum. ... so that is not possible??

PvM · 3 November 2008

Hahaha, this is too funny. Bobby does not need to show that he has no understanding, his own behavior, questions and 'arguments' clearly indicate that his scientific understanding is severely wanting.
cobby said: So not only do you have absolutely no understanding of what a protein is, or does, you have no idea what it takes to get a house built either. ... childish! Still waiting for any evidence that you have any biological knowledge whatsoever. ... you first.

PvM · 3 November 2008

My beloved cobby...
cobby said: My beloved Wayne, ... hmmm

PvM · 3 November 2008

Still confused about science and falsification? I am not surprised.
cobby said: It would talk multiple instances of multiple events to chisel these theories away ... wrong. or are you saying Darwinism is not falsifiable and hence not science?

Robin · 3 November 2008

cobby said: First referenced used is by me on page 9 of this thread: ... well that proves my point. i have used it long before this thread. nice try at deception!
The only point it proves is that you are attempting to evade AND you provided no evidence. Be that as it my, my first referenced use on this board is from 2006. If you'd like to show that you use the translation convention before then, feel free. Otherwise I'll just go with the fact that you are...still...unoriginal.

Robin · 3 November 2008

cobby said: … one byte, one letter of the alphabet is enough info for even the design of a fingernail? you are totally ignorant. Translation: “I don’t have a rebuttal so I’ll just toss out the usual litany of insults and nonsensical statements.” Robin replied to comment from jobby | September 25, 2008 11:15 AM | Reply jobby said: ... robin, you really need to get a life. i cant believe you would look up that and quote it to prove such a petty point. i have better things to do.
Translantion: "I'm a lazy, unoriginal troll." Thanks for admitting the obvious there, Jobob.

Robin · 3 November 2008

Wayne Francis said: Hope you don't mind me coping you Robin! :) Nice work, of course now SFB here will ignore this.
Not a problem at all, Wayne! I guess SFB was wrong about that bender too...;P

cobby · 3 November 2008

Be that as it my, my first referenced use on this board is from 2006.

... prove it.

cobby · 3 November 2008

PvM said: Still confused about science and falsification? I am not surprised.
cobby said: It would talk multiple instances of multiple events to chisel these theories away ... wrong. or are you saying Darwinism is not falsifiable and hence not science?
.. obviously YOU ARE! woof woof chase the stick!

Robin · 3 November 2008

cobby said: So you are claiming unless we show a phylum, which is 5 levels higher then a species, being created then NS doesn’t matter? ... are you saying new phyla are not 'created' by NS?
I can say with 100% certainty that new phyla are NOT created by NS. New phyla (in fact, all phyla) are created by humans.

Robin · 3 November 2008

cobby said: Be that as it my, my first referenced use on this board is from 2006. ... prove it.
Moving the goal posts. You haven't even proven that you've used the translation schtick before this board, so until you do you're just an unoriginal, lazy, copying troll. Go find something else to copy, lazy Troll.

Henry J · 3 November 2008

If it matters (or even if it doesn't), the "Translation:" gimmick gets used fairly often on threads on the AtBC forum.

Henry

Stanton · 3 November 2008

Robin said:
cobby said: So you are claiming unless we show a phylum, which is 5 levels higher then a species, being created then NS doesn’t matter? ... are you saying new phyla are not 'created' by NS?
I can say with 100% certainty that new phyla are NOT created by NS. New phyla (in fact, all phyla) are created by humans.
Such as the case of the demotion of Pogonophora, or the case of Brachiopoda's removal from Mollusca?

cobby · 3 November 2008

I can say with 100% certainty that new phyla are NOT created by NS. New phyla (in fact, all phyla) are created by humans.

... phyla are intelligently designed??

cobby · 3 November 2008

Robin said:
cobby said: Be that as it my, my first referenced use on this board is from 2006. ... prove it.
Moving the goal posts. You haven't even proven that you've used the translation schtick before this board, so until you do you're just an unoriginal, lazy, copying troll. Go find something else to copy, lazy Troll.
... not lazy, just not wasting my time on petty trivia

cobby · 3 November 2008

Henry J said: If it matters (or even if it doesn't), the "Translation:" gimmick gets used fairly often on threads on the AtBC forum. Henry
AtBC forum. ...???

Henry J · 3 November 2008

AtBC = "After the Bar Closes". There's a link to it at the top of this page.

Robin · 3 November 2008

Henry J said: If it matters (or even if it doesn't), the "Translation:" gimmick gets used fairly often on threads on the AtBC forum. Henry
It's used all over the place. I actually saw it used for the first time back in 2003 and have since used it from time to time. For Bobjob to claim that someone copied it from him on this thread is yet another demonstration of his arrogance, but then it was funnier that I could illustrate that by pointing out I had used it before him on this thread. That he is silly enough to take it beyond this thread and not laugh it off just further demonstrates his insecurities. Oh...and for the record, while I saw someone use back in 2003, I've been using it...since...well...umm...1981...yeah...so...so there!! ;P

Robin · 3 November 2008

Stanton said:
Robin said:
cobby said: So you are claiming unless we show a phylum, which is 5 levels higher then a species, being created then NS doesn’t matter? ... are you saying new phyla are not 'created' by NS?
I can say with 100% certainty that new phyla are NOT created by NS. New phyla (in fact, all phyla) are created by humans.
Such as the case of the demotion of Pogonophora, or the case of Brachiopoda's removal from Mollusca?
Bingo! :) Kingdom, Phylum, Class, Order, etc...these are all convenient organizer boxes for humans to use to wrap our heads around the relationships between life on this planet. But the processes governing this world and universe did not create them - we did - and quite often we find the natural processes are more creative and dynamic then our boxes are designed to accommodate. Things do not fit perfectly in any of those boxes per se. And why? Because they are created by man. Bottom line, there is no Kingdom, Phylum, Class, or Order that was created by NS. The organism groups in those greater groups were, but that's a different subject.

Robin · 3 November 2008

cobby said: I can say with 100% certainty that new phyla are NOT created by NS. New phyla (in fact, all phyla) are created by humans. ... phyla are intelligently designed??
The whole taxonomy system was intelligently designed.

Henry J · 3 November 2008

The whole taxonomy system was intelligently designed.

That was before evolution was understood, though. That ranking system can interfere with understanding when talking about the earliest member of a taxon (when the "higher" ranked taxa sort of blur into each other), or when one realizes that there are a half dozen or more significant branches between two consecutive ranks, requiring insertion of lots of super-group or sub-group ranks. Henry

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: So if phylum where rigorously defined you would need a HUGE number of changes to change phylum. ... so that is not possible??
SFB shows that he can't read. Accumulating that many changes is like counting to a million. It isn't hard it just takes a long time. Science has demonstrate random mutation + natural selection in the lab. Even if you only count those experiments as 1 change there is no actual barrier for millions of changes to happen. SFB shows he can't write, spell, read, understand science, the definitions of words and can not be anything but a willfully ignorant lying deceitful arrogant creationist troll.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: My beloved Wayne, ... hmmm
Let us add homophobia to SFB's mental issues. He acts like this and calls us childish. I'm sure SFB is now reporting PT for being a homosexual internet site. I wonder what his church group does when he reports PT to them.

cobby · 3 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: My beloved Wayne, ... hmmm
Let us add homophobia to SFB's mental issues. He acts like this and calls us childish. I'm sure SFB is now reporting PT for being a homosexual internet site. I wonder what his church group does when he reports PT to them.
... i said hmmm and you say homo??? thats a lot of interpretation.

cobby · 3 November 2008

Even if you only count those experiments as 1 change there is no actual barrier for millions of changes to happen.

.... you know that from experimentation or FAITH???

cobby · 3 November 2008

Bottom line, there is no Kingdom, Phylum, Class, or Order that was created by NS. The organism groups in those greater groups were, but that’s a different subject.

... then species were also created by man and not NS??

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: Be that as it my, my first referenced use on this board is from 2006. ... prove it.
SFB is even to lazy to use Google. I've already pointed out to him here that despite his tantrums he is far from the first person to use this type of literary device. As per normal he ignores this and keeps making the same SFB comments. Time to take your meds SFB.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said:
PvM said: Still confused about science and falsification? I am not surprised.
cobby said: It would talk multiple instances of multiple events to chisel these theories away ... wrong. or are you saying Darwinism is not falsifiable and hence not science?
.. obviously YOU ARE! woof woof chase the stick!
Typical SFB responce. Nothing of value and at the intellectual level of a desturbed 6 year old. SFB shouldn't you be taking your lithium? Your really need to stabilize your mania. Take your meds and actually try to respond to the actual issues that you have been avoiding for the last 2 months.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: I can say with 100% certainty that new phyla are NOT created by NS. New phyla (in fact, all phyla) are created by humans. ... phyla are intelligently designed??
SFB tries so hard. He either can't turn off his creationist tactics or he really doesn't get that classifying things into phylums is a human invention. He's probably frantically looking through his bible to see where his "God" defined each animal into a phylum.

DS · 3 November 2008

I wrote:

"Obviously the troll of many names also has attention deficit disorder in addition to being a bipolar schizophrenic. Funny how no one ever seems to understand what it is trying to say and yet they are always somehow the ones to blame for the poor grammar and lack of coherence. Oh well, at least everyone can see that the troll still has no answers and is still just making shit up."

I can keep posting this for another 5000 posts and the troll will still not have any answers. It will just make up more crap about magic invisible holograms and last Thursday. It has not only demonstrated that it has no knowledge but that it does not desire any knowledge either. It won't even read the papers it recommends. Crap says I and crap I means.

Imagine the delusional state required for someone to call other posters jumping monkeys and bark like a dog and then claim that others are childish for pointing out it's lack of knowledge! Crap says I and crap I means.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: My beloved Wayne, ... hmmm
Let us add homophobia to SFB's mental issues. He acts like this and calls us childish. I'm sure SFB is now reporting PT for being a homosexual internet site. I wonder what his church group does when he reports PT to them.
... i said hmmm and you say homo??? thats a lot of interpretation.
No SFB, I said homophobia and homosexual. 2 terms I have no problem using. I also have no problem being around homosexuals and that includes gay men because they don't threaten my masculinity. Do you care to enlighten us on what you did mean then? Not many different ways you can interpret "hmmm" of yours. Even if Stanton and I where lovers it wouldn't detract from the vacuity of your posts. Come on be inventive. Show me how I misinterpreted your "hmmm"

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: Bottom line, there is no Kingdom, Phylum, Class, or Order that was created by NS. The organism groups in those greater groups were, but that’s a different subject. ... then species were also created by man and not NS??
SFB again tries, badly, to get people to say something that he can quote mine. The concept of species is a little more well defined then phylum but still blurry. So the concept of species is a human categorization technique. The process of speciation is more of a term we use for the actual accumulated evolutionary processes, to include NS. To put this another way the word “red” is a human invention and classification. Even without it photons of the wavelength between 625nm to 740nm would still exist. Even without the word “species” there would still be populations of life that change via evolutionary processes, to include NS, to a point that they would not be able to breed with the original population.

DS · 3 November 2008

Henry J wrote:

"The whole taxonomy system was intelligently designed."

You are correct sir, though as you yourself point out, not always intelligently.

Protista and Reptilia are two good examples of taxa that were not so intelligently designed, at least in hind sight.

cobby · 3 November 2008

At the level of speciation, reproductive isolation is often produced, or at least reinforced, by some form of selection, so rates of speciation would no doubt be much lower if no selection were operating.

... are you saying there would be ANY speciation if NS did not function??

Henry J · 3 November 2008

Lower and zero are not synonymous.

cobby · 3 November 2008

To put this another way the word “red” is a human invention and classification. Even without it photons of the wavelength between 625nm to 740nm would still exist. Even without the word “species” there would still be populations of life that change via evolutionary processes, to include NS, to a point that they would not be able to breed with the original population.

.... there is a little bit of difference between an 'arbitrary' naming convention such as red and terms which describe things which cannot be arbitrarily tagged. for instance water and ice cannot have an abitrary temperature boundary but colors can.

... so to say that phyla were invented by man is a deep misunderstanding of the term. nothing new here. woof woof.

cobby · 3 November 2008

Henry J said: Lower and zero are not synonymous.
""no selection were operating."" .... i do believe 'no selection' means 'zero selection' again this read problem appears.

cobby · 3 November 2008

have no problem using. I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity.

... this whole: "I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity. " seems to be a reaction formation. seems to be an undertone of homosexuality here since it is often being brought up by the opposition here why is it an issue at all here. your side keeps bringing it up. that is curious.

cobby · 3 November 2008

Do you care to enlighten us on what you did mean then? Not many different ways you can interpret “hmmm” of yours.

... hmmm is an open ended response. if a psychotherapy client says ' i have trouble meeting new people' and the therapist says 'hmmm' it is just an encouragement for the patient to expound without leading to a specific direction.

... my hmmm immediately brought out a denial of homosexuality on your part. why was there a need for a denial if you are not threatened by the fact that you might be homo.

.... my hmmm could have been interpreted that there is a collusion between the both of you or that you know each other or that you are trying to flatter. well there could be hundreds of interpretations

... but you had defend your non-homosexuality. very revealing indeed.

cobby · 3 November 2008

I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity.

.... would you be comfortable at a gay bar?

DaveH · 3 November 2008

jobbie said: .… i do believe ‘no selection’ means ‘zero selection’ again this read problem appears.
Aaaand fail! Yes, "no selection" means "zero selection" but the point was about "lower speciation" in the presence of "zero selection", moron.
jobbie said somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
Any proof?? or just FAITH? Please tell us all about how the Sater and Jacobson paper you cited supports your position as outlined above.

cobby · 3 November 2008

DaveH said:
jobbie said: .… i do believe ‘no selection’ means ‘zero selection’ again this read problem appears.
Aaaand fail! Yes, "no selection" means "zero selection" but the point was about "lower speciation" in the presence of "zero selection", moron.
jobbie said somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
Any proof?? or just FAITH? Please tell us all about how the Sater and Jacobson paper you cited supports your position as outlined above.
""so rates of speciation would no doubt be much lower if no selection were operating."" ... no sorry charlie. my point was that speciation rates would not be 'much lower' they would be non-existant if there were no selection. that was my point dummy. (really again like teaching my dog algebra) maybe if i dumb it down you will get it: woof, woooof. bow bow wow,

cobby · 3 November 2008

jobbie said

somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.

Any proof?? or just FAITH? Please tell us all about how the Sater and Jacobson paper you cited supports your position as outlined above.

.... out of context! how deceptive of you. paste my entire comment!

cobby · 3 November 2008

Even if you only count those experiments as 1 change there is no actual barrier for millions of changes to happen.

.… you know that from experimentation or FAITH???

..... of course any answer to the above is vigorously avoided.

cobby · 3 November 2008

... i really think the problem with the opposition here is their abysmal reading skills. and now they say that the planet 'pluto' was created by humans since the word was created by humans.

... see the Darwinian theory is so full of holes they have to revert to these unbelieveable contortions of speech and logic when ever the glaring inconsistencies of their theory comes to the surface. so unscientific!

... and their greatest mantra of FAITH:

there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers!

... quite a religious commitment they have. their steadfastness has to be admired!

Henry J · 3 November 2008

Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he's talking about, let alone what evidence might support the notion.

Malcolm · 3 November 2008

cobby said: If you understood what RTKs were, you would understand the relevance. ... circular logic!
Feel free to explain how the enzyme gradients in question work without a kinase.
You claim that enzyme gradients don’t control morphology, .... never said that. reading problems??
So what was that whole hologram thing about then?
but you obviously have no clue what enzyme gradients do. ... false conclusions.
Like I said, feel free to prove me wrong at any time.

cobby · 3 November 2008

Henry J said: Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he's talking about, let alone what evidence might support the notion.
... well since your FAITH has told you there are none, to you it is a case closed and no reason to think about it or even go looking for a barrier, right? .... and since almost all if not all physical systems have limits would it not be logical to assume that there just ** might ** be one for this accumulation? .... nahhhh! why try to prove something your FAITH has told you is true!

cobby · 3 November 2008

Like I said, feel free to prove me wrong at any time.

... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps.

... can you do it with out spitting?

cobby · 3 November 2008

Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he’s talking about, let alone what evidence might support the notion.

.... this reminds of some ancient civilizations who tried to build a 'stairway to heaven' your logic is that since i can take 10 steps i can walk around the world. it really is incumbent on YOU how are making extraordinary claims to show the extraordinary proof. at least thats how Sagan looked at it.

PvM · 3 November 2008

That's too ironic. Bobby himself makes the more outrageous claims and fails, time after time, to show the extraordinary evidence. Hint to Bobby: Science does not deal in proof. Sigh
cobby said: Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he’s talking about, let alone what evidence might support the notion. .... this reminds of some ancient civilizations who tried to build a 'stairway to heaven' your logic is that since i can take 10 steps i can walk around the world. it really is incumbent on YOU how are making extraordinary claims to show the extraordinary proof. at least thats how Sagan looked at it.

cobby · 3 November 2008

PvM said: That's too ironic. Bobby himself makes the more outrageous claims and fails, time after time, to show the extraordinary evidence. Hint to Bobby: Science does not deal in proof. Sigh
cobby said: Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he’s talking about, let alone what evidence might support the notion. .... this reminds of some ancient civilizations who tried to build a 'stairway to heaven' your logic is that since i can take 10 steps i can walk around the world. it really is incumbent on YOU how are making extraordinary claims to show the extraordinary proof. at least thats how Sagan looked at it.
""Like I said, feel free to prove me wrong at any time."" pvm: i think you need to explain that 'proof' thing to Malcom

cobby · 3 November 2008

Bobby himself makes the more outrageous claims and fails, time after time, to show the extraordinary evidence.

... what was this extraordinary claim that i made? are you hallucinating again??

.... however YOU claim there are no limitations as to what NS can accomplish. I think THAT is an extraordinary claim that needs some validation

PvM · 3 November 2008

As usual, Bobby has failed to represent my beliefs and claims accurately when stating that there are no limitations to what NS can accomplish. Garbage in ... garbage out. And if you truly cannot remember your many outrageous claims then who is hallucinating here...
cobby said: Bobby himself makes the more outrageous claims and fails, time after time, to show the extraordinary evidence. ... what was this extraordinary claim that i made? are you hallucinating again?? .... however YOU claim there are no limitations as to what NS can accomplish. I think THAT is an extraordinary claim that needs some validation

PvM · 3 November 2008

cobby said:
PvM said: That's too ironic. Bobby himself makes the more outrageous claims and fails, time after time, to show the extraordinary evidence. Hint to Bobby: Science does not deal in proof. Sigh
""Like I said, feel free to prove me wrong at any time."" pvm: i think you need to explain that 'proof' thing to Malcom
You have been shown to be wrong at almost any time. As to Bobby's confusion about proof, sufficient to say that Bobby's own words show that it is he who needs 'explaining'. Of course, if history is a valid predictor, we will observe Bobby, once again, ignoring the knowledge presented to him and continue to make his 'foolish' claims. For that I thank Bobby

cobby · 3 November 2008

As usual, Bobby has failed to represent my beliefs and claims accurately when stating that there are no limitations to what NS can accomplish.

... so there ARE limitations? what are they? what are those barriers?

PvM · 3 November 2008

Let's first address why Bobby chose to misrepresent me? Why Bobby?
cobby said: As usual, Bobby has failed to represent my beliefs and claims accurately when stating that there are no limitations to what NS can accomplish. ... so there ARE limitations? what are they? what are those barriers?

Wayne Francis · 3 November 2008

Henry J said: Lower and zero are not synonymous.
You are saying this to someone that thinks something can be arbitrary and logical at the same time. So we can add "lower" and "zero" to words that SFB doesn't understand the meaning of.

DS · 3 November 2008

Of course speciation can occur in the absence of selection, that is in fact how allopatric speciation works. It might not be the only form of speciation, but it has been well documented and it does not require any selection in order to establish reproductive isolation. I could find references if anyone wants them, but I certainly am not going to waste my time providing references for the illiterate troll.

Of course selection has limitations, historical contingency for one. We have discussed this to death in months past. Once again, I could give references, but just read Gould if anyone wants examples.

Still no answers from corn cobby, just a lot of childish barking, poor grammar and incoherent arguments. The illiterate, microcephalic chimpanzee with attention deficit disorder and short-term memory loss has zero credibility at this point, so just ignore it's feces slinging, barking and general idocy.

Henry J · 3 November 2008

.… this reminds of some ancient civilizations who tried to build a ‘stairway to heaven’ your logic is that since i can take 10 steps i can walk around the world.

There are known barriers to walking around the world: Oceans, Mountain ranges, Deserts, Jungles.

it really is incumbent on YOU how are making extraordinary claims to show the extraordinary proof.

Assuming a barrier without evidence for its existence is illogical. Inferring that later life is descended from earlier life is not an extraordinary claim, given that we know that life reproduces, and that later generations can differ from earlier ones. Henry

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: To put this another way the word “red” is a human invention and classification. Even without it photons of the wavelength between 625nm to 740nm would still exist. Even without the word “species” there would still be populations of life that change via evolutionary processes, to include NS, to a point that they would not be able to breed with the original population. .... there is a little bit of difference between an 'arbitrary' naming convention such as red and terms which describe things which cannot be arbitrarily tagged. for instance water and ice cannot have an abitrary temperature boundary but colors can. ... so to say that phyla were invented by man is a deep misunderstanding of the term. nothing new here. woof woof.
SFB shows his creationist tactics again. As I said the term "Species" is like the term "Red" both are human categorization. Evolution, Speciation and photons of the wavelength between 625nm to 740nm all still exist with or without humans around to talk about them. The categories of term phyla, the names of phyla and the categorizing of life to these names is invented by man. Or do you propose that something else did? Does you're bible list the phylums and the members of each as handed down by "God"?

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: have no problem using. I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity. ... this whole: "I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity. " seems to be a reaction formation. seems to be an undertone of homosexuality here since it is often being brought up by the opposition here why is it an issue at all here. your side keeps bringing it up. that is curious.
Really, I'll have to tell the friends that I have that happen to also happen to be homosexual that some bi-polar idiot with mania thinks I have an underlying issue with them. You still haven't clarified what you meant by "hmmm". We are used to you moving the goal post and ignoring anything that shows you to be a liar. No reason to think that this situation is different. There is a bigger underlying reason why I don't have an issue with homosexuals. One that your creationist could not understand. I understand that gender, gender identity and gender preference isn't a black and white issue. Life shows us that each of these are independent. Though most people gender identity and gender preference closely matches stereotypical ideas there is a huge range. For example I know a female, I'll call her Jody, that is actually and XY female. Without any operations and only the use of hormone replacement therapy would would not be able to distinguish her from a normal XX female unless you performed a genetic test or detailed internal examination. She identified as a female, she liked guys but her actual gender was "ambigious" depending on how you classified "gender" if you say that "XY" is male and "XX" is female then she would be a male. But then what is a person that is "XXY"? If you define male as having testicles and females as having ovaries then she is neither because they never developed properly from gonads. If you define male as having a penis and a female as having a clitoris then you don't understand anatomy because the 2 structures are pretty much identical only differing in size. Would I be gay if I had a sexual relationship with Jody? I know I wouldn't be embarrass about it. 2,000 years ago no one would have known Jody to be anything but a female. Back then she wouldn't have had hormone replacement therapy so she would have been "flat chested" but there are plenty of women that are like that. I'm sure I am much more open minded then you are just by the way you present yourself here. You are quick to judge people but have a fear of being judged yourself. Lithium won't help much with that beyond the paranoia. Perhaps you should talk to your doctor about these traits of yours.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: Do you care to enlighten us on what you did mean then? Not many different ways you can interpret “hmmm” of yours. ... hmmm is an open ended response. if a psychotherapy client says ' i have trouble meeting new people' and the therapist says 'hmmm' it is just an encouragement for the patient to expound without leading to a specific direction.
I'm sure you have had a lot of psychotherapy in the past and I congratulate you for that if it was self motivated. You should also know that psychologist don't just sit there and listen without thinking. They form hypothesis while they listen to you. Oh wait that is right. Everything you hear and read just enters the brain and is just as quickly forgotten. You can't even form ideas properly. That explains a lot.
SFB a.k.a. cobby said: ... my hmmm immediately brought out a denial of homosexuality on your part. why was there a need for a denial if you are not threatened by the fact that you might be homo.
Did I deny it? I didn't make a reference one way or another. Read more carefully. From those posts you couldn't deduce my gender preference by my statements. You are the one using the more derogatory term of "homo" not me. Projection again? Would I be offended if someone thought me to be gay? Nope, do you know why? Because I have had a few casual friends that thought I was gay. Gave me a chuckle and I understand why they thought that but it is not offensive to me at all.
SFB a.k.a. cobby said: .... my hmmm could have been interpreted that there is a collusion between the both of you or that you know each other or that you are trying to flatter. well there could be hundreds of interpretations
But as normal SFB leave everything vague so he can back out of the comment. He has got caught a few times though. How is that "holographic morphological field theory" of yours going SFB? You tried to claim that you never said it was your idea but have failed to show that anyone else has made that claim.
SFB a.k.a. cobby said: ... but you had defend your non-homosexuality. very revealing indeed.
I don't defend my sexual preference. It is what is it is. You keep up your lying and deceitful tactics SFB no one falls for them anyway.

Dan · 3 November 2008

This is a thread concerning "Luskin and the ID movement on immunology: immune to evidence". Cobby has the strange idea that his/her comment
cobby said: this whole: "I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity. " seems to be a reaction formation. seems to be an undertone of homosexuality here since it is often being brought up by the opposition here why is it an issue at all here. your side keeps bringing it up. that is curious.
is somehow relevant to this thread. That is curious.

Dan · 3 November 2008

cobby said: so there ARE limitations [to natural selection]? what are they?
Natural selection acts only on reproducing things. For example, metal file cabinets cannot be produced by natural selection.

Wayne Francis · 3 November 2008

cobby said: I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity. .... would you be comfortable at a gay bar?
I was at a gay club about 5 weeks ago. Its called The Mars Bar. Good music and they have a good cabaret show there. Your question makes about as much sense as asking someone gay if they would be comfortable in a normal club or asking a white person if they would be comfortable in a club predominantly patronized by non whites. I'm comfortable in most places as long as the people are nice in those places. Probably wouldn't feel comfortable in an outlaw bikers club because I don't agree with how outlaw bikers conduct themselves as a whole. How about you SFB. Do you have any male gay friends? Would you go out to have a drink with them? Would you go to a "gay bar" with them for a drink? Would you go up on the dance floor and dance with them? Would you take dance lessons with them? (I've got a gay male friend that has helped me with some ball room dancing steps) Would you kiss them on cheek good bye? I'm guessing you'll ignore all these questions. But hey surprise me. Say "yes" to all of them. I can say yes to all of them.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said:
DaveH said:
SFB a.k.a. said: .… i do believe ‘no selection’ means ‘zero selection’ again this read problem appears.
Aaaand fail! Yes, "no selection" means "zero selection" but the point was about "lower speciation" in the presence of "zero selection", moron.
jobbie said somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
Any proof?? or just FAITH? Please tell us all about how the Sater and Jacobson paper you cited supports your position as outlined above.
""so rates of speciation would no doubt be much lower if no selection were operating.""
Oh my! SFB might have learned something!?!?!?! Yes if there was no selection pressures then speciation events would be much lower.
SFB a.k.a. cobby said: ... no sorry charlie. my point was that speciation rates would not be 'much lower' they would be non-existant if there were no selection. that was my point dummy. (really again like teaching my dog algebra) maybe if i dumb it down you will get it: woof, woooof. bow bow wow,
Bugger I was to quick in believing he could learn anything. For SFB little mind here is how speciation can occur without selection pressures.
  • You have population A that gets split into population B and C that become geographically isolated.
  • Each population will change via processes like random mutations.
  • These random mutations will not be identical in both populations.
  • With more of these random mutations the populations B and C will diverge further and further apart
The different selection pressures just dictate if a one trait is more likely to appear in subsequent generations then another. Of course the in real world you can't have no selection pressures. For example if I get a set of mutation that causes me to have cancer from birth this set of mutations will never get past on to my children because I'll not live long enough to have children. You know I was SOOO hopeful that SFB actually learned something for once. But he let me down. I was stupid for thinking he could learn.

Wayne Francis · 3 November 2008

cobby said: jobbie said somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere. Any proof?? or just FAITH? Please tell us all about how the Sater and Jacobson paper you cited supports your position as outlined above. .... out of context! how deceptive of you. paste my entire comment!
You claiming that he quote mined? Here is your entire post as it can be found here
SFB a.k.a. cobby said: Remember that I pointed out that the troll was arguing against it’s own position. It has now effectively proven that the instructions in DNA are soley responsible for producing an organism. ... I was just told nothing can be proven If those instructions are disrupted then the organs are usually not correctly produced, If however the instructions come from some “mysterious unknown factor” outside the body, then the organs should form just fine outside the body. ... no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape. ... you are basically saying 'gradients-did-it'. attributing the process to unmeasurable, untestable forces. aka pseudoscience.
Please show us how the statement was quote mined. What all important context was removed that totally changes the meaning of your statements SFB?

DS · 3 November 2008

Wayne,

You are indeed correct. In fact, as I pointed out previously, the neutral theory predicts what the rate of genetic divergence should be in the absence of selection.

You are also correct about the troll of many names. It's almost pathological inability to learn is no doubt responsible for the fact that it has been shown to be wrong about every claim that it has made here. Funny, you would think that it would be right about something eventually just by chance, but after 2250 posts it still hasn't happened yet.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: Even if you only count those experiments as 1 change there is no actual barrier for millions of changes to happen. .… you know that from experimentation or FAITH???
Can you count to 1 billion SFB? Maybe not. Going above 5 is probably a barrier for you because it involves counting fingers on your other hand and then you'll loose tract because your pointing finger can't be used to point to itself. For the rest of us I'm pretty sure that none of us have counted to even 1,000 but there is nothing preventing us from doing so. We can see no barrier in speciation either. We have caused speciation to occur in the lab Anyway those that care to learn but have not seen the studies a brief overview with many papers, demonstrating speciation in the lab, can be found at Observed Instances of Speciation over at talkorigins.org
SFB a.k.a. cobby said: ..... of course any answer to the above is vigorously avoided.
No SFB your questions are very rarely avoided. Like I have done here they are completely refuted with many references so people can investigate for themselves. The only avoidance being done here by you when it comes to learning.

DS · 3 November 2008

Everyone should notice that the troll of many names is effectively arguing against it's own position again.

It has claimed repeatedly that there is no evidence that natural selection is important for speciation and cladogenesis and therefore "Darwinism" is wrong. Of course it will deny this, as it has denied everything else it has ever written, but the evidence is there for all to see.

Now it claims that speciation cannot occur in the absence of selection. It will probably try to deny this as well, but who cares? Well, if speciation has occurred, which it demonstrably has, and natural selection is required for speciation as the troll claims, then ipso facto, selection must have been important for speciation and Darwin was exactly right.

Must be hard trying to remember which side of the argument you are on when you just make shit up. BOW WOW, fetch that jumping monkey.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: ... i really think the problem with the opposition here is their abysmal reading skills. and now they say that the planet 'pluto' was created by humans since the word was created by humans.
No SFB we are saying pluto would be there regardless of what we called it or if we where ever here. You are the one trying to get us to say stuff like that. Now, since you have not got anyone to make these types of statements, you just make shit up.
SFB a.k.a. cobby said: ... see the Darwinian theory is so full of holes they have to revert to these unbelieveable contortions of speech and logic when ever the glaring inconsistencies of their theory comes to the surface. so unscientific!
Tell us. What holes? What holes does the modern theory of evolution have that break the theory? All theories have holes. If they didn't then no science would ever be done. We would know all there is and there would be no more to learn.
SFB a.k.a. cobby said: ... and their greatest mantra of FAITH: there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers!
Show us a barrier. There is no barrier to traveling around the world. Some routes are easier then others but you can still do it. There might be forms of life that would be so unlikely to happen that they never actually will but that doesn't mean that all life is like that. Show us one form of life that doesn't fit into the nested hierarchy. One form of life that can not be linked to another form of life that can be deemed closely related. You may find one. But as of yet we have not found this magical pink unicorn of yours and science won't stop working just because you think it is out there.
SFB a.k.a. cobby said: ... quite a religious commitment they have. their steadfastness has to be admired!
Better then SFB pulling shit out of his ass and saying "See this shit!!! Evolution didn't really happen!" We are on the side of science because science has shown itself to be very good at describing the world around us, making predictions and us benefiting from research based on those predictions. SFB would suggest that if you feel ill then you should have some of your blood drained to get rid of your illness.

Malcolm · 3 November 2008

cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said:
Henry J said: Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he's talking about, let alone what evidence might support the notion.
... well since your FAITH has told you there are none, to you it is a case closed and no reason to think about it or even go looking for a barrier, right?
Who said there is no barriers. What we say is since life all has a common origin that there is no barriers between the forms of life we see. Its like looking a street map of the USA. You can get from one spot to another by using the roads. Using this analogy on evolution you would expect to see lots of streets connected to no other streets. But we don't see this. When we look we see a connections. Now is about the time that SFB will pull out the "God of the Gaps" hypothesis. He, like Behe, would never be happy until every genetic change of every organism in the entire world could be shown. Even then SFB's religious view will have him claim it is some lie perpetrated by Satan.
SFB a.k.a. cobby said: .... and since almost all if not all physical systems have limits would it not be logical to assume that there just ** might ** be one for this accumulation?
Really? Tell us is there a limit to the mass of a black hole beyond the available mass of the universe? Give us some of the limits you think apply to biological systems. We do agree there are limits based on the environment. For example we don't believe you could ever have an insect the size of an elephant on Earth. The limits on different forms of life don't seem to be between the different forms of life. Don't think in 2d here either. You have to travel back in time to the LCA then forward to the other form of life you are looking at. ie we don't expect a dog to give birth to a cat but if we walk back about 42 million years for both species we would see a slow change from dogs and cats back to something like miacis. Look at the Whale evolution Wikipedia article and tell us where you have a problem with any of the whale evolution. Oh wait they would all have different holographic morphological fields wouldn't they! Your "God" must be very busy pumping out all these fields for every form of life in the world. I mean I've never seen 2 multicellular organisms exactly identical down to to the cellular level. They must all have their own unique "holographic field" defined for them.
SFB a.k.a. cobby said: .... nahhhh! why try to prove something your FAITH has told you is true!
SFB lack of understanding how science has built upon past findings does not constitute "FAITH" in the religious meaning of the word. SFB here must never take any doctors advice because he would have to take it on "FAITH". Me I take a doctors advice on faith with a small "f". The more serious the situation the more research I would do. When 99.999% of all biologist say that evolution occurs you can take it on faith with reasonable certainty. But this is where science is good. You don't have to take it on faith. You can look at the studies and, if you put the effort in, reproduce the studies so that you can see for yourself. This is where SFB has a problem because not only does he not want to have faith in all the scientist out there but he refuses to do any of the work to learn why science has come up with the theories it has. Instead he just listens to his pastor who also knows nothing about science claim that evolution isn't true because it conflicts with his literal reading of his holy book. A better word then "faith" when it comes to mainstream science is "belief"

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
This comes from the SFB that repeatedly admits that he can't read more then 2 lines of an explanation. But by all mean, Please do! Walk us through it. This doesn't mean we won't show it to be wrong from the first sentence on. Showing you how your logic fails isn't insulting. Insulting is what we do along with showing you that you are wrong because you have shown yourself to be a lying deceitful willfully ignorant arrogant troll the entire time you have been posting here. Remember last time you did this you made claims that morphology was controlled by some "holographic construction" and that this hologram did not work in the dark. Pick your words wisely SFB. I look forward to showing how everything you say is utter crap.

Wayne Francis · 3 November 2008

SFB a.k.a. cobby said: Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he’s talking about, let alone what evidence might support the notion. .... this reminds of some ancient civilizations who tried to build a 'stairway to heaven' your logic is that since i can take 10 steps i can walk around the world. it really is incumbent on YOU how are making extraordinary claims to show the extraordinary proof. at least thats how Sagan looked at it.
SFB shows doesn't get analogies. Tell me SFB what stops you from going to the moon? Has no one ever been there? Just because you can't jump that high you think no one could figure out how to get to the moon. Well lucky science does give up as easy as you do. Life doesn't either. Life might have to walk, climb and swim its way but it does seem capable of getting everywhere on the Earth. Hell it even digs and flies. For anyone interested read up on Dave Kunst, the first man to "walk around the earth".

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: Bobby himself makes the more outrageous claims and fails, time after time, to show the extraordinary evidence. ... what was this extraordinary claim that i made? are you hallucinating again?? .... however YOU claim there are no limitations as to what NS can accomplish. I think THAT is an extraordinary claim that needs some validation
Where did anyone say there is "no limitations as to what NS can accomplish" What we said is that all life that we see could have evolve from a common ancestor using all the known mechanisms of evolution. Big difference. One thing that would drastically change biology and the theory of evolution would be to find some type of life that couldn't seem to fit in the nested hierarchy of the tree of life. Until you show us that magical pick unicorn we'll keep going with what science show us. You keep having warped ideas about what evolution actually is SFB.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: As usual, Bobby has failed to represent my beliefs and claims accurately when stating that there are no limitations to what NS can accomplish. ... so there ARE limitations? what are they? what are those barriers?
Well how can I put this in tiny words for SFB? Unfortunately for him you can't describe these concepts in tiny words. How can we put "limits" on evolution. This is like someone in 2,000 B.C. looking at the moon and saying "we'll never be able to touch the moon" The only place you'll see "Limits to evolution" is on creationist sites. This is only because they have finally realized evolution does occur and they are shifting the goal post. They lag severely behind the science. They'll claim only "micro-evolution" has occurred but either never define what "macro evolution" is, ignore the evidence of "macro evolution" or move the goal post and say something like we have never observed a new phyla be produced. "Micro and Macro evolution" are terms we use to classify changes. Changes that don't effect breeding/reproduction success are often called "micro evolution". Changes that do effect breeding are often labeled as "macro evolution". Since it is a human classification there are instances where it fails. If I cause a change in 1 base pair in one population that changes the scent of the individuals so that members of the original population will not breed with the new population is that macro or micro? I just say it is evolution. If I change 10 million base pairs that are all neutral but are passed down to subsequent generations is that macro or micro evolution? If you are going to claim "irreducible complexity" then you should read up on the failure of the most popular claims of "blood clotting cascade" or "Bacterial Flagellum" then you really need to keep up with the science. Both of these where deemed incapable of being reached, genetically, via evolution. It did not take long before both where shown to be very doable by evolution.

DaveH · 4 November 2008

jobbie said: jobbie said somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere. Any proof?? or just FAITH? Please tell us all about how the Sater and Jacobson paper you cited supports your position as outlined above. .... out of context! how deceptive of you. paste my entire comment!
I do beg your pardon
(A)nd again the science stopping trolls when presented with an idea like a morphic field that guides development which is supported by many mainstream scientists go thru their ritualistic pounding of chests, spitting and gritting their teeth. ‘no new ideas here’ they shout and spit. … the anti-science trolls do not understand that somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere. … now of course there could be other storage methods in the DNA other than the 4 positions or the info could be obtained from an external source or done in a way yet unknown.
[The "elipses" are jobbie's in the original.] That strikes me as an extraordinary claim. Do you have any extraordinary data to back it up??? Or just FAITH???????

cobby · 4 November 2008

... sorry fans, I simply do not have time to respond to all of your requests for comments. Obviously the demand for my views and thoughts are very high. but it is fun to throw the stick and watch SO many of my canine friends go chasing. now I know you saw me move my arms like i threw something but did i really? are you still sniffing the ground looking for it?

cobby · 4 November 2008

there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.

.... you disagree with the above statement??

... ps. I will respond to the tremendous demand for my thoughts in reverse chronological order.

cobby · 4 November 2008

The only place you’ll see “Limits to evolution” is on creationist sites.

We do agree there are limits based on the environment. For example we don’t believe you could ever have an insect the size of an elephant on Earth.

... Wayne have you been drinking again? Seems like you are contradicting yourself up above.

... anyhow Wayne, I just can wade thru all your dribble. i perused your rantings a bit but really its just too confused to really even respond too.

cobby · 4 November 2008

... general response to all the trolls:

... so you do indeed agree with my point NOW that evolution has limits and barriers. glad i could elucidate that for you.

DS · 4 November 2008

Who cares what this lying scum bag has to say? It always misrepresents others, claiming that they said things they didn't. It never presents any evidence for the bull shit it makes up. It always argues against itself. forgetting which side of the argument it is supposed to be on. It continues to bark and scream while calling others childish. It still can't seem to be able to read any post over two lines.

It still hasn't answered a single question about the magic invisible hologram or any of the other crap that it's pee brain has spewed forth. It still has not shown any evidence at all that it understands enzymes or transcription factors, even though it could have taken an entire college course in the time it has spent here raving like a lunatic.

Now of course we can add selection, allopatric speciation and the neutral theory to the list of things that it doesn't understand. The list is getting longer faster that it can spew forth it's vile filth. Still hasn't contaminated any other threads at least.

cobby · 4 November 2008

DS said: Who cares what this lying scum bag has to say? It always misrepresents others, claiming that they said things they didn't. It never presents any evidence for the bull shit it makes up. It always argues against itself. forgetting which side of the argument it is supposed to be on. It continues to bark and scream while calling others childish. It still can't seem to be able to read any post over two lines. It still hasn't answered a single question about the magic invisible hologram or any of the other crap that it's pee brain has spewed forth. It still has not shown any evidence at all that it understands enzymes or transcription factors, even though it could have taken an entire college course in the time it has spent here raving like a lunatic. Now of course we can add selection, allopatric speciation and the neutral theory to the list of things that it doesn't understand. The list is getting longer faster that it can spew forth it's vile filth. Still hasn't contaminated any other threads at least.
..... Dave Stanton! Go wash your mouth out! Dont you have anything better to do?

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: ... sorry fans, I simply do not have time to respond to all of your requests for comments. Obviously the demand for my views and thoughts are very high. but it is fun to throw the stick and watch SO many of my canine friends go chasing. now I know you saw me move my arms like i threw something but did i really? are you still sniffing the ground looking for it?
Translation : Shit that is a lot of post that show me to be an ignorant ass, quick I better say something that only idiots would think that I'm cool after reading
SFB never responds to anyones comments, well not intelligently. SFB thinks he's special, like that kid that didn't ever take a bath and had no social skills in high school. He thinks he is popular because we are constently showing how stupid he is. SFB couldn't get more ignorant and arrogant if he tried.

cobby · 4 November 2008

... Dave Stanton:

can you clarify? Do you believe evolution has barriers or not?

cobby · 4 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: ... sorry fans, I simply do not have time to respond to all of your requests for comments. Obviously the demand for my views and thoughts are very high. but it is fun to throw the stick and watch SO many of my canine friends go chasing. now I know you saw me move my arms like i threw something but did i really? are you still sniffing the ground looking for it?
Translation : Shit that is a lot of post that show me to be an ignorant ass, quick I better say something that only idiots would think that I'm cool after reading
SFB never responds to anyones comments, well not intelligently. SFB thinks he's special, like that kid that didn't ever take a bath and had no social skills in high school. He thinks he is popular because we are constently showing how stupid he is. SFB couldn't get more ignorant and arrogant if he tried.
... Wayne, why do you waste so much time here?

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere. .... you disagree with the above statement??
Yes we all disagree with your "holographic-like field" hypothesis that says morphological information isn't controlled by DNA. You aren't very bright are you SFB, we've answered this specific question for like 12 pages and in general for about 70 pages.
SFB a.k.a. cobby said: ... ps. I will respond to the tremendous demand for my thoughts in reverse chronological order.
Great SFB, I so like tearing your stupid illogical hypothesises to shreds.

Wayne Francis · 4 November 2008

SFB a.k.a cobby said: The only place you’ll see “Limits to evolution” is on creationist sites. We do agree there are limits based on the environment. For example we don’t believe you could ever have an insect the size of an elephant on Earth. ... Wayne have you been drinking again? Seems like you are contradicting yourself up above.
SFB doesn't get it. There isn't a genetics control the size of an insect. Genetics can make insects grow larger. The fact that we only see insects up to a given size is not a genetic limitation but an environmental limitation. IE insects that grow to large can't move properly. Change the environment, IE introduce insects to a lower gravity environment, and the insects will accumulate changes that are allowed by that new environment. IE lower gravity allows them to grow larger because they would still be able to move. I'd say you should try reading properly instead of trying to read what you want into what someone else writes but you can't because you are creationist troll that thinks lying for Jesus is OK.
SFB a.k.a cobby said:... anyhow Wayne, I just can wade thru all your dribble. i perused your rantings a bit but really its just too confused to really even respond too.
Translation : I started reading your posts that exposed me as an ignorant lying and arrogant troll and couldn't refute any of it so I'll just say "I know you are but what am I"

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: ... general response to all the trolls: ... so you do indeed agree with my point NOW that evolution has limits and barriers. glad i could elucidate that for you.
No SFB you are trying to twist people words and quote mine. With all the life that we see there is no limits between them. Given any 2 organism on Earth you can trace both back to a LCA, Last Common Ancestor. The genetic changes between each of the organisms and the LCA are all explainable by natural means, minus any organism we might have genetically altered.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said:
DS said: Who cares what this lying scum bag has to say? It always misrepresents others, claiming that they said things they didn't. It never presents any evidence for the bull shit it makes up. It always argues against itself. forgetting which side of the argument it is supposed to be on. It continues to bark and scream while calling others childish. It still can't seem to be able to read any post over two lines. It still hasn't answered a single question about the magic invisible hologram or any of the other crap that it's pee brain has spewed forth. It still has not shown any evidence at all that it understands enzymes or transcription factors, even though it could have taken an entire college course in the time it has spent here raving like a lunatic. Now of course we can add selection, allopatric speciation and the neutral theory to the list of things that it doesn't understand. The list is getting longer faster that it can spew forth it's vile filth. Still hasn't contaminated any other threads at least.
..... Dave Stanton! Go wash your mouth out! Dont you have anything better to do?
SFB shows that the truth sometimes does bother him. Oh and SFB "Don't" has an apostrophe between the n and t you ignorant ass.

phantomreader42 · 4 November 2008

Because Bobby is a lying sack of shit. It's that simple. That's the whole reason he keeps babbling endlessly, he's just a lying sack of shit. If you're waiting for him to say something of substance, you'll be waiting until the day you die.
PvM said: Let's first address why Bobby chose to misrepresent me? Why Bobby?
cobby said: As usual, Bobby has failed to represent my beliefs and claims accurately when stating that there are no limitations to what NS can accomplish. ... so there ARE limitations? what are they? what are those barriers?

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: ... Dave Stanton: can you clarify? Do you believe evolution has barriers or not?
Yes I'm sure there are some things evolution can't do but all life form on the Earth did have an LCA with every other life form. So while there are barriers there is no barrier that can be found between life forms on Earth. So the "barriers" topic does not help your stupid hypothesis.

Dan · 4 November 2008

cobby said: The only place you’ll see “Limits to evolution” is on creationist sites.
There are many limits to evolution. For example, evolution will never produce an organism that violates energy conservation. This is so obvious that apparently only creationists congratulate themselves for noticing it.

DS · 4 November 2008

So now we can add historical contingency to the list of things that corn cobby doesn't understand. And once again, the fool of many names has no answers and no explanations, just mindless complaints about the language it so justly deserves. I wonder how that thing with the light socket worked out for it.

Robin · 4 November 2008

Henry J said:

The whole taxonomy system was intelligently designed.

That was before evolution was understood, though. That ranking system can interfere with understanding when talking about the earliest member of a taxon (when the "higher" ranked taxa sort of blur into each other), or when one realizes that there are a half dozen or more significant branches between two consecutive ranks, requiring insertion of lots of super-group or sub-group ranks. Henry
True, but I would still say that intelligence went into it even if a lot of information was (and likely still is) unknown.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: ... sorry fans, I simply do not have time to respond to all of your requests for comments. Obviously the demand for my views and thoughts are very high. but it is fun to throw the stick and watch SO many of my canine friends go chasing. now I know you saw me move my arms like i threw something but did i really? are you still sniffing the ground looking for it?
Translation : Shit that is a lot of post that show me to be an ignorant ass, quick I better say something that only idiots would think that I'm cool after reading
SFB never responds to anyones comments, well not intelligently. SFB thinks he's special, like that kid that didn't ever take a bath and had no social skills in high school. He thinks he is popular because we are constently showing how stupid he is. SFB couldn't get more ignorant and arrogant if he tried.
... Wayne, why do you waste so much time here?
Its not a waste, I'm pretty good at multi tasking. I'm listening to some Black Eye Peas while testing some server code I wrote. Not only do I get some work done, making a nice chunk of change, but I get to show you to be a lying deceitful arrogant and willfully ignorant troll while also learning new stuff on other posts. Hell even describing the same shit over and over to you only makes my understanding of the topics even more solid. I used to tell my students that you can learn something from anyone. This even holds true for you. I've learned that every time I thought you couldn't get any more stupid you prove me wrong.

Robin · 4 November 2008

cobby said: Bottom line, there is no Kingdom, Phylum, Class, or Order that was created by NS. The organism groups in those greater groups were, but that’s a different subject. ... then species were also created by man and not NS??
The category "species" was most definitely created by man. And that category is not very intelligently designed.

cobby · 4 November 2008

ts not a waste, I’m pretty good at multi tasking. I’m listening to some Black Eye Peas while testing some server code I wrote. Not only do I get some work done, making a nice chunk of change, but I get to show you to be a lying deceitful arrogant and willfully ignorant troll while also learning new stuff on other posts.

.... you do this at work??

cobby · 4 November 2008

...trolls you admit there are limits to evolution. well finally. so now the next question

.... how do we know that just for example: the whale did not exceed the limits of what evolution can do???

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: ts not a waste, I’m pretty good at multi tasking. I’m listening to some Black Eye Peas while testing some server code I wrote. Not only do I get some work done, making a nice chunk of change, but I get to show you to be a lying deceitful arrogant and willfully ignorant troll while also learning new stuff on other posts. .... you do this at work??
SFB quickly forgets that how to figure out what time it is in other parts of the world. But yes when I have spare time at work I'll answer posts too. Currently I'm working, but at home in a recliner at my desk. I know it is hard for you to do things like this at work. Flipping burgers for minimum wage doesn't mix well with interacting with blogs and all. Perhaps if you didn't take the attitude of not reading more then 2 sentences in a text book you could have had a job where you don't have to live from pay check to pay check.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: ...trolls you admit there are limits to evolution. well finally. so now the next question
Care to tell us in your own words what you think these limits are? I bet they aren't at all what we have been telling you. I won't hold my breath because SFB can't grasp simple concepts let alone a concept like this.
SFB a.k.a. cobby said: ... how do we know that just for example: the whale did not exceed the limits of what evolution can do???
Because we don't see anything that can't be explained by evolution in the whale. Perhaps you would like to point us out to something that could not have evolved on any cetaceans you care to pick.

phantomreader42 · 4 November 2008

cobby said: ...your logic is that since i can take 10 steps i can walk around the world.
Well, what's stopping you from walking around the world? The ocean. the ocean is a barrier that actually exists in the real world. You can see it, touch it, measure it, examine the water in it. The ocean has observable, predictable effects on things. It's real. How does this compare to these "barriers" that you claim prevent evolution? You won't say what these "barriers" are, where they are, how big they are, what exactly they prevent, or how. You just babble and screech about barriers that your delusions demand, without the slightest speck of evidence. IF there were such "barriers", you'd be able to offer some details on them, but you've never even tried. In fact it probably won't be long before you start pretending you never even mentioned these imaginary "barriers". Of course, it's not like you're capable of anything more than flinging shit in every direction. If you had the ability to support anything you've said, you would've done it by now. You haven't. Instead you keep twisting everything in knots and pretending you didn't make any of the countless idiotic statements you've been polluting this site with. It's painfully obvious to everyone here that you're nothing more than a lying sack of shit. You don't know what you're talking about, and you'd rather die than learn anything. What a pathetic hollow shell of a man you are.

DS · 4 November 2008

"You won’t say what these “barriers” are, where they are, how big they are, what exactly they prevent, or how. You just babble and screech about barriers that your delusions demand, without the slightest speck of evidence."

I predict that corn cobby will now launch into it's patented diatribe about how the blowhole could not possibly have migrated to the top of the head in only 50 million years. It will jump up and down and scream and bark and blow shit out it's blow hole, but it will never give any explanation and it will never present any evidence. If it does give a reference it won't have anything to do with the topic. Just ignore it and it will go away.

After all, it hasn't bothered to support any of the other shit it made up. Why should it start now? Oh and don't give it any equations either. It doesn't understand math any more than it does biology. Any guesses as to why it hasn't tried to explain historical contingency or transcription factors yet?

cobby · 4 November 2008

But yes when I have spare time at work I’ll answer posts too.

... does your employer know you are doing that? Have you asked it if is OK to surf on company time? I would fire you.

cobby · 4 November 2008

how do we know that just for example: the whale did not exceed the limits of what evolution can do???

Because we don’t see anything that can’t be explained by evolution in the whale

... hmmm

cobby · 4 November 2008

.....Dave Stanton, what is your defecation obsession caused by?

cobby · 4 November 2008

Well, what’s stopping you from walking around the world? The ocean. the ocean is a barrier that actually exists in the real world.

.... trolls: what is stopping us from sailing from portugal to india by sailing straight west??

cobby · 4 November 2008

Perhaps if you didn’t take the attitude of not reading more then 2 sentences in a text book you could have had a job where you don’t have to live from pay check to pay check.

.... actually i am independently wealthy. self-made man and all of that! despite not getting out in 87 and getting out in late 99 it all worked out pretty well. well now that i think of it i did not miss much in 2000. however bush completely destroyed my method. completely missed the post iraq thing. now its just boring CDs. well i am glad i wasnt in for this last one!

Dave Lovell · 4 November 2008

cobby said: Well, what’s stopping you from walking around the world? The ocean. the ocean is a barrier that actually exists in the real world. .... trolls: what is stopping us from sailing from portugal to india by sailing straight west??
Either Central America or the fact that "we" don't have a boat, depending on which stupidly literal tangent you plan to shoot off along next

cobby · 4 November 2008

Dave Lovell said:
cobby said: Well, what’s stopping you from walking around the world? The ocean. the ocean is a barrier that actually exists in the real world. .... trolls: what is stopping us from sailing from portugal to india by sailing straight west??
Either Central America or the fact that "we" don't have a boat, depending on which stupidly literal tangent you plan to shoot off along next
...well yes the 'americas' are stopping us. would you say the 'americas' are a barrier?

fnxtr · 4 November 2008

Holy cow, is this nutjob still ranting? There's no substance here, it's just pushing people's buttons. It knows it's an ignorant shit and doesn't care, it just wants attention.

Sad, really.

cobby · 4 November 2008

fnxtr said: Holy cow, is this nutjob still ranting? There's no substance here, it's just pushing people's buttons. It knows it's an ignorant shit and doesn't care, it just wants attention. Sad, really.
... excellent comment! very intellectual and academic! (nice mouth too!)

PvM · 4 November 2008

Pray tell bobby: How would you intend to recognize something intellectual and academic since you seem to be somewhat allergic to it? Is it the rash :-)
cobby said: ... excellent comment! very intellectual and academic! (nice mouth too!)

PvM · 4 November 2008

A very valid observation, strengthened by both genetic and fossil evidence. Hmm....
cobby said: how do we know that just for example: the whale did not exceed the limits of what evolution can do??? Because we don’t see anything that can’t be explained by evolution in the whale ... hmmm

PvM · 4 November 2008

Irony alert.... But the question is a good one, why do real scientists spend quite a bit of time exposing the logical and intellectual fallacies behind Bobby's claims? It's all about education through example... Duhhh
cobby said: ... Wayne, why do you waste so much time here?

PvM · 4 November 2008

What is a 'holographic-like' filed... and yes I disagree with the 'somehow at least approximate dimensions for this is stored somewhere'. What nonsense and ignorance.
cobby said: there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere. .... you disagree with the above statement?? ... ps. I will respond to the tremendous demand for my thoughts in reverse chronological order.

PvM · 4 November 2008

Sure, anything has limits, but the real question is: Are there any barriers found in life which cannot be explained by evolution and the answer is simply: No. Of course, some, like Bobby, may confuse the fact that science does not have all the answers with the existence of such barriers. Confusing ignorance with barriers is a common mistake made by ID creationists. The problem is that Bobby has done nothing to make a coherent, let alone well reasoned, argument.
cobby said: ... general response to all the trolls: ... so you do indeed agree with my point NOW that evolution has limits and barriers. glad i could elucidate that for you.

PvM · 4 November 2008

Have I missed your response to my question?
PvM said: Let's first address why Bobby chose to misrepresent me? Why Bobby?
cobby said: As usual, Bobby has failed to represent my beliefs and claims accurately when stating that there are no limitations to what NS can accomplish. ... so there ARE limitations? what are they? what are those barriers?

Henry J · 4 November 2008

The question isn't whether there are barriers (evolution hasn't produced wheels on axles, microchips, or jet airplanes, afaik), but whether there are barriers between early life and known later life.

cobby · 4 November 2008

PvM said: Pray tell bobby: How would you intend to recognize something intellectual and academic since you seem to be somewhat allergic to it? Is it the rash :-)
cobby said: ... excellent comment! very intellectual and academic! (nice mouth too!)
... well that comment was very junior high. not even a clever slam. why do you waste your time just slamming people. lets talk about the topics you avoid.

cobby · 4 November 2008

but whether there are barriers between early life and known later life.

... how could YOU tell if there were such barriers?

PvM · 4 November 2008

You are projecting again my dear friend
cobby said:
PvM said: Pray tell bobby: How would you intend to recognize something intellectual and academic since you seem to be somewhat allergic to it? Is it the rash :-)
cobby said: ... excellent comment! very intellectual and academic! (nice mouth too!)
... well that comment was very junior high. not even a clever slam. why do you waste your time just slamming people. lets talk about the topics you avoid.

PvM · 4 November 2008

You tell us...
cobby said: but whether there are barriers between early life and known later life. ... how could YOU tell if there were such barriers?

cobby · 4 November 2008

PvM said: You tell us...
cobby said: but whether there are barriers between early life and known later life. ... how could YOU tell if there were such barriers?
... stumped?? It YOUR theory not mine.

PvM · 4 November 2008

On the contrary, you 'argument' is that evolution has barriers and that such barriers fail to explain such things as embryological development or the evolution of let's say the whale (if I remember correctly you were somewhat confused about the evolution of the blowhole?) If there were barriers, they were obviously not crossed. The question thus becomes, so what? As others have pointed out, evolution has failed to evolve 'wheels', a very efficient method of locomotion. But of course, since evolution failed to evolve so many things, it hardly has anything to say about what evolution can and does achieve. Hope you can finally appreciate this fine distinction?
cobby said:
PvM said: You tell us...
cobby said: but whether there are barriers between early life and known later life. ... how could YOU tell if there were such barriers?
... stumped?? It YOUR theory not mine.

cobby · 4 November 2008

how do we know that just for example: the whale did not exceed the limits of what evolution can do???

Because we don’t see anything that can’t be explained by evolution in the whale.

.... Ptolemy felt the same way about his theory. It explained everything. Hmmm.... so if we do not see anything that is not predicted by our theory then the theory is true? How convenient! So the advocates of the theory that invisible pink unicorns live in the center of the earth have a valid theory since they do not see anything to the contrary??

... how do we know there was enough time for the whales to evolve??

PvM · 4 November 2008

Sure, as you point out, evolution may be wrong, such is science. However, you have failed to present any reasoned arguments beyond arguments from ignorance, that show that evolution is wrong. How do we know that the whale did not exceed the limits of what evolution can do? Simple 1. The whale exists 2. The mutation rates to explain the evolution of the whale are well within what is observed 3. Fossil evidence shows support for evolution 4. Embryological evidence shows support for evolution How do we know that the time was insufficient? Bobby won't tell.
cobby said: how do we know that just for example: the whale did not exceed the limits of what evolution can do??? Because we don’t see anything that can’t be explained by evolution in the whale. .... Ptolemy felt the same way about his theory. It explained everything. Hmmm.... so if we do not see anything that is not predicted by our theory then the theory is true? How convenient! So the advocates of the theory that invisible pink unicorns live in the center of the earth have a valid theory since they do not see anything to the contrary?? ... how do we know there was enough time for the whales to evolve??

cobby · 4 November 2008

1. The whale exists

.... true

2. The mutation rates to explain the evolution of the whale are well within what is observed

.... how did you come to that conclusion?? FAITH??

cobby · 4 November 2008

How do we know that the time was insufficient?

... at this time we do not know.

PvM · 4 November 2008

Observation
cobby said: 1. The whale exists .... true 2. The mutation rates to explain the evolution of the whale are well within what is observed .... how did you come to that conclusion?? FAITH??

PvM · 4 November 2008

We do know that given the data and our present day knowledge, there is no reason to presume that time was insufficient. Duhh
cobby said: How do we know that the time was insufficient? ... at this time we do not know.

Henry J · 4 November 2008

Is Ahab still chasing that whale? Huh.

cobby · 4 November 2008

We do know that given the data and our present day knowledge, there is no reason to presume that time was insufficient.

... so there is no reason to assume it IS sufficient either. therefore the theory that whales evolved thru NS is not a validated theory and should be taught as such.

PvM · 4 November 2008

That's a silly position since there is data to support evolution and thus there is a reasonable reason not to reject it given the evidence. And furthermore, you seem to be once again, confused about science, validation, proof and falsification. What's new...
cobby said: We do know that given the data and our present day knowledge, there is no reason to presume that time was insufficient. ... so there is no reason to assume it IS sufficient either. therefore the theory that whales evolved thru NS is not a validated theory and should be taught as such.

PvM · 4 November 2008

Ignorance repeats itself, just like history..
Henry J said: Is Ahab still chasing that whale? Huh.

cobby · 4 November 2008

and thus there is a reasonable reason not to reject it given the evidence.

... sorry charlie. thats not science. because there is not evidence to reject a theory does not mean the theory is valid. remember your friend, falsification. you MUST have a test that can go 2 ways: what is seen if the theory is true and what is seen if it is not true. if we are not able to run this test it is a nice hypothesis and a nice world view and a nice philosophy, but sorry charlie it is NOT science.

... you wouldnt happen to have this little test hidden away somewhere? could we see this test as applied to whale evolution mutation speed.

.... i will not hold my breath.

PvM · 4 November 2008

No,the theory is valid because of the evidence and since you admitted that there is no evidence that evolution is wrong, all we have is ignorance. You present your evidence. I am not holding my breath because if history repeat itself, you will refuse, hide, obfuscate. Ah, the smell of ignorance in the morning.. Love it.
cobby said: and thus there is a reasonable reason not to reject it given the evidence. ... sorry charlie. thats not science. because there is not evidence to reject a theory does not mean the theory is valid. remember your friend, falsification. you MUST have a test that can go 2 ways: what is seen if the theory is true and what is seen if it is not true. if we are not able to run this test it is a nice hypothesis and a nice world view and a nice philosophy, but sorry charlie it is NOT science. ... you wouldnt happen to have this little test hidden away somewhere? could we see this test as applied to whale evolution mutation speed. .... i will not hold my breath.

DaveH · 4 November 2008

jobbie said: somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
... you wouldn't happen to have a little test hidden away somewhere? could we see this test as applied to reality? .... i will not hold my breath.

PvM · 4 November 2008

Good choice, Bobby tends to be somewhat light on 'tests', although he has worse problems to deal with.
DaveH said:
jobbie said: somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
... you wouldn't happen to have a little test hidden away somewhere? could we see this test as applied to reality? .... i will not hold my breath.

cobby · 4 November 2008

No,the theory is valid because of the evidence and since you admitted that there is no evidence that evolution is wrong, all we have is ignorance. You present your evidence.

...hmmm whoah I did not say the theory is WRONG. I said there was insufficient evidence to call it undeniably valid. and again of course evolution is a fact. again you are conflating. my point is that there is insufficient data to say that whales evolved thru NS.

... how do we know there was enough time for the whales to evolve thru NS?

cobby · 4 November 2008

... could whales have evolved from land animals in 10,000 years??

cobby · 4 November 2008

PvM said: Good choice, Bobby tends to be somewhat light on 'tests', although he has worse problems to deal with.
DaveH said:
jobbie said: somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
... you wouldn't happen to have a little test hidden away somewhere? could we see this test as applied to reality? .... i will not hold my breath.
out of context

PvM · 4 November 2008

Yawn, as I said, there are worse problems for Bobby to deal with. Guess his holographic-like statement suddenly has lost much of its appeal to him. Why not retract it, or clarify it. Either way, Bobby is in trouble...
cobby said:
PvM said: Good choice, Bobby tends to be somewhat light on 'tests', although he has worse problems to deal with.
DaveH said:
jobbie said: somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
... you wouldn't happen to have a little test hidden away somewhere? could we see this test as applied to reality? .... i will not hold my breath.
out of context

PvM · 4 November 2008

Hard to tell. But we are not talking about 10,000 years now are we? Unless Bobby is a closet YEC'er...
cobby said: ... could whales have evolved from land animals in 10,000 years??

cobby · 4 November 2008

Yawn, as I said, there are worse problems for Bobby to deal with.

Guess his holographic-like statement suddenly has lost much of its appeal to him. Why not retract it, or clarify it.
Either way, Bobby is in trouble...

... whatever. first of all it was just an analogy to aid a thinking process. i never said it was a 'theory' but you have never answered:

...… could whales have evolved from land animals in 10,000 years??

cobby · 4 November 2008

… could whales have evolved from land animals in 1,000 years??

why the fear in answering this??

PvM · 4 November 2008

What is meant by 'undeniably valid'? It has withstood the attempts to disprove it and has successfully been corroborated by many different data. You claim that there is insufficient evidence, I point out that this is an argument from ignorance. And why the switch from evolution to NS? Surely you do know the difference? What foolishness..
cobby said: No,the theory is valid because of the evidence and since you admitted that there is no evidence that evolution is wrong, all we have is ignorance. You present your evidence. ...hmmm whoah I did not say the theory is WRONG. I said there was insufficient evidence to call it undeniably valid. and again of course evolution is a fact. again you are conflating. my point is that there is insufficient data to say that whales evolved thru NS. ... how do we know there was enough time for the whales to evolve thru NS?

PvM · 4 November 2008

Perhaps, who cares? Why are you obfuscating, just as I predicted? ROTFL
cobby said: … could whales have evolved from land animals in 1,000 years?? why the fear in answering this??

PvM · 4 November 2008

In other words, Bobby neither retracts it nor clarifies it beyond claiming that it was an 'analogy'. That leaves the other problems with his claim. So much ignorance and no clear intent to improve... Thanks Bobby dear
cobby said: Yawn, as I said, there are worse problems for Bobby to deal with. Guess his holographic-like statement suddenly has lost much of its appeal to him. Why not retract it, or clarify it. Either way, Bobby is in trouble... ... whatever. first of all it was just an analogy to aid a thinking process. i never said it was a 'theory' but you have never answered: ...… could whales have evolved from land animals in 10,000 years??

Henry J · 4 November 2008

The question does seem pointless, but I think that for a fully terrestrial species to evolve into a completely aquatic species would take two or three orders of magnitude more than 10,000 years.

cobby · 4 November 2008

PvM said: In other words, Bobby neither retracts it nor clarifies it beyond claiming that it was an 'analogy'. That leaves the other problems with his claim. So much ignorance and no clear intent to improve... Thanks Bobby dear
cobby said: Yawn, as I said, there are worse problems for Bobby to deal with. Guess his holographic-like statement suddenly has lost much of its appeal to him. Why not retract it, or clarify it. Either way, Bobby is in trouble... ... whatever. first of all it was just an analogy to aid a thinking process. i never said it was a 'theory' but you have never answered: ...… could whales have evolved from land animals in 10,000 years??
... my comment is more 'clarified' if posted in its entirety

cobby · 4 November 2008

The question does seem pointless, but I think that for a fully terrestrial species to evolve into a completely aquatic species would take two or three orders of magnitude more than 10,000 years.

.... why do you believe that? can you prove it?

cobby · 4 November 2008

And why the switch from evolution to NS?

... i certainly did not 'switch' you seems to conflate Darwinism with evolution.

PvM · 4 November 2008

Only marginally so. I guess Bobby refuses to clarify his statement beyond the 'analogy' even though his additional comments to his claim also showed several fallacies. Oh the joy of Bobby's contributions.
cobby said: ... my comment is more 'clarified' if posted in its entirety

PvM · 4 November 2008

Oh yes you did, you tend to conflate evolution with Darwinian theory. Why is that?
cobby said: And why the switch from evolution to NS? ... i certainly did not 'switch' you seems to conflate Darwinism with evolution.

PvM · 4 November 2008

And once again Bobby seems to be confused about science and proof. Will he ever learn? Sigh... Such ignorance, no content...
cobby said: The question does seem pointless, but I think that for a fully terrestrial species to evolve into a completely aquatic species would take two or three orders of magnitude more than 10,000 years. .... why do you believe that? can you prove it?

cobby · 4 November 2008

And once again Bobby seems to be confused about science and proof. Will he ever learn?

... so Darwinism has never been proven? We should teach that.

cobby · 4 November 2008

Oh yes you did, you tend to conflate evolution with Darwinian theory.

... no YOU do that. I have said many times evolution is a fact and proven. However Darwinism has not been proven.

PvM · 4 November 2008

Seems Bobby is chasing another one of his strawmen... Hint: Science does not deal in proving... Sigh...
cobby said: And once again Bobby seems to be confused about science and proof. Will he ever learn? ... so Darwinism has never been proven? We should teach that.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: But yes when I have spare time at work I’ll answer posts too. ... does your employer know you are doing that? Have you asked it if is OK to surf on company time? I would fire you.
See this is the difference between jobs that you can get if you are smart as compared to jobs that SFB can get because he thinks that learning stuff is a waste. Yes the manager that approves my time sheets knows I do this type of stuff. Only 80% of my time needs to be against the projects I work on. In IT good managers recognise the productivity is actually higher using this model. It is very easy to get locked into a problem for hours if you are not careful. Often it is better to just change gears all together and do something completely different and come back to the problem. Another plus to my job is everyone spends a good half hour or more a day just talking about stuff. Often this happens at the managers office. All this and a 6 figure salary plus the equivalent of an employer contributed 401k of about $10,000 annually. The only type of contract I don't do this type of thing at normally is a role where I am instructing a class. I tend to spend every minute including before/after class, breaks and lunch answering students questions 1 on 1 which I actually enjoy. So SFB I wouldn't ever work for someone like you but then again I don't believe you could afford my rates.

PvM · 4 November 2008

But you do conflate the two First you ask Cobby: … could whales have evolved from land animals in 10,000 years?? then you ask Cobby: … how do we know there was enough time for the whales to evolve thru NS? So much confusion... And once again, science does not deal in proof. Such foolishness...
cobby said: Oh yes you did, you tend to conflate evolution with Darwinian theory. ... no YOU do that. I have said many times evolution is a fact and proven. However Darwinism has not been proven.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: how do we know that just for example: the whale did not exceed the limits of what evolution can do??? Because we don’t see anything that can’t be explained by evolution in the whale ... hmmm
There is SFB's brain not absorbing anything and him just making noises by his own admission. I bet he does this in conversations to. Doesn't listen, just nods his head blurting out words like "Yup, ah-ha, hmmm and yea" and at the end walks away having no clue what everyone was just talking about. Content free comments from SFB, just like we've come to expect from his post. Notice he avoided my question asking him to name just one trait on any cetaceans of his choice. SFB would have you think that scientist avoid these invisible unknown barriers of his in their research but what actually happens is they do their research as normal and never come up against any barriers. He wants scientists to waste their time looking for something they have never seen and don't have any evidence of. If a scientist ever does come across a one of these magical "barriers" you can be assured that it would be researched. Unique work like this is what scientist thrive on. Probably win a Nobel prize in medicine too.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said:
PvM said: Pray tell bobby: How would you intend to recognize something intellectual and academic since you seem to be somewhat allergic to it? Is it the rash :-)
SFB a.k.a. cobby said: ... excellent comment! very intellectual and academic! (nice mouth too!)
... well that comment was very junior high. not even a clever slam. why do you waste your time just slamming people. lets talk about the topics you avoid.
SFB how many times do you have to be told something before it sinks into that thick skull of yours. Exposing ignorant people like you that want to impose their brand of pseudoscience on the world is NOT a waste of time.

cobby · 4 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: But yes when I have spare time at work I’ll answer posts too. ... does your employer know you are doing that? Have you asked it if is OK to surf on company time? I would fire you.
See this is the difference between jobs that you can get if you are smart as compared to jobs that SFB can get because he thinks that learning stuff is a waste. Yes the manager that approves my time sheets knows I do this type of stuff. Only 80% of my time needs to be against the projects I work on. In IT good managers recognise the productivity is actually higher using this model. It is very easy to get locked into a problem for hours if you are not careful. Often it is better to just change gears all together and do something completely different and come back to the problem. Another plus to my job is everyone spends a good half hour or more a day just talking about stuff. Often this happens at the managers office. All this and a 6 figure salary plus the equivalent of an employer contributed 401k of about $10,000 annually. The only type of contract I don't do this type of thing at normally is a role where I am instructing a class. I tend to spend every minute including before/after class, breaks and lunch answering students questions 1 on 1 which I actually enjoy. So SFB I wouldn't ever work for someone like you but then again I don't believe you could afford my rates.
... why are you so concerned about impressing me?

cobby · 4 November 2008

Exposing ignorant people like you that want to impose their brand of pseudoscience on the world is NOT a waste of time.

... and what exactly am i trying to 'impose on the world'??

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: 1. The whale exists .... true 2. The mutation rates to explain the evolution of the whale are well within what is observed .... how did you come to that conclusion?? FAITH??
No SFB we come to that conclusion from experiments where we measure various mutations and look at the changes it produces. We can then look at natural mutation rates of the target species and then see if there are enough mutation possible during the projected time. For example SFB, we can look at the mutation rate of DNA in humans and chimps. We can compare the DNA of humans and chimps. We can calculate the number of mutations that it would take to get the chimp and human back to a LCA. We take this number and divide it by the current mutation rate. Funny enough the answer we get from genetics saying when the LCA would have lived fits perfectly with the fossil evidence of when the suspected LCA lived. This is why evolution is so strong. It is backed up by multiple lines of evidence in totally separate domains of science. In this case genetics and geology.

cobby · 4 November 2008

If a scientist ever does come across a one of these magical “barriers”

... but you said evolution has limitations. no you are saying that the barriers are magical? you are going around in circles

cobby · 4 November 2008

No SFB we come to that conclusion from experiments where we measure various mutations and look at the changes it produces. We can then look at natural mutation rates of the target species and then see if there are enough mutation possible during the projected time.

... there have been no valid experimentation or even calcuation of mutation rates. go look it up!

Henry J · 4 November 2008

Is it worth asking how one would look up something if it hadn't been done?

PvM · 4 November 2008

Ignorance?
cobby said: Exposing ignorant people like you that want to impose their brand of pseudoscience on the world is NOT a waste of time. ... and what exactly am i trying to 'impose on the world'??

PvM · 4 November 2008

Nope, you are conflating two different aspects. Barriers to evolution which prevent evolution from being a sufficient explanation versus possible barriers to evolution but paths that thus were not followed. Logic my dear friend.
cobby said: If a scientist ever does come across a one of these magical “barriers” ... but you said evolution has limitations. no you are saying that the barriers are magical? you are going around in circles

PvM · 4 November 2008

Can you support your claim? Appeal to ignorance once again. What literature did you search to validate your claims? This is just too foolish for words. What do you consider to be valid experimentation btw? Thought so...
cobby said: No SFB we come to that conclusion from experiments where we measure various mutations and look at the changes it produces. We can then look at natural mutation rates of the target species and then see if there are enough mutation possible during the projected time. ... there have been no valid experimentation or even calcuation of mutation rates. go look it up!

Malcolm · 4 November 2008

Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.

cobby · 4 November 2008

Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
... how long have you been waiting??

cobby · 4 November 2008

… how do we know there was enough time for the whales to evolve thru NS?

..... i dont see any answers!

PvM · 4 November 2008

Couldn't be longer than we have been waiting for you to present a reasoned argument.
cobby said:
Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
... how long have you been waiting??

Malcolm · 4 November 2008

cobby said:
Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
... how long have you been waiting??
Are you going to produce evidence that you know anything about this subject or not?

PvM · 4 November 2008

Don't pretend that I did not give you the necessary evidence that the whales evolved. Whether or not it included NS is a separate issue but we can look at how genetic sites have been conserved. How familiar are you with evolutionary theory. Oh wait... Silly me...
cobby said: … how do we know there was enough time for the whales to evolve thru NS? ..... i dont see any answers!

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: If a scientist ever does come across a one of these magical “barriers” ... but you said evolution has limitations. no you are saying that the barriers are magical? you are going around in circles
No SFB, I said yes there are "barriers" but not like the ones you are suggesting. You are suggesting that there are barriers in between different forms of life on earth. What I'm saying is there are barriers on the outside of life and in most cases that barriers is very far from all life that has ever been on Earth. Lets use a geography metaphor. Lets say every form of life would fit on roads in Kansas. To get from one from of life to another is much like taking street directions. You are suggesting that there are road blocks all around Kansas making it impossible to get to most animals from where you are. From all the reports though not a single one of these road blocks has been found but you want us to go on a massive hunt for them. I don't even think the "barriers" are in Kansas. I'd wager that the barriers are more out at the coast line of North America. I know you will totally screw up the metaphor but it is useful for others that might be lurking and wondering what the actual issue is.

cobby · 4 November 2008

You are suggesting that there are barriers in between different forms of life on earth.

... and YOU of course know there are not. how?? experiments? data? FAITH!

cobby · 4 November 2008

Whether or not it included NS is a separate issue but we can look at how genetic sites have been conserved

... whether or not it included NS is the PRIMARY issue. Darwinism states that NS causes complex body plans. if NS does not Darwinism is invalidated.

cobby · 4 November 2008

Lets say every form of life would fit on roads in Kansas.

... silly analogy.

cobby · 4 November 2008

Malcolm said:
cobby said:
Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
... how long have you been waiting??
Are you going to produce evidence that you know anything about this subject or not?
... how much time do i have to respond?

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: No SFB we come to that conclusion from experiments where we measure various mutations and look at the changes it produces. We can then look at natural mutation rates of the target species and then see if there are enough mutation possible during the projected time. ... there have been no valid experimentation or even calcuation of mutation rates. go look it up!
I agree SFB, there is no "calcuation" of mutation rates. There is a large area of study on mutation rates and using these rates in calculations. Scientist are very interested in this. This is how they estimate how far back 2 random people last relative is using mitochondrial DNA. You really are clueless. SFB claims that just because he is, willfully ignorant, of such studies that they are not "valid". Estimation of DNA sequence context-dependent mutation rates using primate genomic sequences is a good paper. It goes into WAY to much detail for SFB but for the rest of us it discusses the intricacies of the study of mutation rates. SFB will no doubt not even investigate this or any other paper that go address mutations rates but will claim they don't explain what they do explain. No surprise though, SFB often denies that his own posts exist.

cobby · 4 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: No SFB we come to that conclusion from experiments where we measure various mutations and look at the changes it produces. We can then look at natural mutation rates of the target species and then see if there are enough mutation possible during the projected time. ... there have been no valid experimentation or even calcuation of mutation rates. go look it up!
I agree SFB, there is no "calcuation" of mutation rates. There is a large area of study on mutation rates and using these rates in calculations. Scientist are very interested in this. This is how they estimate how far back 2 random people last relative is using mitochondrial DNA. You really are clueless. SFB claims that just because he is, willfully ignorant, of such studies that they are not "valid". Estimation of DNA sequence context-dependent mutation rates using primate genomic sequences is a good paper. It goes into WAY to much detail for SFB but for the rest of us it discusses the intricacies of the study of mutation rates. SFB will no doubt not even investigate this or any other paper that go address mutations rates but will claim they don't explain what they do explain. No surprise though, SFB often denies that his own posts exist.
... these studies show that there was enough time for whales to evolve thru NS?

Dan · 4 November 2008

cobby said: You are suggesting that there are barriers in between different forms of life on earth. ... and YOU of course know there are not. how?? experiments? data? FAITH!
There have been many experiments showing that matter here on Earth is made up of atoms. However, none of these experiments have been performed on the chair on which I am sitting. Nevertheless, I hold that that the chair on which I am sitting is made of atoms. How do I know?? Experiments? Data? FAITH!

Dan · 4 November 2008

cobby said: Lets say every form of life would fit on roads in Kansas. ... silly analogy.
Cobby states that the analogy is silly, but gives no reasoning to support his statement. How does he know that the analogy is silly?? Experiments? Data? FAITH!

Henry J · 4 November 2008

It occurs to me that if the nameful one's questions had come from somebody who hadn't demonstrated an unwillingness to listen, the next step would be an explanation of the scientific method. I wonder if there are any lurkers on the thread who don't already understand it? (Probably not, given that the thread fell off the front page quite a while ago.)

Henry

cobby · 4 November 2008

This is how they estimate how far back 2 random people last relative is using mitochondrial DNA. You really are clueless.

... the problem with most of these studies is that the logic is circular. they use what they feel already is the correct time frame to massage the data. the methodology is very loosy goosy. there is a tremendous amount of cherry picking

Dan · 4 November 2008

cobby said: And once again Bobby seems to be confused about science and proof. Will he ever learn? ... so Darwinism has never been proven? We should teach that.
Not only should we teach that, but we do teach that. See, for example, the NAS publication on "Teaching About Evolution and the Nature of Science". http://www.nap.edu/catalog.php?record_id=5787

cobby · 4 November 2008

Dan said:
cobby said: You are suggesting that there are barriers in between different forms of life on earth. ... and YOU of course know there are not. how?? experiments? data? FAITH!
There have been many experiments showing that matter here on Earth is made up of atoms. However, none of these experiments have been performed on the chair on which I am sitting. Nevertheless, I hold that that the chair on which I am sitting is made of atoms. How do I know?? Experiments? Data? FAITH!
... another horrible analogy

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: Yawn, as I said, there are worse problems for Bobby to deal with. Guess his holographic-like statement suddenly has lost much of its appeal to him. Why not retract it, or clarify it. Either way, Bobby is in trouble... ... whatever. first of all it was just an analogy to aid a thinking process. i never said it was a 'theory' but you have never answered:
Really? So what was with making testable claims like "the hologram doesn't work in the dark"? Doesn't sound like an analogy to me. Sounds like you coming up with a stupid idea, explaining it further with stupid inconsistent attributes and back pedaling when your idea is shown to be stupid. No surprise there though, there is a reason I call you SFB.
SFB a.k.a. cobby said: ...… could whales have evolved from land animals in 10,000 years??
Not from the mutations rates we observe SFB. 10,000 years seems to be off by 2 or 3 orders of magnitude. Note this isn't a barrier but more a practical "speed limit". I see you are a YECer. Do you believe we all are descendants of Noah and Naamah?

DaveH · 4 November 2008

Jobbie said somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere. jobbie also said … whatever first of all it was just an analogy to aid a thinking process. i never said it was a ‘theory’
... a horrible analogy. What is the "holographic-like field" an analogy for?

cobby · 4 November 2008

So what was with making testable claims like “the hologram doesn’t work in the dark”?

.... when did I say that?

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: … could whales have evolved from land animals in 1,000 years?? why the fear in answering this??
The fear? I'll be surprised if no one but me answered your question. You waited all of 1 minute after asking if whales could evolve from land animals in 10,000 years before basically saying we are afraid to answer one of your stupid questions. SFB you do realize that all the posts are timestamped right? People realize that you gave no one even a chance to answer before claiming we where avoiding this question. This is just another example of SFB being a lying and deceitful troll.

cobby · 4 November 2008

Sounds like you coming up with a stupid idea,

... a morphogenic field is concept used by mainstream scientists

cobby · 4 November 2008

... i cant believe you trolls dont having anything better to do

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: And why the switch from evolution to NS? ... i certainly did not 'switch' you seems to conflate Darwinism with evolution.
Care to define both in your own words SFB? As we know from past experience your "definitions" of terms are very different from the definitions everyone else uses.

cobby · 4 November 2008

Not from the mutations rates we observe SFB. 10,000 years seems to be off by 2 or 3 orders of magnitude

... you know how many mutations it takes to make a whale?

cobby · 4 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: And why the switch from evolution to NS? ... i certainly did not 'switch' you seems to conflate Darwinism with evolution.
Care to define both in your own words SFB? As we know from past experience your "definitions" of terms are very different from the definitions everyone else uses.
... my defs are what mainstream scientists use. not your bizarros

PvM · 4 November 2008

Experiments, and data yes. What do you have other than FAITH?
cobby said: You are suggesting that there are barriers in between different forms of life on earth. ... and YOU of course know there are not. how?? experiments? data? FAITH!

PvM · 4 November 2008

How would you know what mainstream scientists use as defs? You have shown yourself to be quite ill informed on science.
cobby said: ... my defs are what mainstream scientists use. not your bizarros

PvM · 4 November 2008

Point mutations, duplications, frame shifts? What exactly do you mean by how many mutations? Specifics please.
cobby said: Not from the mutations rates we observe SFB. 10,000 years seems to be off by 2 or 3 orders of magnitude ... you know how many mutations it takes to make a whale?

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: And once again Bobby seems to be confused about science and proof. Will he ever learn? ... so Darwinism has never been proven? We should teach that.
SFB has been pointed out that "proofs" are for math. Science just provides the best explanation with the current set of data available. "Darwinism" has never been "proven" in just the same way "plate tectonics", "standard model of physics", "Meteorology", "Germ theory" and "Gravity" have never been proven. On the flip side all of these are well supported areas of science with no real threat of being completely overturned any time soon.

PvM · 4 November 2008

Now that's irony for you.
cobby said: ... i cant believe you trolls dont having anything better to do

PvM · 4 November 2008

But not holographic and do you even know how the term is being used? I doubt it.
cobby said: Sounds like you coming up with a stupid idea, ... a morphogenic field is concept used by mainstream scientists

PvM · 4 November 2008

So what? Even if Darwinism were invalidated, evolution still remains a fact. So what's the problem here? As to NS, we know the following: 1. Variation is an observable fact 2. Natural Selection is an observable fact Now all that remains is to determine how much of evolution was due to NS and how much due to other mechanisms. But your argument was against evolution when you asked about whales, only later did you, predictably move towards NS. What silliness.
cobby said: Whether or not it included NS is a separate issue but we can look at how genetic sites have been conserved ... whether or not it included NS is the PRIMARY issue. Darwinism states that NS causes complex body plans. if NS does not Darwinism is invalidated.

PvM · 4 November 2008

Note so far how Bobby has failed to support his claims once again, and as predicted has chosen to obfuscate.

Ah, the power of ignorance never fails.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: Oh yes you did, you tend to conflate evolution with Darwinian theory. ... no YOU do that. I have said many times evolution is a fact and proven. However Darwinism has not been proven.
Again tell us what you believe the big distinction is. Tell us more about how your "God" controls evolution via this "holographic field like" mechanism. It is very nice of your "God" to alter his "holographic field". Really SFB, come out and say what you think happened. Does all life on Earth have a common ancestor? About when did this LCA exist? Given 2 populations sharing the same environment where one population is better suited then the other would you expect that the better suited population would, on average, be more successful (IE breed more) then the less suited population? What controls development and morphology in an organism if it is not controlled by DNA? SFB of coarse will avoid answering these questions in all likely hood because they will define his understanding of the world so it can be more easily shown to be a understanding based on ignorance.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: Exposing ignorant people like you that want to impose their brand of pseudoscience on the world is NOT a waste of time. ... and what exactly am i trying to 'impose on the world'??
SFB couldn't read properly the first time so I bold faced the bit that answers is question.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: Lets say every form of life would fit on roads in Kansas. ... silly analogy.
Only because SFB takes analogies literally. Notice SFB does not justify his comment at all. Common creationist tactic.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said:
Malcolm said: ... Are you going to produce evidence that you know anything about this subject or not?
... how much time do i have to respond?
SFB has had almost 2 month so far.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: No SFB we come to that conclusion from experiments where we measure various mutations and look at the changes it produces. We can then look at natural mutation rates of the target species and then see if there are enough mutation possible during the projected time. ... there have been no valid experimentation or even calcuation of mutation rates. go look it up!
I agree SFB, there is no "calcuation" of mutation rates. There is a large area of study on mutation rates and using these rates in calculations. Scientist are very interested in this. This is how they estimate how far back 2 random people last relative is using mitochondrial DNA. You really are clueless. SFB claims that just because he is, willfully ignorant, of such studies that they are not "valid". Estimation of DNA sequence context-dependent mutation rates using primate genomic sequences is a good paper. It goes into WAY to much detail for SFB but for the rest of us it discusses the intricacies of the study of mutation rates. SFB will no doubt not even investigate this or any other paper that go address mutations rates but will claim they don't explain what they do explain. No surprise though, SFB often denies that his own posts exist.
... these studies show that there was enough time for whales to evolve thru NS?
SFB changes the goal post. He claimed there have been no studies about mutation rates when they clearly do. If he really wanted to know about the current understanding of cetaceans evolution, to include the effect of NS, he could read
Whales, Whaling, and Ocean Ecosystems By James A. Estes Contributor James A. Estes, Douglas P. Demaster, Daniel F. Doak Published by University of California Press, 2006 ISBN 0520248848, 9780520248847
Or any number of books and papers have come out in the last few year. But we know SFB is against learning anything and only tries to quote mine people and fails miserably at it. Hint SFB, most knowledgeable creationists don't talk much about whales any more because the fossils they said couldn't exist have been found.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: So what was with making testable claims like “the hologram doesn’t work in the dark”? .... when did I say that?
Well let me see here you answered these questions
How does a hologram tell the cells to form a certain shape? How do the cells know what to do? … needs reseach What are all these gradients for if they don’t have anything to do with development? the follow the image Why do changes in the gradients affect wing shape if wing shape is determined by the hologram? Why can’t anyone see this hologram? … same reason we cant see gravity Does the hologram work in the dark? … no What intelligence is producing this hologram? … not know Why does it care so much what shape a fly wing is? …not known Are the photons processed in the magnetic field of the earth? …photons arent involved And most importantly, who cares about a magic invisible hologram? …well obviously you do. its no more magic than graivity. …any of the above questions can be applied to gravity
don't worry SFB I did not waste time finding this. I have a whole set of bookmarks for your idiotic posts. Seems you answered some very specific questions about what you now claim was only an analogy. SFB once again shows himself to be a lying and deceitful troll. That or someone that has a severe memory problem. Lithium doesn't help with that. Maybe you should talk to your doctor about your memory problem SFB. That or pray for forgiveness from Jesus for continually lying.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: Sounds like you coming up with a stupid idea, ... a morphogenic field is concept used by mainstream scientists
SFB moves the goal post again. SFB claim was a "holographic construction" which can be seen here It has been all of us telling SFB that morphology is dependent on protein gradients and him arguing that it was really from some other "unknown source" before claiming that it was from a "holographic construction"

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: ... i cant believe you trolls dont having anything better to do
SFB is getting bothered by everyone showing him to be a lying deceitful arrogant willfully ignorant creationist troll. Again SFB is it "don't" not "dont"

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said: Not from the mutations rates we observe SFB. 10,000 years seems to be off by 2 or 3 orders of magnitude ... you know how many mutations it takes to make a whale?
SFB doesn't even get it. The question doesn't even make sense unless he gives us a starting point. I've already explained how they make these calculations. You said that there where no such calculations made. I showed you that there are studies that show how we get these calculations. You ignored all that and started saying the same thing once again.

Wayne Francis · 4 November 2008

SFB a.k.a. cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: And why the switch from evolution to NS? ... i certainly did not 'switch' you seems to conflate Darwinism with evolution.
Care to define both in your own words SFB? As we know from past experience your "definitions" of terms are very different from the definitions everyone else uses.
... my defs are what mainstream scientists use. not your bizarros
No SFB what you keep babbling about isn't mainstream science. Remember you are complaining that mainstream scientists are not really performing science because they don't investigate your magical holographic construction.

DS · 4 November 2008

Well I finally figured out what the troll is trying to accomplish. It is trying to kill us by making us laugh so hard that we forget to breathe. Man what a dolt. How can one person cram so much ignorance into one small cranium?

Of course we have been able to estimate mutation rates since the early seventies and we have been able to measure mutation rates failry precisely since the early eighties. I could cite literally thousands of references, but why bother? Everyone else already knows this and the troll is uncapable of learning. I mean really, once you can sequence DNA, measuring mutation rates is fairly simple. And of course it is very important for medicine as well as evolution so lots of studies have been done.

Just in case anyone is not aware, the pattern of amino acid and nucleotide substitutions that has been revealed by the last thirty years of research is entirely consistent with the hypothesis of functional constraint. In other words, yes, selection is very important in determining the fate of mutations.

Now the troll will claim that it never said that there are no mearurements of mutation rates. It will probably also try to claim that it never said that proteins are just bricks and that protein gradients are only marginally effective at controlling development. And of course it has yet to explain any of of the hologram nonsense. Crap says I and crap I means.

phantomreader42 · 4 November 2008

From this moment, you have twenty-four hours to provide evidence in support of your idiotic assertions, or go fuck yourself. Of course, you will ignore this, because the very idea of evidence is anathema to you. Still, either way you'll be exposed as a lying sack of shit. Though that's been obvious for months.
cobby said:
Malcolm said:
cobby said:
Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
... how long have you been waiting??
Are you going to produce evidence that you know anything about this subject or not?
... how much time do i have to respond?

tresmal · 4 November 2008

phantomreader42 said (to jobby):"From this moment, you have twenty-four hours to provide evidence in support of your idiotic assertions, or go fuck yourself."

If you have been reading this thread long enough you realize that jobby is quite squeamish and uncomfortable on the subject of sex. I think even autosexuality is too much for him.

DS · 4 November 2008

Now you've gone and done it, you used a dirty word. Now the troll will use that as an excuse to not explain anything for another two months. What ever shall we do? It will probably demand that you wash your mouth out, even though you typed the post.

When it gets through barking it will probably try to change the subject again. Maybe it will try to claim that no one has measured the speed of light yet. Yea, that's why the magic invisible hologram can't work in the dark.

Oh well. I guess we can now add the molecular clock to the list of things it doesn't understand. That list is getting pretty long. Too bad there is nothing in the list of things it has demonstrated that it does understand. Even if it did understand something, it would probably just argue against itself until it lost. Remember this is the same nut that claimed that there was no evidence for the role of natural selection in evolution and then claimed that there could be no speciation without natural selection! Of course it will deny making either claim, but of course the evidence never dies.

fnxtr · 4 November 2008

Congratulations, neighbours. The rest of the world is cautiously optimistic.

Wayne Francis · 4 November 2008

tresmal said: phantomreader42 said (to jobby):"From this moment, you have twenty-four hours to provide evidence in support of your idiotic assertions, or go fuck yourself."
If you have been reading this thread long enough you realize that jobby is quite squeamish and uncomfortable on the subject of sex. I think even autosexuality is too much for him.
Yea, SFB kept probing me to try to get it to look like I was closet homophobe after he realized that he was not going to get anything he could quote mine from me he avoided the topic. On one of his rants about being a "self made man" he seemed to imply that he served in the military. So I'm unsure what his problem with swearing is. From my 6 years in the USMC, dealing with all branches of service, swearing is just part and parcel of the military lifestyle from E1 all the way up to flag officers. I'll wager that SFB will claim that he has to many other requests for his comments to make a comment on this. Any takers?

DS · 5 November 2008

Wayne,

Of course corn cobby cannot provide any evidence of any kind. Even if it were making a valid point, it still couldn't read a paper or explain why the paper supports it's claims. The only question is which troll tactic it will employ as an excuse not to provide any evidence. I already have dibs on the "wash your mouth out" tactic, you have dibs on the "I don't have time to respond" tactic, others can vote for their favorites. The ever popular "I never said that" tactic is still open.

Oh well, it doesn't really matter. I say that when the twenty four hours is up, we should all think of some creative acts of sexual deviance to suggest for corn cobby as a going away present. Maybe it can use the magic invisible hologram to display pornographic scenes while it continues it's mental masturbation. Really, no matter how crude, rude or lewd the suggestions, the troll has earned it. Of course the moderator could step in and end this fiasco at any time. 2500 posts of the troll proving it's ignorance serves no purpose that I can discern.

cobby · 5 November 2008

... I am beginning to realize this a place where disturbed people waste their time.

Wayne Francis · 5 November 2008

SFB a.k.a. cobby said: ... I am beginning to realize this a place where disturbed people waste their time.
Where is that explanation of yours SFB?

DS · 5 November 2008

OK, who guessed troll tactic 39 - just insult everyone and hope they will not realize that you have not provided any evidence of any kind? Now, the next step will probably be to claim that everyone is too stupid to understand so it doesn't have to bother trying to explain anything. Oh well, it probably can't even remember what it promised to explain anyway.

Only twelve hours left until time runs out. Get those suggestions ready. Man we could elect a new president faster that this troll can explain anything. Oops, never mind.

rog · 5 November 2008

cobby said: ... I am beginning to realize this a place where disturbed people waste their time.
Cobby...Jacob is correct. He is disturbed (passive-aggressive disorder) and he has been wasting our time.

cobby · 5 November 2008

rog said:
cobby said: ... I am beginning to realize this a place where disturbed people waste their time.
Cobby...Jacob is correct. He is disturbed (passive-aggressive disorder) and he has been wasting our time.
... no one is forcing you to respond. it just seems the trolls want to obfuscate any meaningful dialogue.

fnxtr · 5 November 2008

(snicker) Such as...????

Henry J · 5 November 2008

… you know how many mutations it takes to make a whale?

SFB doesn’t even get it. The question doesn’t even make sense unless he gives us a starting point.

For a convenient starting point, I'd suggest the last common ancestor of whales and hippopotamuses. Henry

phantomreader42 · 5 November 2008

cobby said: ... I am beginning to realize this a place where disturbed people waste their time.
Yes, you are a disturbed person, and you are wasting your time. Clock is ticking little troll. Less than twelve hours left to offer some speck of evidence in support of your endless idiocy. You were the one who asked for a deadline, it's your fault if you can't meet it. And we all know you can't, lying sack of shit.

PvM · 5 November 2008

Must have been quite a disturbing discovery?
cobby said: ... I am beginning to realize this a place where disturbed people waste their time.

PvM · 5 November 2008

Bobby seems to understand what he is doing. That's progress..
cobby said: ... no one is forcing you to respond. it just seems the trolls want to obfuscate any meaningful dialogue.

DS · 5 November 2008

Just six hours left. Man I wonder what this nut job is waiting for, After all, if he offered a "walk through" two weeks ago then he must have already had the evidence, right. Either that or he never did and never will have any evidence of any kind.

Well, troll tactic 57 is still a possibility - you have all treated me so poorly that I don't have to explain anything to any of you. That might not be an effective strategy given all of th jumping monkey and barking dog business. Or maybe it will claim that we all somehow stopped it from posting the evidence. Yea right, if we could do that, why couldn't anyone stop it from posting 1000 pieces of crap here? Or maybe it will just ask some more insipid questions and try to change the subject again.

Malcolm · 5 November 2008

Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
Still waiting...

fnxtr · 5 November 2008

Maybe his next pseudonym should be Godot.

cobby · 5 November 2008

don’t worry SFB I did not waste time finding this. I have a whole set of bookmarks for your idiotic posts.

... i personally would not waste time bookmarking YOUR posts. do you really take this that seriously? does anyone close to you know you waste so much time here? you have a whole set of bookmarks for 'idiotic' posts? do you really think that is healthy??

cobby · 5 November 2008

Malcolm said:
Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
Still waiting...
... malcolm you are going to have to wait quite a while longer. i do not run my life on your dictates! please squirm away!

tresmal · 5 November 2008

jobby said":"malcolm you are going to have to wait quite a while longer. i do not run my life on your dictates! please squirm away!"

Translation: Damn! He called my bluff!

Malcolm · 5 November 2008

cobby said:
Malcolm said:
Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
Still waiting...
... malcolm you are going to have to wait quite a while longer. i do not run my life on your dictates! please squirm away!
Trust me, I'm not holding my breath. As I said, You have shown absolutely no knowledge of anything to do with this topic. I'm not actually expecting that to change any time soon.

PvM · 5 November 2008

You may have to wait till 'hell freezes over' before Bobby addresses his claims. Par for the course I would say
cobby said: ... malcolm you are going to have to wait quite a while longer. i do not run my life on your dictates! please squirm away!

Henry J · 5 November 2008

Maybe his next pseudonym should be Godot.

No, it should be "Eliza". More descriptive.

DS · 5 November 2008

Time is up.

Game over.

You lose.

Go fuck yourself.

phantomreader42 · 5 November 2008

cobby said:
Malcolm said:
Malcolm said:
Malcolm said:
cobby said: Like I said, feel free to prove me wrong at any time. ... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps. ... can you do it with out spitting?
Go right ahead.
I'm still waiting.
Still waiting...
... malcolm you are going to have to wait quite a while longer. i do not run my life on your dictates! please squirm away!
You're the one who asked for a deadline. That deadline has passed, almost two hours ago, without you even trying to provide the slightest speck of evidence for your idiotic assertions. So go fuck yourself. You've proved, countless times, that you are nothing but a worthless lying sack of shit. An empty shell of a man. In short, a typical creationist. If this "walkthrough" you spoke of on November 3 existed, you would have been able to provide it. In three days, you have not even pretended to try. This makes it obvious that your "walkthrough" is nothing, just like you are nothing. You have no evidence, you are terrified of the very concept of evidence. You would rather die than learn anything. So you have no business here. You exist only to fling shit and waste time. Take your willfully ignorant mental masturbation elsewhere.

Wayne Francis · 5 November 2008

SFB a.k.a. cobby said: don’t worry SFB I did not waste time finding this. I have a whole set of bookmarks for your idiotic posts. ... i personally would not waste time bookmarking YOUR posts.
This is because I haven't repeated made statements then claimed that I never made such statements. When I see someone repeated lying then I make my job to show them as a liar as easy as possible.
SFB a.k.a. cobby said: do you really take this that seriously?
Yes I take exposing pseudoscience slinging creationist lying willfully ignorant nut jobs like yourself serious.
SFB a.k.a. cobby said: does anyone close to you know you waste so much time here?
Seeing all but about 3 of my posts on this thread have been addressing your posts and I don't address all of your post now and didn't jump into this thread for the first 3 weeks one would see that you post more often then I do and why you "waste" your time. My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion. And since I am the only one that I have to answer to about my time it doesn't matter what other people think. Friends of mine that are interested in this type of stuff sometimes read PT and I have one friend that has been following along on this thread and have got comments from him about how stupid you are, he actually suggested I start just calling you SFB.
SFB a.k.a. cobby said: you have a whole set of bookmarks for 'idiotic' posts? do you really think that is healthy??
When you keep making claims that you didn't make the posts? Yup, takes me about 5 seconds to make a book mark for one of your stupid posts and saves me about 5 minutes on the flip side when referencing your stupid post. Just think about the number of times you lied on this thread and how many times I've called you on it. Oh I don't bookmark all of your post just the ones I know I'll need to reference later because you've made a stupid claim that I know you'll deny later.

PvM · 6 November 2008

Was that really necessary?
DS said: Time is up. Game over. You lose. Go fuck yourself.

cobby · 6 November 2008

... we have some really classy people here. wonderful examples for kids wanting to become 'scientists'. this site reads like a smut site. nice going trolls.

cobby · 6 November 2008

My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion.

... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?

Wayne Francis · 6 November 2008

SFB a.k.a. cobby said: My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion. ... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?
SFB doesn't realise that this thread will come up in google searches. Very often people only read the newest posts in a thread. So I'd rather have those future lurkers that stumble on this massive thread to see that no one takes him for anything but what he is. A lying deceitful arrogant willfully ignorant creationist troll. If SFB thinks it is useless to post here then one would wonder why he is still posting himself.

cobby · 6 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion. ... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?
SFB doesn't realise that this thread will come up in google searches. Very often people only read the newest posts in a thread. So I'd rather have those future lurkers that stumble on this massive thread to see that no one takes him for anything but what he is. A lying deceitful arrogant willfully ignorant creationist troll. If SFB thinks it is useless to post here then one would wonder why he is still posting himself.
... i think you are making yourself look like a mentally disturbed person. does your boss at work know you post here in this manner? really it sounds like you are dangerous and threatening. is that your real name?

phantomreader42 · 6 November 2008

cobby said: ... we have some really classy people here. wonderful examples for kids wanting to become 'scientists'. this site reads like a smut site. nice going trolls.
So, as usual, you don't have the slightest speck of evidence to support any of your idiotic assertions. Just desperate shit-flinging to distract everyone from the obvious fact that you've got nothing. Not gonna work. Nobody else here is as stupid as you are. Time's up. You lost. You have acheived a level of FAIL previously unknown on this site. In all your months of wasting bandwidth, you have not presented anything that even remotely looks like it might have some speck of substance.

Stanton · 6 November 2008

If cobby/jobby/bobby/jacob/hamstrung/balanced/goff ever intended to support his moronic assertions with evidence in the first place, we would not be complaining about his willfully malignant idiocy in the first place, nor would he be confined to this thread as punishment for trolling and sockpuppeteering.
phantomreader42 said:
cobby said: ... we have some really classy people here. wonderful examples for kids wanting to become 'scientists'. this site reads like a smut site. nice going trolls.
So, as usual, you don't have the slightest speck of evidence to support any of your idiotic assertions. Just desperate shit-flinging to distract everyone from the obvious fact that you've got nothing. Not gonna work. Nobody else here is as stupid as you are. Time's up. You lost. You have acheived a level of FAIL previously unknown on this site. In all your months of wasting bandwidth, you have not presented anything that even remotely looks like it might have some speck of substance.

DS · 6 November 2008

Sorry PvM. You are absolutely right. It won't happen again. The moderator should remove that comment to the bathroom wall. If you will grant me moderator privileges I will remove it myself. Of course then I would immediately remove every single one of the troll comments that have inexplicably been allowed to infest this site.

Seriously, when you allow a mindless boob to post off-topic nonsense for month after month, what can you expect to happen? The only thing it seems to be averse to is foul language. The moderator has allowed it to change names at least a dozen times in blatant violation of the most basic rules and with malice a forethought. It has openly committed slander and accused people of being pedophiles and alcoholics. It has even made personal threats which were not only allowed to remain but were not even addressed by any moderator.

I know that you have done everything you can to prevent this ignorant idiot from infesting this site. Perhaps it is time that you suggest stronger measures before the site becomes overrun. Thank you for keeping the troll off of all other threads.

Wayne Francis · 6 November 2008

SFB a.k.a cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion. ... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?
SFB doesn't realise that this thread will come up in google searches. Very often people only read the newest posts in a thread. So I'd rather have those future lurkers that stumble on this massive thread to see that no one takes him for anything but what he is. A lying deceitful arrogant willfully ignorant creationist troll. If SFB thinks it is useless to post here then one would wonder why he is still posting himself.
... i think you are making yourself look like a mentally disturbed person. does your boss at work know you post here in this manner? really it sounds like you are dangerous and threatening. is that your real name?
Good thing I don't give a shit what you think about me SFB aye. At least my manner of posting is honest. Yes this is my real name, I'm not afraid of what I post being seen by anybody, unlike trolls like you. J.A.D. a few years ago was a bit like you. He threatened to report me to the FBI so I gave all my information to him so that he could even contact the CEO of the Hospital I was working for. Please show me where I have made any threats to you. Calling you a shit for brains lying and deceitful creationist troll isn't dangerous and isn't threatening. They are accurate descriptions of you base on all the posts you have written in this thread. Your integrity shouldn't be threatened as you don't have any to threaten. I see you still have a very poor grasp of grammar. Care to tell us your real name SFB? I will not hold my breath because you rarely answer any question and when you do it seems to be a load of incoherent babbling. I notice you are still avoiding posting anything of substance, just trying to get me mad. Most trolls in your shoes would realise the futility of that by this point but then again most trolls are not quite as thick as you are.

cobby · 6 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion. ... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?
SFB doesn't realise that this thread will come up in google searches. Very often people only read the newest posts in a thread. So I'd rather have those future lurkers that stumble on this massive thread to see that no one takes him for anything but what he is. A lying deceitful arrogant willfully ignorant creationist troll. If SFB thinks it is useless to post here then one would wonder why he is still posting himself.
... i think you are making yourself look like a mentally disturbed person. does your boss at work know you post here in this manner? really it sounds like you are dangerous and threatening. is that your real name? ...J.A.D.??? ... ok where do you work now?
Wayne Francis said:
SFB a.k.a cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion. ... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?
SFB doesn't realise that this thread will come up in google searches. Very often people only read the newest posts in a thread. So I'd rather have those future lurkers that stumble on this massive thread to see that no one takes him for anything but what he is. A lying deceitful arrogant willfully ignorant creationist troll. If SFB thinks it is useless to post here then one would wonder why he is still posting himself.
... i think you are making yourself look like a mentally disturbed person. does your boss at work know you post here in this manner? really it sounds like you are dangerous and threatening. is that your real name?
Good thing I don't give a shit what you think about me SFB aye. At least my manner of posting is honest. Yes this is my real name, I'm not afraid of what I post being seen by anybody, unlike trolls like you. J.A.D. a few years ago was a bit like you. He threatened to report me to the FBI so I gave all my information to him so that he could even contact the CEO of the Hospital I was working for. Please show me where I have made any threats to you. Calling you a shit for brains lying and deceitful creationist troll isn't dangerous and isn't threatening. They are accurate descriptions of you base on all the posts you have written in this thread. Your integrity shouldn't be threatened as you don't have any to threaten. I see you still have a very poor grasp of grammar. Care to tell us your real name SFB? I will not hold my breath because you rarely answer any question and when you do it seems to be a load of incoherent babbling. I notice you are still avoiding posting anything of substance, just trying to get me mad. Most trolls in your shoes would realise the futility of that by this point but then again most trolls are not quite as thick as you are.
...J.A.D.??? ... ok where do you work now?

PvM · 6 November 2008

Sure, and they would learn how ignorance breeds more ignorance and for that we should thank you Bobby. You make a very useful case of how ignorance and content free comments doom you to irrelevance.
cobby said: My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion. ... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?

PvM · 6 November 2008

Yes Bobby, please do tell us. After all, you have been violating the terms of services of this board for quite some time...
cobby said: ... ok where do you work now?

PvM · 6 November 2008

How cute, Bobby is sharing some of his fame with others.. Now I understand why Bobby confuses a single thread with a site, after all why should we expect Bobby to understand such differences when he fails to appreciate the biological sciences, confuses morphogenetic fields with holographic fields. Yes, Bobby, your contributions make for good examples why children want to become scientists and educate themselves rather than troll their ignorance.
cobby said: ... we have some really classy people here. wonderful examples for kids wanting to become 'scientists'. this site reads like a smut site. nice going trolls.

cobby · 6 November 2008

PvM said: How cute, Bobby is sharing some of his fame with others.. Now I understand why Bobby confuses a single thread with a site, after all why should we expect Bobby to understand such differences when he fails to appreciate the biological sciences, confuses morphogenetic fields with holographic fields. Yes, Bobby, your contributions make for good examples why children want to become scientists and educate themselves rather than troll their ignorance.
cobby said: ... we have some really classy people here. wonderful examples for kids wanting to become 'scientists'. this site reads like a smut site. nice going trolls.
... you MUST have something better to do than to obsessively slam on me. Well maybe not. Seem like I am very important in your life.

Dan · 6 November 2008

cobby said: ... would any teacher send one of his students here to read this smut?
The list of honors and awards won by Panda's Thumb is given on the opening page of the site. Yes, it would be very reasonable for a teacher to send one or many of his students to Panda's Thumb, despite the fact that it includes intellectual smut such as this:
jobby said: 01010001010100101010010100100010100101010111010100101010 10100100010101001010100101001000101001010101110101001010 10101001000101010010101001010010001010010101011101010010 10101010010001010100101010010100100010100101010111010100 1010101010 JUMP MONKEYS!!

cobby · 6 November 2008

Dan said:
cobby said: ... would any teacher send one of his students here to read this smut?
The list of honors and awards won by Panda's Thumb is given on the opening page of the site. Yes, it would be very reasonable for a teacher to send one or many of his students to Panda's Thumb, despite the fact that it includes intellectual smut such as this:
jobby said: 01010001010100101010010100100010100101010111010100101010 10100100010101001010100101001000101001010101110101001010 10101001000101010010101001010010001010010101011101010010 10101010010001010100101010010100100010100101010111010100 1010101010 JUMP MONKEYS!!
... nothing better to do??

PvM · 6 November 2008

Again we get to enjoy the irony of Bobby accusing others of obsession. Fascinating specimen
cobby said: ... you MUST have something better to do than to obsessively slam on me. Well maybe not. Seem like I am very important in your life.

PvM · 6 November 2008

Pot kettle...
cobby said: ... nothing better to do??

Dan · 6 November 2008

cobby said: ... nothing better to do??
I'm an anti-smut crusader, and I enjoy finding intellectual smut and pointing it out. Notice that cobby agrees that his writing is intellectual smut, and differs with me only in that he claims that pointing out smut is not worth the time. This despite the fact that he/she takes the time to do it him/herself!
cobby said: ... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?
I leave it to those more knowledgeable than me to decide wither the proper diagnosis for cobby is schizophrenia or multiple personality disorder or just plain stupidity.

tresmal · 6 November 2008

So jobby, are you ready to walk us through your ideas?

DS · 6 November 2008

Dan wrote:

"I leave it to those more knowledgeable than me to decide wither the proper diagnosis for cobby is schizophrenia or multiple personality disorder or just plain stupidity."

I would just like to point out that those scenarios are not mutually exclusive. For example:

The same nut job who claimed that there was no evidence for the role natural selection in evolution also claimed that speciation could not occur in the absence of natural selection

The same nut job who claimed that the magic invisible hologram could not work in the dark denied ever having claimed that

The same nut job who offered to explain it's nonsensical ideas asked how much time it had to explain and then claimed that it didn't have to meet the deadline

The same nut job who claimed that he posted here for the benefit of the lurkers now claims that no one but the particiapants ever read the thread

I vote for all three scenarios simultaneously. Others may add to the list. I have already diagnosed short-term memory loss and attention deficit disorder. Maybe when it is through walking through it's own delusional mind it can try to make some sort of coherent argument, but of course no one will care.

Malcolm · 6 November 2008

Still no walk through from the troll.

It would appear that my original observation that the troll knows absolutely nothing about enzyme gradients was correct. What a surprise.

Malcolm · 6 November 2008

DS said: Dan wrote: "I leave it to those more knowledgeable than me to decide wither the proper diagnosis for cobby is schizophrenia or multiple personality disorder or just plain stupidity." I would just like to point out that those scenarios are not mutually exclusive. For example: The same nut job who claimed that there was no evidence for the role natural selection in evolution also claimed that speciation could not occur in the absence of natural selection
Like most creationists, it probably doesn't understand what the terms 'evolution' and 'natural selection' mean, so this isn't really all that surprising.

Malcolm · 6 November 2008

Dan said: I leave it to those more knowledgeable than me to decide wither the proper diagnosis for cobby is schizophrenia or multiple personality disorder or just plain stupidity.
I think that you have missed out a more obvious diagnosis: The troll acts like a child because the troll is a child.

fnxtr · 6 November 2008

tresmal said: So jobby, are you ready to walk us through your ideas?
Wait, let me get my farm boots on, 'cause you know what there's gonna be a lot of...

cobby · 6 November 2008

DS said: Dan wrote: "I leave it to those more knowledgeable than me to decide wither the proper diagnosis for cobby is schizophrenia or multiple personality disorder or just plain stupidity." I would just like to point out that those scenarios are not mutually exclusive. For example: The same nut job who claimed that there was no evidence for the role natural selection in evolution also claimed that speciation could not occur in the absence of natural selection The same nut job who claimed that the magic invisible hologram could not work in the dark denied ever having claimed that The same nut job who offered to explain it's nonsensical ideas asked how much time it had to explain and then claimed that it didn't have to meet the deadline The same nut job who claimed that he posted here for the benefit of the lurkers now claims that no one but the particiapants ever read the thread I vote for all three scenarios simultaneously. Others may add to the list. I have already diagnosed short-term memory loss and attention deficit disorder. Maybe when it is through walking through it's own delusional mind it can try to make some sort of coherent argument, but of course no one will care.
... I wouldnt waste my time responding to a 'nut job'

cobby · 6 November 2008

... I get what I want out of you trolls. But you don't get much from me. hahaha!

tresmal · 6 November 2008

cobby said: ... I get what I want out of you trolls. But you don't get much from me. hahaha!
No, just the enormous satisfaction of not being you.

cobby · 6 November 2008

tresmal said:
cobby said: ... I get what I want out of you trolls. But you don't get much from me. hahaha!
No, just the enormous satisfaction of not being you.
... I dont think that is worth the effort you trolls put in here to discredit me. To me it is easier just to ignore idiots. Obviously you do not think I am an 'idiot' since you put so much effort in trying to discredit me. Anyhow thanks for the research you have done for me! It saved me hours of hunting a lot of it down.

tresmal · 6 November 2008

cobby said:
tresmal said:
cobby said: ... I get what I want out of you trolls. But you don't get much from me. hahaha!
No, just the enormous satisfaction of not being you.
... I dont think that is worth the effort you trolls put in here to discredit me. To me it is easier just to ignore idiots. Obviously you do not think I am an 'idiot' since you put so much effort in trying to discredit me.
Actually discrediting idiots is always a good use of time.
Anyhow thanks for the research you have done for me! It saved me hours of hunting a lot of it down.
OK, now who is going to save you the many more hours of reading it? And who are you going to find to explain it to you in terms simple enough for your marginally literate and numerate mind to understand?

P.S. Ready to walk us through your ideas yet?

Dan · 6 November 2008

cobby said: ... I get what I want out of you trolls. But you don't get much from me. hahaha!
I had earlier suggested diagnoses of "schizophrenia or multiple personality disorder or just plain stupidity." But I wonder if it's more appropriate to diagnose a new disease altogether, the disease of wanting to be ignorant, of reveling in one's own ignorance, of exalting ignorance. I coin the term WREI for this disease (wanting, reveling in, and exalting ignorance). But just as the disease ALS is more widely known as Lou Gehrig's disease, WREI will probably come to be known as Sarah Palin's disease.

cobby · 6 November 2008

OK, now who is going to save you the many more hours of reading it? And who are you going to find to explain it to you in terms simple enough for your marginally literate and numerate mind to understand?

... well actually you trolls would find and paste what i needed to know. thanks! of course i could do the research myself but why should i when i have a pack of monkeys at my command.

... remember how well i had you trained. if i needed some info i just shouted

JUMP MONKEYS!! and off you would scurry to get what i needed.

cobby · 6 November 2008

.. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light.

JUMP MONKEYS!

cobby · 6 November 2008

...thanks monkeys!

tresmal · 6 November 2008

So jobby, are you ready to walk us through your ideas yet?


I suggest that this be the only response jobby gets until he does "walk us through" or admits he's got nuthin'.

cobby · 6 November 2008

tresmal said: So jobby, are you ready to walk us through your ideas yet?

I suggest that this be the only response jobby gets until he does "walk us through" or admits he's got nuthin'.

..which idea?

tresmal · 6 November 2008

So jobby, ready to walk us through your ideas?

Stanton · 6 November 2008

So where did you get your definition of a holograph [sic] not being light? The same place that has definitions of cold fire and dry water?
cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!

cobby · 6 November 2008

Stanton said: So where did you get your definition of a holograph [sic] not being light? The same place that has definitions of cold fire and dry water?
cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!
... well there is dry ice. but anyhow terms change as decades go by for instance the use of moron, idiot and imbecile here used to have very specific meanings. now there are pretty much just slams. actually the more modern use of the term hologram is a force field. but i dont think many of the monkeys here are very current. seems like they were brainwashed years ago can cannot adjust to changing technology or terms ... monkey can you think of a term that has changed in meaning over decades?

PvM · 6 November 2008

A hologram is a force field... Wow, watching the SciFi channel a bit too often?
cobby said: ... well there is dry ice. but anyhow terms change as decades go by for instance the use of moron, idiot and imbecile here used to have very specific meanings. now there are pretty much just slams. actually the more modern use of the term hologram is a force field. but i dont think many of the monkeys here are very current. seems like they were brainwashed years ago can cannot adjust to changing technology or terms ... monkey can you think of a term that has changed in meaning over decades?

cobby · 6 November 2008

PvM said: A hologram is a force field... Wow, watching the SciFi channel a bit too often?
cobby said: ... well there is dry ice. but anyhow terms change as decades go by for instance the use of moron, idiot and imbecile here used to have very specific meanings. now there are pretty much just slams. actually the more modern use of the term hologram is a force field. but i dont think many of the monkeys here are very current. seems like they were brainwashed years ago can cannot adjust to changing technology or terms ... monkey can you think of a term that has changed in meaning over decades?
... well of course much of what is new in technology had portends in sci-fi. (jules verne) do a little research and will see that the term hologram is expanding. MRI??

Stanton · 6 November 2008

Your argument of "words changing definitions over time" falls flat on account of how there are no definitions of a "hologram" being a "forcefield." In fact, the only place where there are "hologram forcefields" is on the Holodecks in the Star Trek Universe. So, you probably just garbling something you misheard on Star Trek: The Next Generation, and are trying to bullshit your way out of this.
cobby said:
Stanton said: So where did you get your definition of a holograph [sic] not being light? The same place that has definitions of cold fire and dry water?
cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!
... well there is dry ice. but anyhow terms change as decades go by for instance the use of moron, idiot and imbecile here used to have very specific meanings. now there are pretty much just slams. actually the more modern use of the term hologram is a force field. but i dont think many of the monkeys here are very current. seems like they were brainwashed years ago can cannot adjust to changing technology or terms ... monkey can you think of a term that has changed in meaning over decades?

Stanton · 6 November 2008

cobby said: ... well of course much of what is new in technology had portends in sci-fi. (jules verne) do a little research and will see that the term hologram is expanding. MRI??
Holographic MRI still requires light to make the holograms in question.

DS · 6 November 2008

Come on guys, you're just wasting your time with this slack jawed slacker. Now it is going to argue about the definition of "hologram" and "force field" until someone actually looks it up and proves that it is wrong once again. Who cares? What kind of "force field" doesn't work in the dark? What kind of "force field" responds to changes in the sequence of nucleotides in DNA?

The brick for brains troll is just making crap up. It doesn't even have a clue what the words mean. The point is that it hasn't got any evidence, period. Why argue about definitions when there is absolutely no evidence? Obviously it is just desperate for attention, why give it any? Let the jumping monkey jump off a bridge by itself.

Henry J · 6 November 2008

A hologram is a three dimensional image of something that isn't there; the image is produced by reflecting laser light off a blank background. (Against a non-blank background, the background and hologram image will be overlaid on each other.)

tresmal, posted 11/06/08 6:17 PM So jobby, ready to walk us through your ideas?

If he is, wear boots. Henry

Malcolm · 6 November 2008

cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!
That one definitely sounds like something you'd hear in a primary school playground. Changing the definition of terms when she are losing an argument is a favourite tactic of my 9 year old niece.

Wayne Francis · 6 November 2008

Malcolm said:
Dan said: I leave it to those more knowledgeable than me to decide wither the proper diagnosis for cobby is schizophrenia or multiple personality disorder or just plain stupidity.
I think that you have missed out a more obvious diagnosis: The troll acts like a child because the troll is a child.
Don't insult children like this. I recently went to Melbourne for the International Tap Festival there. The kids in my son's dance company are WAY more mature and smart then SFB. I think he acts like what he probably is, a washed up adult that never really amounted to anything in life. Life time of avoiding learning, why should he change now? He "knows" stuff in his mind to be true and damn what the real world says. Sorry to any McCain supporters/Republicans out there but I think he's also a Republican. The ones that think they are members of some "master race". Do you notice you never see white supremacists that call themselves democrats?

Wayne Francis · 6 November 2008

tresmal said:
cobby said: ... I get what I want out of you trolls. But you don't get much from me. hahaha!
No, just the enormous satisfaction of not being you.
I get plenty of satisfaction every time SFB posts his stupidity. I like pointing it out. Like I have said before. It is like standing next to a really ugly person in a club. They make you look much better looking to everyone else.

Wayne Francis · 6 November 2008

SFB a.k.a. cobby said:
tresmal said:
cobby said: ... I get what I want out of you trolls. But you don't get much from me. hahaha!
No, just the enormous satisfaction of not being you.
... I dont think that is worth the effort you trolls put in here to discredit me. To me it is easier just to ignore idiots. Obviously you do not think I am an 'idiot' since you put so much effort in trying to discredit me. Anyhow thanks for the research you have done for me! It saved me hours of hunting a lot of it down.
SFB can't understand why everyone doesn't think like he does. We are all thankful we don't think like he does. SFB logic
  • SFB claims doesn't waste time with trolls.
  • SFB claims we are all trolls
  • SFB keeps replying to our posts
and
  • SFB thinks smart people will not point out idiots
  • SFB keeps calls us idiots
Doesn't mater what is easier either SFB. Doing volunteer work isn't as easy as sitting at home in front of the TV but I still do volunteer work. We already know you are lazy SFB. You don't have to emphasize that fact. Now he's trying to get us upset by implying that he tricked us into providing him links? SFB is a real idiot. 1) He has not shown any evidence of even looking at anything we've provided him. 2) We actually want him to read the stuff we provided him. 3) Finding this information didn't take hours, might take him hours to find it but for most of us it is a 30 second job. Read away troll. If you ever think you have learned something feel free to come back and show us your new found knowledge. My bet is you won't get past the first 2 lines from your own comments saying you just that. We have converted a few creationist in the past but never a troll. The difference is the former actually came here ignorant but willing to learn while the later, a.k.a. SFB, comes here ignorant and arrogant and has fought tooth and nail to even watch a video that explained a processes he didn't understand.

Wayne Francis · 6 November 2008

Dan said:
cobby said: ... I get what I want out of you trolls. But you don't get much from me. hahaha!
I had earlier suggested diagnoses of "schizophrenia or multiple personality disorder or just plain stupidity." But I wonder if it's more appropriate to diagnose a new disease altogether, the disease of wanting to be ignorant, of reveling in one's own ignorance, of exalting ignorance. I coin the term WREI for this disease (wanting, reveling in, and exalting ignorance). But just as the disease ALS is more widely known as Lou Gehrig's disease, WREI will probably come to be known as Sarah Palin's disease.
I laughed when she made the comment "We don't have to understand the cause of a problem to fix it" in response to someone talking about the causes of global warming. Its like a dentist saying he doesn't need to know what causes tooth decay to fix the problem. This dentist ends up constantly filling cavities or ripping peoples teeth out while a normal dentist does check ups and sends kids home with their own teeth, telling them to brush and floss.

Wayne Francis · 7 November 2008

SFB a.k.a. cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!
SFB doesn't matter what you "think". Please show us a definition where hologram doesn't deal with photons. Oh wait this is one of your completely unsupported claims again.

Wayne Francis · 7 November 2008

SFB a.k.a. cobby said:
Stanton said: So where did you get your definition of a holograph [sic] not being light? The same place that has definitions of cold fire and dry water?
cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!
... well there is dry ice. but anyhow terms change as decades go by for instance the use of moron, idiot and imbecile here used to have very specific meanings. now there are pretty much just slams. actually the more modern use of the term hologram is a force field. but i dont think many of the monkeys here are very current. seems like they were brainwashed years ago can cannot adjust to changing technology or terms ... monkey can you think of a term that has changed in meaning over decades?
Oh this stuff is rich. Please show us the support for your force field claim. The issue isn't that definitions of words change SFB. It is the definition of a words you use don't match current definitions and often don't match past definitions either.

Wayne Francis · 7 November 2008

SFB a.k.a. cobby said:
PvM said: A hologram is a force field... Wow, watching the SciFi channel a bit too often?
cobby said: ... well there is dry ice. but anyhow terms change as decades go by for instance the use of moron, idiot and imbecile here used to have very specific meanings. now there are pretty much just slams. actually the more modern use of the term hologram is a force field. but i dont think many of the monkeys here are very current. seems like they were brainwashed years ago can cannot adjust to changing technology or terms ... monkey can you think of a term that has changed in meaning over decades?
... well of course much of what is new in technology had portends in sci-fi. (jules verne) do a little research and will see that the term hologram is expanding. MRI??
You have no clue about anything do you SFB. MRI != hologram. MRI is a technique used to detect the location of hydrogen atoms. These images are 2D. Computers can be used to stitch together many of these images and produce a 3D image. This 3D image could be displayed via a hologram, just as any other 3D image could. The hologram part has nothing to do with the MRI though. The MRI works just fine without holograms. Umm you do realize that Jules Verne wrote journey to the center of the earth. A journey that would not ever happen the way he wrote about. He also wrote From the Earth to the Moon. Thankfully science didn't follow his lead there either because being launched from a cannon that can achieve escape velocity would instantly kill a human. Michael Crichton, may he rest in peace, would have been a better example to use as he didn't just make a few guesses and wrote about something but investigated issues very completely. Books like The Andromeda Strain and Terminal Man where decades ahead of their time and much more accurate overall then a few minor details as found in Jules Verne's books.

Stanton · 7 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!
SFB doesn't matter what you "think". Please show us a definition where hologram doesn't deal with photons. Oh wait this is one of your completely unsupported claims again.
I'd ask cobby/jobby/bobby/jacob/balanced/hamstrung/goff to explain how cells build the body with lightless, forcefield-holograms, let alone produce lightless, forcefield-holograms, but...

cobby · 7 November 2008

Malcolm said:
cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!
That one definitely sounds like something you'd hear in a primary school playground. Changing the definition of terms when she are losing an argument is a favourite tactic of my 9 year old niece.
.... well the term holograph, hologram etc is used to describe several other concepts other than the what the general population considers a hologram as a 3d light image. do some homework and look it up. i dont have the the time to help you now.

cobby · 7 November 2008

... good Monkeys!

.... most of you jumped. very good!

cobby · 7 November 2008

Umm you do realize that Jules Verne wrote journey to the center of the earth. A journey that would not ever happen the way he wrote about. He also wrote From the Earth to the Moon. Thankfully science didn’t follow his lead there either because being launched from a cannon that can achieve escape velocity would instantly kill a human.

... of course not all ideas in sci-fi have come to be. it is a bit of a brainstorming area. most of us have our flip out 'communitcators' and there is puctureless medical injections.

.... look up the etymology of 'hologram'. actually its use for 3d light structures is a bit of a misnomer. but so what.

.... go monkeys! learn something!

Dave Lovell · 7 November 2008

cobby said: .... look up the etymology of 'hologram'. actually its use for 3d light structures is a bit of a misnomer. but so what.
So you're still hiding behind arguments about the meaning of words to avoid having to discuss real issues. Have you forgotten that you were person who introduced the idea of a "hologram" to this thread. Why did you do that if you thought the word was ambiguous, but perhaps you could clarify exactly what you meant by "hologram" when you originally used the word.

cobby · 7 November 2008

Dave Lovell said:
cobby said: .... look up the etymology of 'hologram'. actually its use for 3d light structures is a bit of a misnomer. but so what.
So you're still hiding behind arguments about the meaning of words to avoid having to discuss real issues. Have you forgotten that you were person who introduced the idea of a "hologram" to this thread. Why did you do that if you thought the word was ambiguous, but perhaps you could clarify exactly what you meant by "hologram" when you originally used the word.
... because i am not writing a research paper here. is was a casual comment using a term as an analogy. i dont take this a seriously as you do. to me it is entertaining to see monkeys jump. .... jump monkeys!

Wayne Francis · 7 November 2008

SFB a.k.a. cobby said:
Malcolm said:
cobby said: .. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light. JUMP MONKEYS!
That one definitely sounds like something you'd hear in a primary school playground. Changing the definition of terms when she are losing an argument is a favourite tactic of my 9 year old niece.
.... well the term holograph, hologram etc is used to describe several other concepts other than the what the general population considers a hologram as a 3d light image. do some homework and look it up. i dont have the the time to help you now.
SFB has no clue about anything. He makes a stupid comment like this then claims he doesn't have the time to provide any reference that could back up his claim. I understand why, he doesn't have any. SFB is a lying troll. Not a very good one. Maybe SFB creationist friends believe his bull shit but here people are well educated in a number of scientific fields. Hologram is Greek, means whole drawing. Holograms are just a way to record wave patterns. Most often light ways. Unfortunately for SFB none of the applications have anything to do with what SFB has been babbling.

PvM · 7 November 2008

Now that's irony, bobby encouraging others to learn something when he has refused to do so and confused the term hologram. What a lovely sight...
cobby said: .... look up the etymology of 'hologram'. actually its use for 3d light structures is a bit of a misnomer. but so what. .... go monkeys! learn something!

PvM · 7 November 2008

Translation: I was wrong once again and will as usual refuse to show support for my claims under the excuse of being too busy even though I just responded to several postings. I am not surprised though that Bobby once again refuses to support his claims. Worse, not only does he not support his claims, he also seems to be quite wrong about the concept of hologram... What a crock.
cobby said: .... well the term holograph, hologram etc is used to describe several other concepts other than the what the general population considers a hologram as a 3d light image. do some homework and look it up. i dont have the the time to help you now.

cobby · 7 November 2008

Hologram is Greek, means whole drawing.

.... where does it specify that light must be involved. yes it has been lately used to specify a certain type of image generation. but nowhere that i can see that it must use light

cobby · 7 November 2008

PvM said: Translation: I was wrong once again and will as usual refuse to show support for my claims under the excuse of being too busy even though I just responded to several postings. I am not surprised though that Bobby once again refuses to support his claims. Worse, not only does he not support his claims, he also seems to be quite wrong about the concept of hologram... What a crock.
cobby said: .... well the term holograph, hologram etc is used to describe several other concepts other than the what the general population considers a hologram as a 3d light image. do some homework and look it up. i dont have the the time to help you now.
... pvm, i am just so entertained by seeing you get all indignant and jumping up and down. i cant believe you people take this so seriously. you are too funny!

PvM · 7 November 2008

Ignorance in all its forms should be taken seriously. Exposing the content free 'arguments' by Bobby is a fun past-time.
cobby said: ... pvm, i am just so entertained by seeing you get all indignant and jumping up and down. i cant believe you people take this so seriously. you are too funny!

cobby · 7 November 2008

.... wouldnt be better to do this in a forum that was not biased. where your opposition would have an level playing field?

Stanton · 7 November 2008

You can level the playing field, yourself, by demonstrating how the cells of the body build the body by using photon-less forcefield holograms, and not the various genomic products made from translation and transcription of DNA, as you have repeatedly suggested.
cobby said: .... wouldnt be better to do this in a forum that was not biased. where your opposition would have an level playing field?

tresmal · 7 November 2008

cobby said: .... wouldnt be better to do this in a forum that was not biased. where your opposition would have an level playing field?
This forum isn't biased, reality is biased against you.

cobby · 7 November 2008

reality is biased against you.

.... you have not show the experiment proving new body plans can arise thru NS.

Henry J · 7 November 2008

A generalization is not proven by a single experiment; it's supported by 1) being consistent with the data, and 2) having ways in which contradictory data could have been found if the premise were wrong, plus 3) being consistent with some data that predicted before being examined.

PvM · 7 November 2008

Is asking someone to support his claims creating a playingfield which is not level? Weird...
cobby said: .... wouldnt be better to do this in a forum that was not biased. where your opposition would have an level playing field?

PvM · 7 November 2008

As he said, reality is biased against you. Probably because you have shown to be ignorant about much related to embryogenesis, and biology for that matter.
cobby said: reality is biased against you. .... you have not show the experiment proving new body plans can arise thru NS.

cobby · 7 November 2008

PvM said: As he said, reality is biased against you. Probably because you have shown to be ignorant about much related to embryogenesis, and biology for that matter.
cobby said: reality is biased against you. .... you have not show the experiment proving new body plans can arise thru NS.
.... you have not show the experiment proving new body plans can arise thru NS. ... this is always avoided by the willfully ignorant trolls

Malcolm · 7 November 2008

Henry J said: A generalization is not proven by a single experiment; it's supported by 1) being consistent with the data, and 2) having ways in which contradictory data could have been found if the premise were wrong, plus 3) being consistent with some data that predicted before being examined.
Henry, Now you're bring science into it. That's not fair. You know the troll gets confused by science.

Malcolm · 7 November 2008

cobby said:
PvM said: As he said, reality is biased against you. Probably because you have shown to be ignorant about much related to embryogenesis, and biology for that matter.
cobby said: reality is biased against you. .... you have not show the experiment proving new body plans can arise thru NS.
.... you have not show the experiment proving new body plans can arise thru NS. ... this is always avoided by the willfully ignorant trolls
I'd be interested to know what the troll's definition of natural selection is, because "body plans", what ever they are, don't arise through natural selection. Allele frequency changes through natural selection.

cobby · 7 November 2008

Malcolm said:
Henry J said: A generalization is not proven by a single experiment; it's supported by 1) being consistent with the data, and 2) having ways in which contradictory data could have been found if the premise were wrong, plus 3) being consistent with some data that predicted before being examined.
Henry, Now you're bring science into it. That's not fair. You know the troll gets confused by science.
2) having ways in which contradictory data could have been found if the premise were wrong, ... .... yes having ways to show contradictory data could have been found if the premise were wrong, ... please show us those 'ways' as far as NS causing novel body structures. nice talk but wheres the beef?

cobby · 7 November 2008

because “body plans”, what ever they are, don’t arise through natural selection.

... then where do these body plans come from, oh great trollish one, Godditit??

PvM · 7 November 2008

Are those the only choices Bobby? Why should you be interested in finding out more about science when in the past you have rejected any relevant knowledge out of hand?
cobby said: because “body plans”, what ever they are, don’t arise through natural selection. ... then where do these body plans come from, oh great trollish one, Godditit??

cobby · 7 November 2008

PvM said: Are those the only choices Bobby? Why should you be interested in finding out more about science when in the past you have rejected any relevant knowledge out of hand?
cobby said: because “body plans”, what ever they are, don’t arise through natural selection. ... then where do these body plans come from, oh great trollish one, Godditit??
.... again the troll has no answer.

PvM · 7 November 2008

Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006
PvM said: Are those the only choices Bobby? Why should you be interested in finding out more about science when in the past you have rejected any relevant knowledge out of hand?
cobby said: because “body plans”, what ever they are, don’t arise through natural selection. ... then where do these body plans come from, oh great trollish one, Godditit??

PvM · 7 November 2008

Yes Bobby why do you refuse to answer?
cobby said:
PvM said: Are those the only choices Bobby? Why should you be interested in finding out more about science when in the past you have rejected any relevant knowledge out of hand?
cobby said: because “body plans”, what ever they are, don’t arise through natural selection. ... then where do these body plans come from, oh great trollish one, Godditit??
.... again the troll has no answer.

cobby · 7 November 2008

Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006

... you read this article?? or just googled it?

PvM · 7 November 2008

Both, of course, this is not the first time I have read the article. But of course, you will use anything to avoid dealing with science. Predictable. Thanks for playing.
cobby said: Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006 ... you read this article?? or just googled it?

cobby · 7 November 2008

PvM said: Both, of course, this is not the first time I have read the article. But of course, you will use anything to avoid dealing with science. Predictable. Thanks for playing.
cobby said: Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006 ... you read this article?? or just googled it?
... why do you think this article supports your position?

PvM · 7 November 2008

Benjamin Prud'homme, Nicolas Gompel, Sean B. Carroll Emerging principles of regulatory evolution, PNAS May 15, 2007 vol. 104 no. Suppl 1 8605-8612 Enjoy... Time to educate yourself Bobby.
PvM said: Both, of course, this is not the first time I have read the article. But of course, you will use anything to avoid dealing with science. Predictable. Thanks for playing.
cobby said: Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006 ... you read this article?? or just googled it?

PvM · 7 November 2008

Because it shows how evolution can affect changes to the body plans without the need for major changes to the 'building blocks' (just an metaphor).

Because most animals share a conserved repertoire of body-building and -patterning genes, morphological diversity appears to evolve primarily through changes in the deployment of these genes during development.

You must have heard of gene regulatory networks? Betchya
cobby said: ... why do you think this article supports your position?

cobby · 7 November 2008

PvM said: Because it shows how evolution can affect changes to the body plans without the need for major changes to the 'building blocks' (just an metaphor).

Because most animals share a conserved repertoire of body-building and -patterning genes, morphological diversity appears to evolve primarily through changes in the deployment of these genes during development.

You must have heard of gene regulatory networks? Betchya
cobby said: ... why do you think this article supports your position?
.... and it shows NS caused all of this?

Malcolm · 7 November 2008

cobby said:
PvM said: As he said, reality is biased against you. Probably because you have shown to be ignorant about much related to embryogenesis, and biology for that matter.
cobby said: reality is biased against you. .... you have not show the experiment proving new body plans can arise thru NS.
.... you have not show the experiment proving new body plans can arise thru NS. ... this is always avoided by the willfully ignorant trolls
I'd be interested to know what the troll's definition of natural selection is, because "body plans", what ever they are, don't arise through natural selection. Allele frequency changes through natural selection.
cobby said: because “body plans”, what ever they are, don’t arise through natural selection. ... then where do these body plans come from, oh great trollish one, Godditit??
Troll, since you are the only one talking about "body plans", you first need to define what this term means.

cobby · 7 November 2008

Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006

Troll, since you are the only one talking about “body plans”, you first need to define what this term means.

... seems like Davidson and Erwin also are talking about body plans. If you read the article i think you would be familiar with the term

PvM · 7 November 2008

Has bobby read the article? Hmm thought so...
cobby said: Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006 Troll, since you are the only one talking about “body plans”, you first need to define what this term means. ... seems like Davidson and Erwin also are talking about body plans. If you read the article i think you would be familiar with the term

cobby · 7 November 2008

since you are the only one talking about “body plans”,

.... what are you talking about?

PvM · 7 November 2008

Perhaps you could explain to Malcom the concept of body plan?
cobby said: since you are the only one talking about “body plans”, .... what are you talking about?

cobby · 7 November 2008

PvM said: Perhaps you could explain to Malcom the concept of body plan?
cobby said: since you are the only one talking about “body plans”, .... what are you talking about?
http://en.wikipedia.org/wiki/Body_plan

PvM · 7 November 2008

Did you read it or just google it :-)
cobby said:
PvM said: Perhaps you could explain to Malcom the concept of body plan?
cobby said: since you are the only one talking about “body plans”, .... what are you talking about?
http://en.wikipedia.org/wiki/Body_plan

SWT · 7 November 2008

PvM said: Has bobby read the article? Hmm thought so...
cobby said: Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006 Troll, since you are the only one talking about “body plans”, you first need to define what this term means. ... seems like Davidson and Erwin also are talking about body plans. If you read the article i think you would be familiar with the term
This is hilarious! Mr. "Not Enough Information in the Genome" posts a link to an article that discusses how gene regulatory networks specify body plans, once again providing peer-reviewed information that undermines his points. Legion really should read these things before he links to them.

PvM · 7 November 2008

Irony never fails...
SWT said:
PvM said: Has bobby read the article? Hmm thought so...
cobby said: Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006 Troll, since you are the only one talking about “body plans”, you first need to define what this term means. ... seems like Davidson and Erwin also are talking about body plans. If you read the article i think you would be familiar with the term
This is hilarious! Mr. "Not Enough Information in the Genome" posts a link to an article that discusses how gene regulatory networks specify body plans, once again providing peer-reviewed information that undermines his points. Legion really should read these things before he links to them.

Malcolm · 7 November 2008

cobby said:
PvM said: Perhaps you could explain to Malcom the concept of body plan?
cobby said: since you are the only one talking about “body plans”, .... what are you talking about?
http://en.wikipedia.org/wiki/Body_plan
That's why I asked you to define body plans. The scientific definition didn't seem to fit in well with your argument. If you don't understand why, you might want to read the page you just linked to. Strangely enough, it doesn't talk about holograms. It talks about enzyme gradients.

Henry J · 8 November 2008

Paraphrasing the question so that it makes sense: what evidence would reduce confidence in origin of body plans from earlier species via accumulation of genetic changes by the known causes of genetic change?

I reckon anything that reduces confidence in common descent of animal phyla would do that (e.g., later species found way too early in geographic record, or significant discrepancies between the nested hierarchies constructed from different body parts or DNA sequences).

Or, evidence for some mechanism other than natural selection for production of new complex traits, such that the newly discovered mechanism is also consistent with the evidence, while providing as good an explanation for that evidence as is provided by the current theory.

Without a plausible replacement for the known ways DNA can change, I don't see a way to separate the variation + selection hypothesis from common descent; it looks to me like they stand or fall together.

Henry

phantomreader42 · 8 November 2008

In all its idiotic babbling today, has the lying sack of shit made any attempt to present the slightest speck of evidence in support of its claims? No, of course not, it would rather die than do such a thing. Has it posted even a single letter of its promised "walkthrough"? No, of course not, the "walkthrough" exists only in its delusions.

So yet another day of the brain-dead troll flinging shit in every direction, without any effort at all to address reality. Just what we've all come to expect from creationists. Endless dishonesty, worship of ignorance, total lack of substance.

cobby · 8 November 2008

phantomreader42 said: In all its idiotic babbling today, has the lying sack of shit made any attempt to present the slightest speck of evidence in support of its claims? No, of course not, it would rather die than do such a thing. Has it posted even a single letter of its promised "walkthrough"? No, of course not, the "walkthrough" exists only in its delusions. So yet another day of the brain-dead troll flinging shit in every direction, without any effort at all to address reality. Just what we've all come to expect from creationists. Endless dishonesty, worship of ignorance, total lack of substance.
.... what have YOU ever done here except bring down the level of discussion to the gutter?

cobby · 8 November 2008

I reckon anything that reduces confidence in common descent of animal phyla would do that

... no you are misunderstanding. the point is YOU must show what we would see if common descent occurred WITHOUT NS.

cobby · 8 November 2008

I don’t see a way to separate the variation + selection hypothesis from common descent;

... we could have a combination of systems working thats how. of course NS happens and of course common descent happens.

... the question is can those methods reach far enough allow a reptile to evolve into a mammal. HOW can YOU show that?

cobby · 8 November 2008

That’s why I asked you to define body plans. The scientific definition didn’t seem to fit in well with your argument.

.... WHY do you say that?

Wayne Francis · 8 November 2008

SFB a.k.a. cobby said: I don’t see a way to separate the variation + selection hypothesis from common descent; ... we could have a combination of systems working thats how. of course NS happens and of course common descent happens. ... the question is can those methods reach far enough allow a reptile to evolve into a mammal. HOW can YOU show that?
This is like saying "Sure you can dig a whole, Sure there are really big holes but can you dig really big holes. There are a lot more factors in play other then random mutation and natural selection. SFB here has just repeated ignored us telling him that. If SFB wasn't such a creationist troll more interested in trying to spread his pseudoscience then he is in learning what the modern theory of evolution says then he would have learned about this weeks ago when we where explaining it to him. SFB looks for gaps in HIS knowledge and expect science to investigate these. It doesn't matter to him that if he read the papers and articles he's been pointed to he'd have a better understanding of the concepts. In fact SFB prefers to stay ignorant. SFB tell us in your own words what is the difference between a "reptile" and a "mammal". You should know by past post by m,e and others, that reptiles and mammals have the same body plan. But you don't because you don't ever learn from anything you read. You get your science from shows like star trek and expect everyone to believe the shit you fling around here.. SFB doesn't even get that he isn't even asking a question consistently. He moves the goal post constantly. Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. The question for science is not if NS can produce it but if the modern theory of evolution could NS alone doesn't do anything. Natural selection is also not the only form of selection in the modern evolutionary theory. Only creationist trolls like SFB here try to make the claim. Then when they get someone to agree that NS couldn't do it alone they try to claim the whole theory is broke because of this. It doesn't matter to them that they don't even understand that NS alone isn't expected to produce all the life we observe. This is why they are so messed up with respect to their holy book. They fear if anything in the bible is not true that there is no value to the whole thing. SFB is an arrogant lying deceitful willfully ignorant creationist troll.

cobby · 8 November 2008

Wayne Francis said:
SFB a.k.a. cobby said: I don’t see a way to separate the variation + selection hypothesis from common descent; ... we could have a combination of systems working thats how. of course NS happens and of course common descent happens. ... the question is can those methods reach far enough allow a reptile to evolve into a mammal. HOW can YOU show that?
This is like saying "Sure you can dig a whole, Sure there are really big holes but can you dig really big holes. There are a lot more factors in play other then random mutation and natural selection. SFB here has just repeated ignored us telling him that. If SFB wasn't such a creationist troll more interested in trying to spread his pseudoscience then he is in learning what the modern theory of evolution says then he would have learned about this weeks ago when we where explaining it to him. SFB looks for gaps in HIS knowledge and expect science to investigate these. It doesn't matter to him that if he read the papers and articles he's been pointed to he'd have a better understanding of the concepts. In fact SFB prefers to stay ignorant. SFB tell us in your own words what is the difference between a "reptile" and a "mammal". You should know by past post by m,e and others, that reptiles and mammals have the same body plan. But you don't because you don't ever learn from anything you read. You get your science from shows like star trek and expect everyone to believe the shit you fling around here.. SFB doesn't even get that he isn't even asking a question consistently. He moves the goal post constantly. Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. The question for science is not if NS can produce it but if the modern theory of evolution could NS alone doesn't do anything. Natural selection is also not the only form of selection in the modern evolutionary theory. Only creationist trolls like SFB here try to make the claim. Then when they get someone to agree that NS couldn't do it alone they try to claim the whole theory is broke because of this. It doesn't matter to them that they don't even understand that NS alone isn't expected to produce all the life we observe. This is why they are so messed up with respect to their holy book. They fear if anything in the bible is not true that there is no value to the whole thing. SFB is an arrogant lying deceitful willfully ignorant creationist troll.
... wow. you seem to be a very angry person.

cobby · 8 November 2008

Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. T

... its pretty much the same question. getting angry wont help you overcome your ignorance.

..... show me the experiment. you know there is not one and that is why you put on a tantrum

SWT · 8 November 2008

cobby said: Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. T ... its pretty much the same question. getting angry wont help you overcome your ignorance. ..... show me the experiment. you know there is not one and that is why you put on a tantrum
Not at all the same question, since mammals and reptiles both have the chordate body plan.

cobby · 8 November 2008

Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. T ... its pretty much the same question. getting angry wont help you overcome your ignorance. ..... show me the experiment. you know there is not one and that is why you put on a tantrum
SWT said:
cobby said: Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. T ... its pretty much the same question. getting angry wont help you overcome your ignorance. ..... show me the experiment. you know there is not one and that is why you put on a tantrum
Not at all the same question, since mammals and reptiles both have the chordate body plan.
... well they both have more accurately a tetrapod body plan in common. but there are subdivisions of that heading. .... are you really saying a turtle and a giraffe have the same body plan??

SWT · 8 November 2008

cobby said: .... are you really saying a turtle and a giraffe have the same body plan??
Are you really saying they don't? After all, they're in the same phylum.

phantomreader42 · 8 November 2008

So, for the record, you HAVEN'T offered anything remotely resembling evidence, and once again you desperately try to distract attention from the fact that you're a lying sack of shit. You know you've got nothing, everyone knows it. Time to put up or shut up, brain-dead troll. Provide your evidence, or take your mental masturbation elsewhere.
cobby said:
phantomreader42 said: In all its idiotic babbling today, has the lying sack of shit made any attempt to present the slightest speck of evidence in support of its claims? No, of course not, it would rather die than do such a thing. Has it posted even a single letter of its promised "walkthrough"? No, of course not, the "walkthrough" exists only in its delusions. So yet another day of the brain-dead troll flinging shit in every direction, without any effort at all to address reality. Just what we've all come to expect from creationists. Endless dishonesty, worship of ignorance, total lack of substance.
.... what have YOU ever done here except bring down the level of discussion to the gutter?

cobby · 8 November 2008

SWT said:
cobby said: .... are you really saying a turtle and a giraffe have the same body plan??
Are you really saying they don't? After all, they're in the same phylum.
... of course animals in the same phyla have similar body plans but body plan is also used to seperate smaller subdivisions. of course the body plan criteria gets less useful the closer you get to species. and of course many of the divisions are 'arbitrary' ex: craniata, vertebrata

cobby · 8 November 2008

phantomreader42 replied to comment from cobby | November 8, 2008 2:12 PM | Reply

So, for the record, you HAVEN’T offered anything remotely resembling evidence, and once again you desperately try to distract attention from the fact that you’re a lying sack of shit. You know you’ve got nothing, everyone knows it. Time to put up or shut up, brain-dead troll. Provide your evidence, or take your mental masturbation elsewhere.

... would you be comfortable having this individual alone with your children??

Malcolm · 8 November 2008

cobby said: phantomreader42 replied to comment from cobby | November 8, 2008 2:12 PM | Reply So, for the record, you HAVEN’T offered anything remotely resembling evidence, and once again you desperately try to distract attention from the fact that you’re a lying sack of shit. You know you’ve got nothing, everyone knows it. Time to put up or shut up, brain-dead troll. Provide your evidence, or take your mental masturbation elsewhere. ... would you be comfortable having this individual alone with your children??
Much more comfortable than leaving them with a creationist loon like yourself.

Malcolm · 8 November 2008

cobby said: That’s why I asked you to define body plans. The scientific definition didn’t seem to fit in well with your argument. .... WHY do you say that?
Like I said, enzyme gradients, no holograms.

tresmal · 8 November 2008

Jobby is a demonstration of the Dunning-Kruger effect.

PvM · 8 November 2008

If Bobby considers them to be different 'body plans' then there is even better data showing how these body plans evolved.
SWT said:
cobby said: .... are you really saying a turtle and a giraffe have the same body plan??
Are you really saying they don't? After all, they're in the same phylum.

cobby · 8 November 2008

PvM said: If Bobby considers them to be different 'body plans' then there is even better data showing how these body plans evolved.
SWT said:
cobby said: .... are you really saying a turtle and a giraffe have the same body plan??
Are you really saying they don't? After all, they're in the same phylum.
... body plan != phylum, sorry charlie

cobby · 8 November 2008

Malcolm said:
cobby said: phantomreader42 replied to comment from cobby | November 8, 2008 2:12 PM | Reply So, for the record, you HAVEN’T offered anything remotely resembling evidence, and once again you desperately try to distract attention from the fact that you’re a lying sack of shit. You know you’ve got nothing, everyone knows it. Time to put up or shut up, brain-dead troll. Provide your evidence, or take your mental masturbation elsewhere. ... would you be comfortable having this individual alone with your children??
Much more comfortable than leaving them with a creationist loon like yourself.
... then i feel sorry and fear for your children

PvM · 8 November 2008

Wikipedia: Body plan is the basis for phylum, and there are 35 different basic animal body plans, corresponding to different phyla. Yawn
cobby said:
PvM said: If Bobby considers them to be different 'body plans' then there is even better data showing how these body plans evolved.
SWT said:
cobby said: .... are you really saying a turtle and a giraffe have the same body plan??
Are you really saying they don't? After all, they're in the same phylum.
... body plan != phylum, sorry charlie

PvM · 8 November 2008

Why? THe observation that you have offered nothing remotely resembling evidence seems quite accurate. As to the, somewhat unnecessary but understandable name calling, it seems that this is more a case of the pot calling the kettle...
cobby said:
Malcolm said:
cobby said: phantomreader42 replied to comment from cobby | November 8, 2008 2:12 PM | Reply So, for the record, you HAVEN’T offered anything remotely resembling evidence, and once again you desperately try to distract attention from the fact that you’re a lying sack of shit. You know you’ve got nothing, everyone knows it. Time to put up or shut up, brain-dead troll. Provide your evidence, or take your mental masturbation elsewhere. ... would you be comfortable having this individual alone with your children??
Much more comfortable than leaving them with a creationist loon like yourself.
... then i feel sorry and fear for your children

Wayne Francis · 8 November 2008

SFB a.k.a. cobby said:
Wayne Francis said:
SFB a.k.a. cobby said: I don’t see a way to separate the variation + selection hypothesis from common descent; ... we could have a combination of systems working thats how. of course NS happens and of course common descent happens. ... the question is can those methods reach far enough allow a reptile to evolve into a mammal. HOW can YOU show that?
This is like saying "Sure you can dig a whole, Sure there are really big holes but can you dig really big holes. There are a lot more factors in play other then random mutation and natural selection. SFB here has just repeated ignored us telling him that. If SFB wasn't such a creationist troll more interested in trying to spread his pseudoscience then he is in learning what the modern theory of evolution says then he would have learned about this weeks ago when we where explaining it to him. SFB looks for gaps in HIS knowledge and expect science to investigate these. It doesn't matter to him that if he read the papers and articles he's been pointed to he'd have a better understanding of the concepts. In fact SFB prefers to stay ignorant. SFB tell us in your own words what is the difference between a "reptile" and a "mammal". You should know by past post by m,e and others, that reptiles and mammals have the same body plan. But you don't because you don't ever learn from anything you read. You get your science from shows like star trek and expect everyone to believe the shit you fling around here.. SFB doesn't even get that he isn't even asking a question consistently. He moves the goal post constantly. Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. The question for science is not if NS can produce it but if the modern theory of evolution could NS alone doesn't do anything. Natural selection is also not the only form of selection in the modern evolutionary theory. Only creationist trolls like SFB here try to make the claim. Then when they get someone to agree that NS couldn't do it alone they try to claim the whole theory is broke because of this. It doesn't matter to them that they don't even understand that NS alone isn't expected to produce all the life we observe. This is why they are so messed up with respect to their holy book. They fear if anything in the bible is not true that there is no value to the whole thing. SFB is an arrogant lying deceitful willfully ignorant creationist troll.
... wow. you seem to be a very angry person.
SFB claims I am an angry person. Seems anyone that points out the truth to SFB is angry, disturbed, stupid and dangerous. Seems SFB is a bit paranoid. SFB, care to show us what particular parts of my post show me to be angry?

Wayne Francis · 8 November 2008

SFB a.k.a. cobby said: Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. T ... its pretty much the same question. getting angry wont help you overcome your ignorance. ..... show me the experiment. you know there is not one and that is why you put on a tantrum
SFB, I'd ask why you think I'm angry. Do you think anyone that points out your misunderstanding of an issue is angry? It has only been SFB here that has repeatedly shown his ignorance and repeatedly asks people why they waste there time when ever he has been shown to be an outright liar and ignorant. It is not the same question. They are related but different in scale. SFB won't accept the modern theory of evolution until he sees an experiment that shows a starting species, that is classified as a reptile, over many generations, produce a species that could be classified as a mammal. I'm sure if that experiment could even be done, because of time scales, that SFB would move the goal post and again claim while NS works at the class level we can't prove that it works at the phylum level. We have shown that it works at the species level and have no indication that there are any "barriers". Within the tree of life an organism and its direct offspring do not change from one species to another. Just like changes from one class to another is not a clear boundary. Neither is the boundary that define phyla. Seeing this happened over a hundred million years one would have to think that this is not a very practical laboratory experiment. Notice he doesn’t even define what he considers a reptile and mammal. This is because he doesn’t realise that even there are species that have traits that outside of the classifications of animals they are grouped with. SFB might as well argue that until science can find the very first cell that common decent isn’t true. The fact is there are many studies that are looking into the genetic differences that commonly define different classes. SFB has not once stated what supposed barriers there could be with respects to life that we see it. Tell me SFB have you called my current employer about me posting on PT and repeatedly showing you to be an wilfully ignorant liar?

Wayne Francis · 8 November 2008

SFB a.k.a. cobby said:
SWT said:
SFB a.k.a. cobby said: .... are you really saying a turtle and a giraffe have the same body plan??
Are you really saying they don't? After all, they're in the same phylum.
... of course animals in the same phyla have similar body plans but body plan is also used to seperate smaller subdivisions. of course the body plan criteria gets less useful the closer you get to species. and of course many of the divisions are 'arbitrary' ex: craniata, vertebrata
SFB again shows he has no clue of what arbitrary means. Craniata is a subdivision of Chordates. The division isn’t arbitrary. They didn’t just pull the classification out of their ass like SFB does with most of what he said. There is a logical reason they split up Chordates into Craniata and Tunicates. Craniata and Vertebrates are not different "arbitrary" divisions. If you are a Vertebrate then by definition you are a Craniata because Vertebrates are a subdivision. This is mostly because there are species that can be classified as Craniata that do not have a spine. There are definite reasons scientists create these groupings. They don't just come to work and say "Hey think I'll create a new taxon because I don't have anything else to do today"

Wayne Francis · 8 November 2008

SFB a.k.a. cobby said:
PvM said: If Bobby considers them to be different 'body plans' then there is even better data showing how these body plans evolved.
SWT said:
SFB a.k.a. cobby said: .... are you really saying a turtle and a giraffe have the same body plan??
Are you really saying they don't? After all, they're in the same phylum.
... body plan != phylum, sorry charlie
No SFB, no one said body plan = plylum. We said body plans are defined at the phylum level. Ie you don't look at 2 species in the same family and say they have different body plans. Just like you don't look at a rattle snake and a sleepy lizard and say they are not both reptiles. They are in different families but are in the same phylum and have the same body plan.

DS · 8 November 2008

So, we can now add cladistics to the list of things that the troll doesn't understand. So far the list includes:

information theory and DNA

proteins including enzymes and transcription factors

developmental genetics and morphogenic fields

natural selection and speciation

mutation rates and the molecular clock

cladistics and systematics

Doubtless it does not see any connection between the areas of it's ignorance either.

If the troll demands any evidence, remember that it is just making crap up and has provided no evidence whatsoever for any claim that it has ever made. If anyone points this out too blatantly, it goes into a jumping monkey fit and then starts barking. Like spilt water, if you ignore it, it will eventually go away.

phantomreader42 · 9 November 2008

And once again the lying sack of shit babbles in a desperate attempt to distract people from his total failure to provide the slightest speck of evidence. You're not fooling anyone. IF you had a single fact on your side, you would've mentioned it by now. You haven't. You've been babbling for 86 pages, and not once did you even come close to having a valid argument. Anyone with a brain can see this. And no matter what idiotic slanders you throw out, you will never change the facts.
cobby said: phantomreader42 replied to comment from cobby | November 8, 2008 2:12 PM | Reply So, for the record, you HAVEN’T offered anything remotely resembling evidence, and once again you desperately try to distract attention from the fact that you’re a lying sack of shit. You know you’ve got nothing, everyone knows it. Time to put up or shut up, brain-dead troll. Provide your evidence, or take your mental masturbation elsewhere. ... would you be comfortable having this individual alone with your children??

phantomreader42 · 9 November 2008

It has also been clearly demonstrated that the troll does not understand that its past comments remain on the page, and attempts to pretend it didn't make some idiotic statement are futile.
DS said: So, we can now add cladistics to the list of things that the troll doesn't understand. So far the list includes: information theory and DNA proteins including enzymes and transcription factors developmental genetics and morphogenic fields natural selection and speciation mutation rates and the molecular clock cladistics and systematics Doubtless it does not see any connection between the areas of it's ignorance either. If the troll demands any evidence, remember that it is just making crap up and has provided no evidence whatsoever for any claim that it has ever made. If anyone points this out too blatantly, it goes into a jumping monkey fit and then starts barking. Like spilt water, if you ignore it, it will eventually go away.

Wayne Francis · 9 November 2008

I better qualify what I meant by "No SFB, no one said body plan = plylum" because some people obviously don't have a problem with that statement and these people are more knowledgeable then I am about the topic.

Looking at it again I have to agree with PvM. This, of course, does nothing for SFB statements. All it shows is that I’m able to learn from someone else while SFB is in his own reality which does not reflect the real world and he is unable to change his perception without lying about it.

For clarification my thinking of phylum and body plans where overlapping classifications. I guess they are but they are far more overlapping then what I was taking them as.

DS · 9 November 2008

Good point. I made a list of contradictory statements made by the troll previously. I'm sure Wayne has bookmarked quite a few. So now we have lists of contradictory statements, psychological disorders and areas of ignorance. This basket case sure does provide lots of material to work with. Oh well, until it comes up with some evidence, or at least a reasonable hypothesis not tangential to reality, I guess the lists are all we're left with.

Stanton · 9 November 2008

DS said: If the troll demands any evidence, remember that it is just making crap up and has provided no evidence whatsoever for any claim that it has ever made.
Do also remember that whenever someone provides evidence, whether to satisfy one of cobby/jobby/bobby/jacob/hamstrung/balanced/goff's inane demands, or to demonstrate the falseness and or vacuity of one of his inane and baseless claims, he pretends that there is no evidence.

Wayne Francis · 9 November 2008

Stanton said:
DS said: If the troll demands any evidence, remember that it is just making crap up and has provided no evidence whatsoever for any claim that it has ever made.
Do also remember that whenever someone provides evidence, whether to satisfy one of cobby/jobby/bobby/jacob/hamstrung/balanced/goff's inane demands, or to demonstrate the falseness and or vacuity of one of his inane and baseless claims, he pretends that there is no evidence.
Or tries to claim that he made those claims.

Wayne Francis · 9 November 2008

You know SFB has a new spin on the "God of the gaps". He isn't finding gaps. He says "See that area there that is well known? Well you can't prove 'God' isn't the cracks."

Where most creationist start at the gap level and get squeezed into the crack level. SFB just jumps into solid block head on into solid science hoping he can make a crack and as he is laying there all bloody and can't remember even his own name he makes claims that literally are right in front of his face.

cobby · 9 November 2008

Well you can’t prove ‘God’ isn’t the cracks.”

.... when did i say anything even close to that. honestly it seems like you have a mental problem. you equates someone not accepting every Darwinian principle as 'gospel' as heresy. you have turned Darwinism into a religion.

.... is it against your religion to doubt Darwinism??

cobby · 9 November 2008

You’ve been babbling for 86 pages,

... actually if you would objectively ( dont think they have the capability of being objective) look at the amount of verbage here the darwinists are the the most verbose and rantish. i make small concise comments while my opposition rants on and on.

cobby · 9 November 2008

... I really do think that any reasonable, open minded people reading this would come to the conclusion that my opposition are vulgar, petty, deceitful, angry, and are not arguing their point in good faith.

cobby · 9 November 2008

.... Wayne, I read very little of your rants here.

Dave Lovell · 9 November 2008

tresmal said: Jobby is a demonstration of the Dunning-Kruger effect.
I think they were only formalising the very old idea that ignorance is bliss. Jobby's very first comments on this thread made me think of Mark Twain.
Reader's Digest, Sept. 1937. This quote has been attributed to Mark Twain, but until the attribution can be verified, the quote should not be regarded as authentic. When I was a boy of fourteen, my father was so ignorant I could hardly stand to have the old man around. But when I got to be twenty-one, I was astonished at how much the old man had learned in seven years.

Dave Lovell · 9 November 2008

Wayne Francis said: SFB won't accept the modern theory of evolution until he sees an experiment that shows a starting species, that is classified as a reptile, over many generations, produce a species that could be classified as a mammal. I'm sure if that experiment could even be done, because of time scales, that SFB would move the goal post and again claim while NS works at the class level we can't prove that it works at the phylum level.
Even if it could be done, what would it prove? Modern reptiles and mammals are both the result of millions of tiny changes from some common ancestor. The best result the experiment could hope for would be a crocodog. Even it had every major mammalian feature, it would still be in the clade of reptiles, and could never be classified as a mammal. To jobby's mindset it would also not have been produced by NS because the experimenter was intelligently selecting for mammalian traits

cobby · 9 November 2008

Modern reptiles and mammals are both the result of millions of tiny changes from some common ancestor.

... any experiments backing this up? and predictions? falsification scenarios? nice hypothesis. but unfortunately cannot be validated.

Stanton · 9 November 2008

So how come you have refused to present any evidence for your own claims, and have done nothing but antagonize us ever since you came here over 8 months ago? How come you refuse to explain how cells use lightless, forcefield-holograms, and not genomic products produced from the transcription and translation of DNA, to build the body?
cobby/jobby/bobby/jacob/hamstrung/balanced/goff projected: ... I really do think that any reasonable, open minded people reading this would come to the conclusion that my opposition are vulgar, petty, deceitful, angry, and are not arguing their point in good faith.
cobby/jobby/bobby/jacob/hamstrung/balanced/goff said: .... Wayne, I read very little of your rants here.
There, fixed.

DS · 9 November 2008

Did mammals evolve from reptiles? Well let's see what predictions have been made:

Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia

A cladistic analysis of morphology should yield the same topology as the nested hierarchy produced on the genetic data

Reptiles and mammals should share common developmental pathways that are conserved in the early stages and more divergent in the later stages

There should be intermediate forms between reptiles and mammals in the fossil record including intermediate forms in the evolution of the three bones of the inner ear

That should do for now. There is strong evidence that is completely consistent with each of these predictions. Just go to talkorigins.org and search the archives if you want references. Each one of these prredictions, and dozens more, could have served to conclusively falsifiy the hypothesis, they just didn't. Historical reconstruction is not done by repeating the process in controlled conditions. Just watch CSI to see how the evidence is used to test hypotheses and reconstruct past events.

Of course the troll of many names did not learn anything past junior high, so obviously it is compeletely ignorant of all of this evidence. Oh well, if you don't understand cladistics, what can you expect?

Wayne Francis · 9 November 2008

SFB a.k.a cobby said: .... Wayne, I read very little of your rants here.
SFB reads very little period.

cobby · 9 November 2008

... it is easy to get confirming predictions. where are the predictions to what we would see if the theory is NOT valid.

Did mammals evolve from reptiles? Well let’s see what predictions have been made:

Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia

.... genetic similarity?? thats a broad statemnet. express it in a way that can be test

A cladistic analysis of morphology should yield the same topology as the nested hierarchy produced on the genetic data

... same as above

Reptiles and mammals should share common developmental pathways that are conserved in the early stages and more divergent in the later stages

... ontog recaps philog?

There should be intermediate forms between reptiles and mammals in the fossil record including intermediate forms in the evolution of the three bones of the inner ear

.... the jaw bones became the middle ear?? any other evidence??

... would love to see some specific examples of your above vague generalizations

...OK if NS and common descent did not work would there be ANY humans according to your theory?

cobby · 9 November 2008

and have done nothing but antagonize us ever since you came here over 8 months ago?

.. i dont read posts from people that bother me. i think that would help you not get upset.

cobby · 9 November 2008

There should be intermediate forms between reptiles and mammals in the fossil record including intermediate forms in the evolution of the three bones of the inner ear

... if these forms were not found would that have falsified Darwinism?

cobby · 9 November 2008

Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia

... if reptiles and mammals have been individually created would they NOT have the same genetic material?

DS · 9 November 2008

TRANSLATION:

I DON'T UNDERSTSND ANY OF THEM BIG WORDS

JUMP MONKEY

BOW WOW

cobby · 9 November 2008

DS said: TRANSLATION: I DON'T UNDERSTSND ANY OF THEM BIG WORDS JUMP MONKEY BOW WOW
translation: your questions have completely stumped me!

DS · 9 November 2008

Translation: Your answers have completely stumped me. Just like your questions about the protein bricks completely stumped me, just like your questions about the magic invisible hologram stumped me. All I can do is ask more inane questions and try to deflect the burden of proof once again. If that doesn't work, I'll just jump and scream and bark and hope that no one notices that I have no answers and no evidence at all. I'll complain about language and hurl personal insults and impotent threats trying to deflect attention away from the delusional claims that I have made and then denied making. I'll ask for more and more detail until everyone forgets what the original question was and that I was proven to be completely wrong months ago.

Oh yea, and everyone should notice that I never said anything whatsoever about natural selection, so if the troll tries to move the goalposts again, that won't work either. Maybe the troll will now offer to "walk thru" some more delusional crap and made up definitions. I'm going to try to care, but somehow I just don't think I''ll quite be able to do it.

PvM · 9 November 2008

Seems bobby has dumped yet another one of his claims and is moving on to more ignorance.

Fascinating

cobby · 9 November 2008

All I can do is ask more inane questions and try to deflect the burden of proof once again.

... burden of proof? I was told science does not 'prove anything.

cobby · 9 November 2008

Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia

… if reptiles and mammals have been individually created would they NOT have the same genetic material?

...... interesting: they do not have an answer to the above question so they feel if they call it 'innane' they can avoid answering it.

SWT · 9 November 2008

cobby said: Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia … if reptiles and mammals have been individually created would they NOT have the same genetic material? ...... interesting: they do not have an answer to the above question so they feel if they call it 'innane' they can avoid answering it.
If reptiles and mammals had been individually created rather than resulting from common descent, genetic similarity would not necessarily be observed.

PvM · 9 November 2008

Funny, using Bobby's 'logic', we can very well conclude that his avoidance to answer questions because he does not have an answer. However, his questions show little more than a failure to understand that 1) Creation is an unconstrained explanation as it would both explain genetic similarity in a nested hierarchy as well as absence thereof. The problem however is that Creation explains anything and thus nothing. Failure to understand science and the scientific method seems to have led Bobby down yet another path of ignorance and avoidance. We can only predict that it will take not much time for him to abandon yet another topic and move on to yet another one. If he only spent a fraction of the time he spends on his 'foolish' comments on educating himself he would not have made such foolish comments about holograms, body plans etc. Yet, Bobby's failures do serve as a powerful lesson to those who want to walk down a similar path. For that we should be thankful.
cobby said: Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia … if reptiles and mammals have been individually created would they NOT have the same genetic material? ...... interesting: they do not have an answer to the above question so they feel if they call it 'innane' they can avoid answering it.

PvM · 9 November 2008

Confused by a metaphor? Figures.
cobby said: All I can do is ask more inane questions and try to deflect the burden of proof once again. ... burden of proof? I was told science does not 'prove anything.

PvM · 9 November 2008

Very well said..
SWT said:
cobby said: Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia … if reptiles and mammals have been individually created would they NOT have the same genetic material? ...... interesting: they do not have an answer to the above question so they feel if they call it 'innane' they can avoid answering it.
If reptiles and mammals had been individually created rather than resulting from common descent, genetic similarity would not necessarily be observed.

PvM · 9 November 2008

Seems Bobby needs a lot more education as to how cladistic analysis or genetic similarity is determined. Sad to hear that other than 'ridiculing' Bobby has done nothing to reject the arguments presented. His questions betray his ignorance, his avoidance of questions his inability to lessen said ignorance.
cobby said: ... it is easy to get confirming predictions. where are the predictions to what we would see if the theory is NOT valid. Did mammals evolve from reptiles? Well let’s see what predictions have been made: Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia .... genetic similarity?? thats a broad statemnet. express it in a way that can be test A cladistic analysis of morphology should yield the same topology as the nested hierarchy produced on the genetic data ... same as above Reptiles and mammals should share common developmental pathways that are conserved in the early stages and more divergent in the later stages ... ontog recaps philog? There should be intermediate forms between reptiles and mammals in the fossil record including intermediate forms in the evolution of the three bones of the inner ear .... the jaw bones became the middle ear?? any other evidence?? ... would love to see some specific examples of your above vague generalizations ...OK if NS and common descent did not work would there be ANY humans according to your theory?

cobby · 9 November 2008

If reptiles and mammals had been individually created rather than resulting from common descent, genetic similarity would not necessarily be observed.

.... ok then genetic similarity is not a validation of Darwinism

PvM · 9 November 2008

It should not come as a shock to many that Bobby is as usual mistaken I am sure he will ignore this as well as other scientific data that has been presented to him. No surprise here really.
cobby said: Modern reptiles and mammals are both the result of millions of tiny changes from some common ancestor. ... any experiments backing this up? and predictions? falsification scenarios? nice hypothesis. but unfortunately cannot be validated.

cobby · 9 November 2008

Creation is an unconstrained explanation as it would both explain genetic similarity in a nested hierarchy as well as absence thereof.

... just as geocentrism and/or heliocentrism both would explain both the absence or presence of the planet jupiter.

PvM · 9 November 2008

Of course it is, for Darwinism, which is based on observable mechanisms, genetic similarity is a requirement. Seems that Bobby is once again struggling with understanding the scientific method. Genetic similarity would not be a validation of 'Creation' unless one can constrain it. Basic logic...
cobby said: If reptiles and mammals had been individually created rather than resulting from common descent, genetic similarity would not necessarily be observed. .... ok then genetic similarity is not a validation of Darwinism

PvM · 9 November 2008

cobby said: Creation is an unconstrained explanation as it would both explain genetic similarity in a nested hierarchy as well as absence thereof. ... just as geocentrism and/or heliocentrism both would explain both the absence or presence of the planet jupiter.
Nope. You are confusing the simple fact that 'Creation' is an unconstrained explanation, geocentrism and heliocentrism are not. Creationism, to be a valid explanation of evolution needs to explain in a non begging the question manner the existence of nested hierarchies and genetic similarities.

cobby · 9 November 2008

Of course it is, for Darwinism, which is based on observable mechanisms, genetic similarity is a requirement.

.... then what EXACTLY would we see if genetic similarity did not exist in the animal kingdom. you have said Darwinism has made a prediction. so you must be saying if Darwinism were incorrect we would see WHAT in this area?

PvM · 9 November 2008

Lack of genetic similarity. That was simple. No hierarchical branching but rather straight lines within 'kinds'. And within kinds, there would be no expectation of similarities in for instance well conserved genes such as hox genes. Surely you can think of your own ways how Darwinism would be rejected by a lack of genetic similarity? You do know how Darwinian theory was defined by Darwin?
cobby said: Of course it is, for Darwinism, which is based on observable mechanisms, genetic similarity is a requirement. .... then what EXACTLY would we see if genetic similarity did not exist in the animal kingdom. you have said Darwinism has made a prediction. so you must be saying if Darwinism were incorrect we would see WHAT in this area?

cobby · 9 November 2008

..... here is the error in their argument. they say that species were not individually created. they also say that it is possible if they were created there would be genetic similarities. but then they say validation that they were NOT created is a lack of genetic similarities. this simply is not logical.

PvM · 9 November 2008

Honestly I have no idea what you are trying to say here. Genetic similarity is in strong support of Darwinian theory while for 'Creation' it cannot be seen as support unless one can constrain 'Creation' to use genetic similarities. Creation, since it lacks any content, always remains a possibility, but will also always lack as a scientific explanation until it can be 'constrained'. Surely you must comprehend?
cobby said: ..... here is the error in their argument. they say that species were not individually created. they also say that it is possible if they were created there would be genetic similarities. but then they say validation that they were NOT created is a lack of genetic similarities. this simply is not logical.

PvM · 9 November 2008

Seems Bobby is confused about the following logic

1. Darwinian theory predicts genetic similarity

2. 'Creation' predicts absence or presence of genetic similarity since it is not constrained

Genetic similarity is found

1. thus is validated by the evidence 2. remains as uninteresting as a scientific explanation as ever.

Capisce?

PvM · 9 November 2008

Have you read this article yet Bobby? Anything related to this article? Simple research will uncover a truly massive amount of literature discussing these issues. What's holding you back?
PvM said: Both, of course, this is not the first time I have read the article. But of course, you will use anything to avoid dealing with science. Predictable. Thanks for playing.
cobby said: Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006 ... you read this article?? or just googled it?

cobby · 9 November 2008

Surely you must comprehend?

.... I comprehend however you seem confused. I guess you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity.

PvM · 9 November 2008

Simple 1.Existence of nested hierarchies 2.Existence of well conserved hox genes 3.(near) universal genetic code Just follow the link I provided earlier. There is a wealth of data there. A lack of genetic similarities would lead to lack of consistent and coherent phylogenies, species would arise out of 'temporal' order causing a major discrepancy between genetic data and fossil data (bunny in the Cambrian). THis is basic stuff Bobby. Glad you are making an attempt but much of this can be found on line and in any good book on evolution.
cobby said: Surely you must comprehend? .... I comprehend however you seem confused. I guess you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity.

cobby · 9 November 2008

1.Existence of nested hierarchies 2.Existence of well conserved hox genes 3.(near) universal genetic code

.... again these are generalities

you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity. SPECIFICALLY.

PvM · 9 November 2008

How more specific can you get than this? Did you follow the link I provided to 29+ evidences? I suggest you familiarize yourself with the evidence, the arguments and then report to us what remaining areas of confusions you would like for us to address. "You can lead a horse to water but you can't make it drink"
cobby said: 1.Existence of nested hierarchies 2.Existence of well conserved hox genes 3.(near) universal genetic code .... again these are generalities you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity. SPECIFICALLY.

cobby · 9 November 2008

PvM said: How more specific can you get than this? Did you follow the link I provided to 29+ evidences? I suggest you familiarize yourself with the evidence, the arguments and then report to us what remaining areas of confusions you would like for us to address. "You can lead a horse to water but you can't make it drink"
cobby said: 1.Existence of nested hierarchies 2.Existence of well conserved hox genes 3.(near) universal genetic code .... again these are generalities you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity. SPECIFICALLY.
... i am familiar with those 'evidences' they are in error. why are you avoiding my questions? ........ you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity. SPECIFICALLY

DS · 9 November 2008

The troll is simply assuming that in order to validate "Darwinism" one would have to disprove creationism. That of course is a logical fallacy, as PvM correctly points out.

If creationism predicts that no nested hierarchy of genetic similarities should be found, then creationism is conclusively falsified. If creationism makes no claims regarding genetic similaarity then creationism is unfalsifiable.

The theory of evolution predicts that a nested hierarchy of genetic similarity should be found, if it were not, then the theory of evolution would be falsified. However, a nested hierarchy is found and it corresponds precisely to the hierarchy produced by the morphological data and the fossil record. Who knows what it would look like if descent with modification were not true? What would it look like if there were no blue teapot in orbit around the moon? The troll of many names has still not learned anything in it's time her. It just keeps making the same mistakes over and over. More is the pity.

One could hypothesize about what one might observe if there were no nested hierarchy, depending on what alternative was proposed. For example, if an all powerful, omnipotent creator were to create every species fixed and perfect, then I guees that butterflies could be some random genetic distance from every other species and the distances would not correspond to any morphogical distance. So I guess one butterfly could be more closely related to spiders that to any other butterflies and another butterfly could be more closely related to a sponge than to any other insects, etc. I guess it would all be at the whim of the creator and so there need be no discernable pattern. Of course there is a pattern and there is no reason for an omnipotent creator to be constrained by such a pattern.

The troll cannot comprehend this because the explanation takes more than two lines and it has attention deficit disorder.

PvM · 9 November 2008

If they are 'in error' then please present your arguments. Prediction: Bobby will pretend he never stated this and continue to avoid presenting any errors of these 'evidences'. Surprise me...
cobby said: ... i am familiar with those 'evidences' they are in error. why are you avoiding my questions? ........ you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity. SPECIFICALLY

PvM · 9 November 2008

A common confusion amongst science doubters is that Darwinian theory is based on a disproof of creationism. As history correctly shows, Darwin's arguments did not rely on disproving Creation but rather by providing a scientific alternative to the content free 'explanation', Darwin allowed science to proceed a more fertile path. Creationism predicts little, while Darwinian theory predicts and retrodicts. That Bobby fails to understand says more about his lack of familiarity with the arguments... Well stated DS
DS said: The troll is simply assuming that in order to validate "Darwinism" one would have to disprove creationism. That of course is a logical fallacy, as PvM correctly points out. If creationism predicts that no nested hierarchy of genetic similarities should be found, then creationism is conclusively falsified. If creationism makes no claims regarding genetic similaarity then creationism is unfalsifiable. The theory of evolution predicts that a nested hierarchy of genetic similarity should be found, if it were not, then the theory of evolution would be falsified. However, a nested hierarchy is found and it corresponds precisely to the hierarchy produced by the morphological data and the fossil record. Who knows what it would look like if descent with modification were not true? What would it look like if there were no blue teapot in orbit around the moon? The troll of many names has still not learned anything in it's time her. It just keeps making the same mistakes over and over. More is the pity. One could hypothesize about what one might observe if there were no nested hierarchy, depending on what alternative was proposed. For example, if an all powerful, omnipotent creator were to create every species fixed and perfect, then I guees that butterflies could be some random genetic distance from every other species and the distances would not correspond to any morphogical distance. So I guess one butterfly could be more closely related to spiders that to any other butterflies and another butterfly could be more closely related to a sponge than to any other insects, etc. I guess it would all be at the whim of the creator and so there need be no discernable pattern. Of course there is a pattern and there is no reason for an omnipotent creator to be constrained by such a pattern. The troll cannot comprehend this because the explanation takes more than two lines and it has attention deficit disorder.

cobby · 9 November 2008

Creationism predicts little, while Darwinian theory predicts and retrodicts.

... yes of course Dism predicts just about everything. What does it say will not happen? you still have not answered the genetic similarity question.

DS · 9 November 2008

If the troll wants any more specific details, then perhaps it can give an example of what one would observe if the magic invisible hologram was responsible for development rather than morphogenic fields. Perhaps it could give a specific example of an observation tht would falsify it's nonsensical hypothesis. Perhaps it could give just one testable detail of the magic invisible hologram. Of wait, it claimed that it did not work in the dark. I guess that the hypothesis is conclusively falsified then.

PvM · 9 November 2008

Again you are incorrect, I referred you to the Evidences page which you assert is erroneous. It's up to you to defend your argument. And Darwinian theory does not predict just about everything, on the contrary, that is yet another foolish assertion. Darwinian theory: Genetic similarity, consistent nested phylogenies Potential rejection: Lack of consistently nested phylogenies
cobby said: Creationism predicts little, while Darwinian theory predicts and retrodicts. ... yes of course Dism predicts just about everything. What does it say will not happen? you still have not answered the genetic similarity question.

PvM · 9 November 2008

ROTFL. Let's not remind Bobby of that foolish episode... Or perhaps we should? Either way, it shows a fascinating hit and run mentality.
DS said: If the troll wants any more specific details, then perhaps it can give an example of what one would observe if the magic invisible hologram was responsible for development rather than morphogenic fields. Perhaps it could give a specific example of an observation tht would falsify it's nonsensical hypothesis. Perhaps it could give just one testable detail of the magic invisible hologram. Of wait, it claimed that it did not work in the dark. I guess that the hypothesis is conclusively falsified then.

PvM · 9 November 2008

Bobby's method of logic

Bobby: show me the evidence

Evidence is shown

Bobby: Show me the evidence

Evidence is shown again

Bobby: The evidence is wrong

Why

Bobby: Don't ask me such silly questions... It just is. Trust me...

cobby · 9 November 2008

For example, if an all powerful, omnipotent creator were to create every species fixed and perfect, then I guees that butterflies could be some random genetic distance from every other species and the distances would not correspond to any morphogical distance.

... you are using a strawman. the old 'creator must be perfect' trick.

..... are you saying that a less than perfect creator could not have used similar parts in similar animals? Is that not the way the 'creator' of automobiles has done. Fords and Chevys have similar parts. Does that show they were not created?

.... the point is that Darwinism is NOT validated because we observe genetic similarities. We would see those whether or not Dism is true or not. Just as we would see stars in the sky if heliocentrism was true or false

cobby · 9 November 2008

Creationism predicts little,

... ???

.... it predicts not complete common descent and lack of transitionals and sudden appearance of species, does it not??

cobby · 9 November 2008

DS said: If the troll wants any more specific details, then perhaps it can give an example of what one would observe if the magic invisible hologram was responsible for development rather than morphogenic fields. Perhaps it could give a specific example of an observation tht would falsify it's nonsensical hypothesis. Perhaps it could give just one testable detail of the magic invisible hologram. Of wait, it claimed that it did not work in the dark. I guess that the hypothesis is conclusively falsified then.
... never said the above was a testable scientific theory. it was an ANALOGY , mr. dummy. there is no proof for an analogy. it is just a way to make a point .... Is Darwinism just an analogy???

cobby · 9 November 2008

Potential rejection: Lack of consistently nested phylogenies

... need specific example

PvM · 9 November 2008

Nope, and the concept of 'perfection' is yet another meaningless concept. As the poster observes correctly, there should be no constraints on the designer, unless of course you have a way to constrain the Christian God. Feel free to do so. The point is that Darwinian theory predicts genetic similarities and thus is validated. That does not mean that merely finding similarities is sufficient but it is necessary. Fords and chevys do not form a nested hierarchy. And we see good examples of a hybrid or even a non-gas engine. Designers are not constrained by reusing parts.
cobby said: For example, if an all powerful, omnipotent creator were to create every species fixed and perfect, then I guees that butterflies could be some random genetic distance from every other species and the distances would not correspond to any morphogical distance. ... you are using a strawman. the old 'creator must be perfect' trick. ..... are you saying that a less than perfect creator could not have used similar parts in similar animals? Is that not the way the 'creator' of automobiles has done. Fords and Chevys have similar parts. Does that show they were not created? .... the point is that Darwinism is NOT validated because we observe genetic similarities. We would see those whether or not Dism is true or not. Just as we would see stars in the sky if heliocentrism was true or false

PvM · 9 November 2008

Lack of consistently nested phylogenies is a specific example.
cobby said: Potential rejection: Lack of consistently nested phylogenies ... need specific example

DS · 9 November 2008

The question about genetic similarity was answered, multiple times. The questions about the magic invisible hologram were not. If the troll doesn't like the answers it can make up it's own.

The troll of many names is just using a strawman argument, the magic invisible creator could have made everything look exaclty like it would if evolution had actually happened. Not a very scientific explanation.

Creationism may or may not predict lack of common descent, lack of transitionals and sudden appearance of species. If it does, it is falsified. If it doesn't, it is unfalsifiable.

Now, how about those "bricks". Are enzymes just "bricks"? Are transcription factors just "bricks"? I sure hope it educated itself about these topics by now.

PvM · 9 November 2008

You are confusing predictions with ad hoc stipulations. But if it predicts, in a somewhat ad hoc manner, the sudden appearance of species, then or lack of transitionals then creation has been disproven. Is that your argument? And what would disproof do for the concept of creation? Nothing really since it can accommodate lack or existence of any of the examples you mention. Hope this clarifies.
cobby said: Creationism predicts little, ... ??? .... it predicts not complete common descent and lack of transitionals and sudden appearance of species, does it not??

cobby · 9 November 2008

Fords and chevys do not form a nested hierarchy.

.... give an example of a 'nested hierarchy'

cobby · 9 November 2008

Creationism predicts little, while Darwinian theory predicts and retrodicts.

Creationism may or may not predict lack of common descent, lack of transitionals and sudden appearance of species. If it does, it is falsified. If it doesn’t, it is unfalsifiable.

... the 2 statements above seem to be contraditory.

.... anyhow has Creationism been proving wrong??

cobby · 9 November 2008

the magic invisible creator could have made everything look exaclty like it would if evolution had actually happened. Not a very scientific explanation.

.... i never said that. quit the lying. you deceitful troll

DS · 9 November 2008

So now we can add "nested hierarchy" to the list of things that the troll of many names does not understand. It should go look it up for itself.

If the troll wants to agrue about what creationism does or does not predict, it needs to pick one form of creationism and explain what it predicts and what it doesn't predict.

How about a specific example of a transcription factor that is a "brick"? Oh well, at least it has now stopped trying to claim that there is a magic invisible hologram. I guess it realizes that it is all morphogenic fields after all. Well that only took two months.

cobby · 9 November 2008

And what would disproof do for the concept of creation? Nothing really since it can accommodate lack or existence of any of the examples you mention.

.... has creationism been disproven??

cobby · 9 November 2008

Creationism predicts little, while Darwinian theory predicts and retrodicts.
DS said: So now we can add "nested hierarchy" to the list of things that the troll of many names does not understand. It should go look it up for itself. If the troll wants to agrue about what creationism does or does not predict, it needs to pick one form of creationism and explain what it predicts and what it doesn't predict. How about a specific example of a transcription factor that is a "brick"? Oh well, at least it has now stopped trying to claim that there is a magic invisible hologram. I guess it realizes that it is all morphogenic fields after all. Well that only took two months.
Creationism predicts little, while Darwinian theory predicts and retrodicts. .... well you need to discuss what creationism predicts and does not with the poster who posted the above. Oh well, at least it has now stopped trying to claim that there is a magic invisible hologram. ..... i did not say the above you lying troll

DS · 9 November 2008

There it goes again. Trying to deny what it just posted for all to see. The magic invisible creator could have "used similar body parts in similar animals" but that doesn't mean that it created things to look exactly the same as they would if evolution was true. Right.

And the magic invisible hologram is just an analogy. Yea, an analogy that can't work in the dark! HA HA HA HA HA, very funny. When Wayne wakes up, I'm sure he will get a real kick out of the analogy excuse.

And yes, some forms of creationism have been conclusively falsified. That is why the rest of them are so reluctant to make any specific predictions. They don't know enough about the evidence to understand which claims have already been falsified and which claims will shortly be falsified by new evidence. Of course, the failure to make predictions removes them from the realm of science, hence the legal problems seen of late.

cobby · 9 November 2008

And yes, some forms of creationism have been conclusively falsified.

... like what liar?

cobby · 9 November 2008

DS said: So now we can add "nested hierarchy" to the list of things that the troll of many names does not understand. It should go look it up for itself. If the troll wants to agrue about what creationism does or does not predict, it needs to pick one form of creationism and explain what it predicts and what it doesn't predict. How about a specific example of a transcription factor that is a "brick"? Oh well, at least it has now stopped trying to claim that there is a magic invisible hologram. I guess it realizes that it is all morphogenic fields after all. Well that only took two months.
.... Dave Stanton. does your dean know you waste so much time here? Should I contact him??

DS · 9 November 2008

Well, it's losing the argument, so out come the impotent personal threats. Very childish.

Of course, what can your expect from someone who claims that morphogenic fields are only marginally effective at controlling development, then claims that magic invisible holograms are really responsible, then claims that they won't work in the dark, then claims that they are only an anology, then denies claiming that they don't exist. Priceless.

Stanton · 9 November 2008

It never had a viable argument to lose in the first place, what with its constant refusal to provide even the most rudimentary explanation.
DS said: Well, it's losing the argument, so out come the impotent personal threats. Very childish.

Henry J · 9 November 2008

Did mammals evolve from reptiles? Well let’s see what predictions have been made: Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia

But afaik, all living reptiles are in a side branch separate from that of mammals, and we can't test the genetics of the extinct members of reptilia. Henry

cobby · 9 November 2008

DS said: Well, it's losing the argument, so out come the impotent personal threats. Very childish. Of course, what can your expect from someone who claims that morphogenic fields are only marginally effective at controlling development, then claims that magic invisible holograms are really responsible, then claims that they won't work in the dark, then claims that they are only an anology, then denies claiming that they don't exist. Priceless.
.... what a lying nut bag you are!

cobby · 9 November 2008

DS said: Well, it's losing the argument, so out come the impotent personal threats. Very childish. Of course, what can your expect from someone who claims that morphogenic fields are only marginally effective at controlling development, then claims that magic invisible holograms are really responsible, then claims that they won't work in the dark, then claims that they are only an anology, then denies claiming that they don't exist. Priceless.
...why did you change your handle from David Stanton to DS? ashamed of your tantrums and rants here. I think I will call your dean. (989) 964-4000;

Malcolm · 9 November 2008

cobby said: Potential rejection: Lack of consistently nested phylogenies ... need specific example
Globin genes.

SWT · 9 November 2008

cobby said:
DS said: Well, it's losing the argument, so out come the impotent personal threats. Very childish. Of course, what can your expect from someone who claims that morphogenic fields are only marginally effective at controlling development, then claims that magic invisible holograms are really responsible, then claims that they won't work in the dark, then claims that they are only an anology, then denies claiming that they don't exist. Priceless.
... why did you change the subject? ...why did you change your handle from David Stanton to DS? ashamed of your tantrums and rants here. I think I will call your dean. (989) 964-4000;

SWT · 9 November 2008

Oops, forgot to preview the previous post ... it should have been:
cobby said:
DS said: Well, it's losing the argument, so out come the impotent personal threats. Very childish. Of course, what can your expect from someone who claims that morphogenic fields are only marginally effective at controlling development, then claims that magic invisible holograms are really responsible, then claims that they won't work in the dark, then claims that they are only an anology, then denies claiming that they don't exist. Priceless.
...why did you change your handle from David Stanton to DS? ashamed of your tantrums and rants here. I think I will call your dean. (989) 964-4000;
... why did you change the subject?

DS · 9 November 2008

HA HA HA, the troll of many names is complaining about someone else changing their handle. Of course the troll can call anyone it wants any time it wants, but if it does it will be in for a big surprise.

As for the accusation that I am lying about something, well anyone can read exactly where the troll said every one of those things. Perhaps Wayne can provide convenient links.

Now why do you suppose it tried to change the subject once again? Perhaps the troll would like to post it's mother's phone number.

Wayne Francis · 9 November 2008

SFB a.k.a. cobby said:
DS said: If the troll wants any more specific details, then perhaps it can give an example of what one would observe if the magic invisible hologram was responsible for development rather than morphogenic fields. Perhaps it could give a specific example of an observation tht would falsify it's nonsensical hypothesis. Perhaps it could give just one testable detail of the magic invisible hologram. Of wait, it claimed that it did not work in the dark. I guess that the hypothesis is conclusively falsified then.
... never said the above was a testable scientific theory. it was an ANALOGY , mr. dummy. there is no proof for an analogy. it is just a way to make a point
What you did was make a unsupported claim. Tried to back up that unsupported claim with some ridiculous attributes and you where shown how your stupid claim fails. Then you lie, big surprise there, and try to claim that it was an "analogy" but this fails and shows you as a stupid liar.
Analogy [uh-nal-uh-jee]
  • drawing a comparison in order to show a similarity in some respect
Trying to claim that the hologram was just an analogy might have passed if you left it at your very first claim. After you started supporting it with claims that actually didn't "show a similarity" in any respect, like saying it doesn't work in the dark, the "analogy" argument of yours fails. It would be like me saying "gambling is coin flipping" if I left it there it could be seen as an analogy to something like black jack. But when I go on to say things like "if you eat a strawberry ice cream cone with sprinkles the coin will always turn up heads" then my claim that I was making an "analogy" looses all credibility. You are a lying deceitful creationist troll SFB.
SFB a.k.a. cobby said: .... Is Darwinism just an analogy???
You can use evolution via natural selection as an analogy for other things but evolution via natural selection itself is a fact. The evidence is overwhelming. This is why, not only, over 99% of scientists support the theory of evolution but studies show that the more educated you are the more likely you are to support evolution. This includes many clergy to include Pope John Paul II. Currently there are over 11 thousand clergy that have signed a statement that says
from the Clergy Letter Project the theory of evolution is a foundational scientific truth, one that has stood up to rigorous scrutiny and upon which much of human knowledge and achievement rests. To reject this truth or to treat it as “one theory among others” is to deliberately embrace scientific ignorance and transmit such ignorance to our children.
This is exactly what SFB is doing, deliberately embracing scientific ignorance and trying to transmit this ignorance onto others. SFB is a lying deceitful arrogant and willfully ignorant creationist troll.

PvM · 9 November 2008

Except for the fact that this appears to be an accurate representation of your 'arguments'. Perhaps you can correct DS's 'confusion'? Thought so...
cobby said:
DS said: Well, it's losing the argument, so out come the impotent personal threats. Very childish. Of course, what can your expect from someone who claims that morphogenic fields are only marginally effective at controlling development, then claims that magic invisible holograms are really responsible, then claims that they won't work in the dark, then claims that they are only an anology, then denies claiming that they don't exist. Priceless.
.... what a lying nut bag you are!

PvM · 9 November 2008

Young Earth Creationism Jeez Bobby, do some research, ignorance is no excuse....
cobby said: And yes, some forms of creationism have been conclusively falsified. ... like what liar?

PvM · 9 November 2008

Biological phylogenies. Are you really that uninformed about science?
cobby said: Fords and chevys do not form a nested hierarchy. .... give an example of a 'nested hierarchy'

PvM · 9 November 2008

Already provided you troll
cobby said: Potential rejection: Lack of consistently nested phylogenies ... need specific example

PvM · 9 November 2008

Seems to me that Bobby's problem is that he is or has shown little familiarity with biological sciences, the scientific method and logic.

Too bad.

Wayne Francis · 9 November 2008

SFB a.k.a. cobby said:
DS said: Well, it's losing the argument, so out come the impotent personal threats. Very childish. Of course, what can your expect from someone who claims that morphogenic fields are only marginally effective at controlling development, then claims that magic invisible holograms are really responsible, then claims that they won't work in the dark, then claims that they are only an anology, then denies claiming that they don't exist. Priceless.
...why did you change your handle from David Stanton to DS? ashamed of your tantrums and rants here. I think I will call your dean. (989) 964-4000;
Have you called my current employer yet SFB? Seems you are having issues of threatening other people here. You should get some professional help with that mental condition of yours. Let me tell you a little secret. No one here is scared of you calling anyone. Go ahead nut job call away. Don't be surprised when people hang up on you though. I'm pretty sure SFB here has been told before that DS and David Stanton are 2 different people. I could be wrong about this but I'm pretty sure. I didn't book mark that page because I didn't think that it wouldn't register with SFB little brain. He probably thinks PvM, SWT, Malcolm, myself and everybody else that has posted here is the same person. Every time people show SFB for the troll he is he strikes out like this. It is sad, very very sad. Ah well, almost lunch time, got to run into the city to have lunch with some friends.

Stanton · 9 November 2008

Wayne Francis said: I'm pretty sure SFB here has been told before that DS and David Stanton are 2 different people. I could be wrong about this but I'm pretty sure. I didn't book mark that page because I didn't think that it wouldn't register with SFB little brain. He probably thinks PvM, SWT, Malcolm, myself and everybody else that has posted here is the same person.
He also has demonstrated that he is too lazy or too dim to realize that I am a different person than either DS or David Stanton.

Malcolm · 9 November 2008

cobby said:
PvM said: How more specific can you get than this? Did you follow the link I provided to 29+ evidences? I suggest you familiarize yourself with the evidence, the arguments and then report to us what remaining areas of confusions you would like for us to address. "You can lead a horse to water but you can't make it drink"
cobby said: 1.Existence of nested hierarchies 2.Existence of well conserved hox genes 3.(near) universal genetic code .... again these are generalities you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity. SPECIFICALLY.
... i am familiar with those 'evidences' they are in error. why are you avoiding my questions?
Just because something doesn't match what your Sunday school teacher says, doesn't mean it is in error. If you what your opinion to be taken seriously, you need to back it up with some kind of data
........ you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity. SPECIFICALLY
Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes. A creator could have stuck them in there, but there is absolutely no reason to have done so. Of course I don't expect the troll to understand any of this, but for anyone actually interested in science, I recommend taking a look at the globins. That specific enough for you, troll?

cobby · 10 November 2008

Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes.

.... wrong again!

cobby · 10 November 2008

Wayne Francis said:

I’m pretty sure SFB here has been told before that DS and David Stanton are 2 different people.

.... well lets ask him and see what he says

cobby · 10 November 2008

Have you called my current employer yet SFB? Seems you are having issues of threatening other people here.

.... tell me who your employer is. you say he knows you post here while you work so you should not be afraid. and you consider whistle blowing 'threats'? I think both you and Dave Stanton should be sanctioned for your unethical activities here.

Malcolm · 10 November 2008

cobby said: Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes. .... wrong again!
Care to elaborate? You asked for a specific example. I provided one. As I said before, the fact that it goes against what you learned in Sunday school doesn't make it wrong. If you want to refute something, you will need to provide data.

Malcolm · 10 November 2008

cobby said: Have you called my current employer yet SFB? Seems you are having issues of threatening other people here. .... tell me who your employer is. you say he knows you post here while you work so you should not be afraid. and you consider whistle blowing 'threats'? I think both you and Dave Stanton should be sanctioned for your unethical activities here.
What have they done that you think is unethical?

cobby · 10 November 2008

Malcolm said:
cobby said: Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes. .... wrong again!
Care to elaborate? You asked for a specific example. I provided one. As I said before, the fact that it goes against what you learned in Sunday school doesn't make it wrong. If you want to refute something, you will need to provide data.
... I dont go to 'sunday school' i am not a christian. not religious. you are wrong again. .... you have just said that globin genes are a perfect example etc... you have not backed up YOUR claim with any data.

cobby · 10 November 2008

Malcolm said:
cobby said: Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes. .... wrong again!
Care to elaborate? You asked for a specific example. I provided one. As I said before, the fact that it goes against what you learned in Sunday school doesn't make it wrong. If you want to refute something, you will need to provide data.
... wayne surfs the net on company time and so does DS. DS is foul mouthed and a bad example for where he teaches. both of their employers should be informed of their activities. it helps people who DO have a work ethic

Malcolm · 10 November 2008

cobby said:
Malcolm said:
cobby said: Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes. .... wrong again!
Care to elaborate? You asked for a specific example. I provided one. As I said before, the fact that it goes against what you learned in Sunday school doesn't make it wrong. If you want to refute something, you will need to provide data.
... I dont go to 'sunday school' i am not a christian. not religious. you are wrong again. .... you have just said that globin genes are a perfect example etc... you have not backed up YOUR claim with any data.
Did I mention "literal textbook example"? If you knew anything about genetics, you would know about this. I'd point you to some papers on it, but what would be the point? You don't read science papers.

cobby · 10 November 2008

Did I mention “literal textbook example”? If you knew anything about genetics, you would know about this. I’d point you to some papers on it, but what would be the point? You don’t read science papers.

.... yes and i could point you to many places etc, etc. but the point here is to explain your ideas in these boxes. anyone say 'its all out there' 'here is a link read it '

.... you have said 'pseudogenes prove my point' and i am saying 'no they dont' . but arguments have equal value.

Wayne Francis · 10 November 2008

SFB a.k.a. cobby said: Have you called my current employer yet SFB? Seems you are having issues of threatening other people here. .... tell me who your employer is. you say he knows you post here while you work so you should not be afraid. and you consider whistle blowing 'threats'? I think both you and Dave Stanton should be sanctioned for your unethical activities here.
SFB can't read. I already told him who I worked for. It isn't whistle blowing SFB. Whistle blowing is an employee reporting criminal activity within the company. I have 2 standard contract I offer companies. One has clause that only 80% of my time is billable to projects. The other is 90% but my hourly rate goes up by 15%, technically it goes up by 16.35%. Most organisations opt for the 80% billable. I've had 2 contracts that actually offered 25% of my time on R&D projects of my choosing but those are in more academic setting. You better report me to my past full time employers for me receiving 4 weeks of holidays a year. How about reporting me for using an expense account to bring my team out to lunch! SFB doesn't realise that in academic settings doing things like this can be pretty much expected. SFB is locked into thinking everyone's job is like his flipping burgers at Burger King. For SFB
Threat [thret]
  • a declaration of an intention or determination to inflict punishment, injury, etc., in retaliation for, or conditionally upon, some action or course; menace
  • a warning that something unpleasant is imminent
  • an expression of intent to injure or punish another
The fact that SFB threats are idle threats doesn't mean they are not threats. It is like a six year old coming up to me on the street and threatening to hurt me by punching me. I don't have to be worried about the threat for it still being a threat. SFB's intent is that he thinks he can inflict punishment on DS and myself. The fact that he doesn't understand that he's like that six year old doesn't matter. SFB you truly are an idiot.

Wayne Francis · 10 November 2008

SFB a.k.a. cobby said:
Malcolm said:
SFB a.k.a. cobby said: Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes. I also notice SFB is evading questions again. .... wrong again!
Care to elaborate? You asked for a specific example. I provided one. As I said before, the fact that it goes against what you learned in Sunday school doesn't make it wrong. If you want to refute something, you will need to provide data.
... wayne surfs the net on company time and so does DS. DS is foul mouthed and a bad example for where he teaches. both of their employers should be informed of their activities. it helps people who DO have a work ethic
SFB can't wrap his head around the idea that this isn't unethical behaivor. All internet traffic is logged. Not only does my manager know what sites I visit but his manager and networks konw what I'm doing. If it was unethical then they wouldn't have accepted my contract SFB. Hey SFB why don't you tell my mom that I call you a lying deceiftul shit for brain troll.

Wayne Francis · 10 November 2008

SFB a.k.a. cobby said: Did I mention “literal textbook example”? If you knew anything about genetics, you would know about this. I’d point you to some papers on it, but what would be the point? You don’t read science papers. .... yes and i could point you to many places etc, etc. but the point here is to explain your ideas in these boxes. anyone say 'its all out there' 'here is a link read it ' .... you have said 'pseudogenes prove my point' and i am saying 'no they dont' . but arguments have equal value.
SFB thinks his unsupported claims, and SFB has been shown to lie repeatedly, is as valid as others peoples claims that are supported by multiple sources by people and don’t lie.

cobby · 10 November 2008

Definition of a whistleblower

Most whistleblowers are internal whistleblowers, who report misconduct to a fellow employee or superior within their company. External whistleblowers, however, report misconduct to outside persons or entities. In these cases, depending on the information's severity and nature, whistleblowers may report the misconduct to lawyers, the media, law enforcement or watchdog agencies, or other local, state, or federal agencies.

... wrong again! look up qui tam. and if you are so sure of yourself tell me where you work and i will talk to them.

Dave Lovell · 10 November 2008

You certainly are wrong again!
Wayne said:Whistle blowing is an employee reporting criminal activity within the company
How can you present this in response!
cobby said: Definition of a whistleblower Most whistleblowers are internal whistleblowers, who report misconduct to a fellow employee or superior within their company. External whistleblowers, however, report misconduct to outside persons or entities. In these cases, depending on the information's severity and nature, whistleblowers may report the misconduct to lawyers, the media, law enforcement or watchdog agencies, or other local, state, or federal agencies. ... wrong again! look up qui tam. and if you are so sure of yourself tell me where you work and i will talk to them.
To me this says "internal whistle blowing" is reporting criminal activity within a company to a superior or fellow employee, and "external whistle blowing" is reporting criminal activity within a company to an external agent. How can you think either applies in your case?

cobby · 10 November 2008

Wayne said:Whistle blowing is an employee reporting criminal activity within the company

.... where did he say that??

SWT · 10 November 2008

cobby said: Wayne said:Whistle blowing is an employee reporting criminal activity within the company .... where did he say that??
http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-172574 cobby, you should probably see a specialist about your short-term memory issues ...

Stanton · 10 November 2008

SWT said:
cobby said: Wayne said:Whistle blowing is an employee reporting criminal activity within the company .... where did he say that??
http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-172574 cobby, you should probably see a specialist about your short-term memory issues ...
I would say, "but the problem is that he keeps forgetting about it," but, the truth of the matter is that he doesn't care.

Dan · 10 November 2008

DS said: Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes. cobby replied: .... wrong again!
Cobby is actually under the misimpression that s/he's presenting an argument!

PvM · 10 November 2008

Right again... ;-) Don't expect an argument from Bobby though, that's too much to ask for. Instead, expect him to move onward to a new 'topic' and pretend his earlier requests were never made.
Dan said:
DS said: Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes. cobby replied: .... wrong again!
Cobby is actually under the misimpression that s/he's presenting an argument!

PvM · 10 November 2008

Some questions Bobby has yet to address:

Prediction: Genetic similarity and nested hierarchies such as found in globins

Falsification: Lack of nested hierarchies or genetic similarities.

Assertion: Bobby: The claims at 29+ Evidences for Macroevolution The Scientific Case for Common Descent are in error.

Argument: Bobby has provided none.

Let's see if we can get Bobby to present some arguments to support his claims.

phantomreader42 · 10 November 2008

Bobby has yet to address ANYTHING relating to reality. Bobby is a lying sack of shit with a terminal allergy to evidence. It has never had anything worth saying, and it never will. This has been obvious for months. Nothing, absolutely nothing, will ever get Bobby the boob to present any evidence for his IDiotic claims, the very idea of evidence terrifies him. And of course he denies making all those claims, even when confronted with the direct quote. As with all creationists, the truth is his mortal enemy. In conclusion, Bobby the boob is a worthless lying sack of shit, and all his future posts should be automatically deleted as spam. Also, call whatever library he's posting from and tell them to wash the chair he's jerking off in.
PvM said: Some questions Bobby has yet to address: Prediction: Genetic similarity and nested hierarchies such as found in globins Falsification: Lack of nested hierarchies or genetic similarities. Assertion: Bobby: The claims at 29+ Evidences for Macroevolution The Scientific Case for Common Descent are in error. Argument: Bobby has provided none. Let's see if we can get Bobby to present some arguments to support his claims.

phantomreader42 · 10 November 2008

Malcolm said:
cobby said: phantomreader42 replied to comment from cobby | November 8, 2008 2:12 PM | Reply So, for the record, you HAVEN’T offered anything remotely resembling evidence, and once again you desperately try to distract attention from the fact that you’re a lying sack of shit. You know you’ve got nothing, everyone knows it. Time to put up or shut up, brain-dead troll. Provide your evidence, or take your mental masturbation elsewhere. ... would you be comfortable having this individual alone with your children??
Much more comfortable than leaving them with a creationist loon like yourself.
I can imagine how cobby's babysitting career might go. He'd probably rape the child, kill it, eat it, and then insist to the parents' faces that there never was a child, while standing on a pile of the bones. AT least it might give him a chance at an insanity plea. Reality just does not exist for the sack of shit. Oh, poor troll have a problem with me making shit up? It's your whole argument, and at least I have some damn creativity.

ben · 10 November 2008

I have an idea on how to deal with Bobby. Enforce his ban. Oh yeah, PT is run by spineless wimps who thrive on 90-page derailed comment threads, would rather snipe endlessly at ineducable trolls instead of maintain the slightest QC, and seem to be capable of being fooled innumerable times by idiots who post under slightly different names, I forgot. Nevermind.

PvM · 10 November 2008

Phantomreader, I believe that you are way out of line here...

PvM · 10 November 2008

Last I checked, PT contributors were all vertebrates.
ben said: I have an idea on how to deal with Bobby. Enforce his ban. Oh yeah, PT is run by spineless wimps who thrive on 90-page derailed comment threads, would rather snipe endlessly at ineducable trolls instead of maintain the slightest QC, and seem to be capable of being fooled innumerable times by idiots who post under slightly different names, I forgot. Nevermind.

Science Avenger · 10 November 2008

Then they are either masochists, have a really perverse sense of humor, or are completely disinterested in attracting new, intelligent readers.

SWT · 10 November 2008

Last I checked, PT contributors were all vertebrates.

... where is the evidence? Or do you just believe this on FAITH? This is a huge problem for Darwinism. I think you just googled this and are faking it.

PvM · 10 November 2008

ROTFL
SWT said: Last I checked, PT contributors were all vertebrates. ... where is the evidence? Or do you just believe this on FAITH? This is a huge problem for Darwinism. I think you just googled this and are faking it.

phantomreader42 · 10 November 2008

PvM said: Phantomreader, I believe that you are way out of line here...
So, the troll of many names, despite supposedly being banned, is allowed to spend 90 pages spewing nothing but bullshit and slander, but I'm not allowed to return the favor once? If bobby the boob is even capable of being reached (which I doubt), it might learn there's something wrong with lying by having to deal with some character assassination directed back at itself. A longshot, sure, but it's been obvious for months that facts will never penetrate the troll's delusions. Did you have a problem with your "friend" making shit up about other people at every opportunity? Nope, you've let that slide again and again. You seem to have pretty poor taste in "friends". Face it, educating the undead troll is impossible. It will never listen to reality. It likes being ignorant and spewing nonsense. It has turned off its brain, and no force in the universe will convince it to turn it back on again. No good can come of dealing with such a total waste of human life.

Henry J · 10 November 2008

SWT said: Last I checked, PT contributors were all vertebrates. ... where is the evidence? Or do you just believe this on FAITH? This is a huge problem for Darwinism. I think you just googled this and are faking it.
That needed one or two grammar or spelling errors to be convincing. ;)

DS · 10 November 2008

Ben,

I would have to agree in this case. Not only that, but they allow those who have broken the rules to post personal threats and post what they believe is personal information about other posters without their permission. I can think of no justification for allowing this behavior.

Everyone knows that these particular threats are impotent, but that is not the issue. If the site refuses to moderate the thread then they invite all sorts of illegal activity and personal attacks. Why in the world would anyone want to post here if they thought that some mentally disturbed person would post personal information about them?

If this site wishes to be destroyed by the mentally challenged such as jacob/bobby/jobby/cobby/observer/goff then they are dong a great job of accomplishing their goal. 2700 off-topic posts and counting.

Malcolm · 10 November 2008

cobby said: Did I mention “literal textbook example”? If you knew anything about genetics, you would know about this. I’d point you to some papers on it, but what would be the point? You don’t read science papers. .... yes and i could point you to many places etc, etc. but the point here is to explain your ideas in these boxes. anyone say 'its all out there' 'here is a link read it '
Since you don't know what globins are, or where they are for that matter, there isn't enough space in these boxes to educate you. If you knew any biology I wouldn't have to.
.... you have said 'pseudogenes prove my point' and i am saying 'no they dont' . but arguments have equal value.
Since you don't even know what a pseudogene is, your "argument" has no value at all.

PvM · 10 November 2008

I hear your worries. However, only the originator of this thread has control over the thread. I will however raise your concerns with the admins.
DS said: Ben, I would have to agree in this case. Not only that, but they allow those who have broken the rules to post personal threats and post what they believe is personal information about other posters without their permission. I can think of no justification for allowing this behavior. Everyone knows that these particular threats are impotent, but that is not the issue. If the site refuses to moderate the thread then they invite all sorts of illegal activity and personal attacks. Why in the world would anyone want to post here if they thought that some mentally disturbed person would post personal information about them? If this site wishes to be destroyed by the mentally challenged such as jacob/bobby/jobby/cobby/observer/goff then they are dong a great job of accomplishing their goal. 2700 off-topic posts and counting.

Wayne Francis · 10 November 2008

SFB a.k.a. cobby said: Definition of a whistleblower Most whistleblowers are internal whistleblowers, who report misconduct to a fellow employee or superior within their company. External whistleblowers, however, report misconduct to outside persons or entities. In these cases, depending on the information's severity and nature, whistleblowers may report the misconduct to lawyers, the media, law enforcement or watchdog agencies, or other local, state, or federal agencies. ... wrong again! look up qui tam. and if you are so sure of yourself tell me where you work and i will talk to them.
I've already told you SFB, go and actually read for once. I'm sure everyone else here could find the post in about 2-3 minutes SFB. The fact is most people equate whistle blowers to an individual within the organization. This is why there are special laws to protect such people from negative repercussions from the organization. Reporting criminal activity from outside the organization is just reporting them. You don't have to worry about loosing your job. SFB still doesn't understand that the only way this activity is deemed as misconduct is if the employer either states that such activity is deemed as misconduct or if such misconduct is automatically defined as illegal. Broad statements like "internet use is for official company use only" can cover this but no such clause actually exists. Not only that but my contract specifically entitles me to typically 1 and 1/2 hours a day that I can do what I want. This covers my lunch and breaks. The internet use is unrestricted baring standard clauses like use of illegal or pornographic sites due to work place sexual harassment laws. I know SFB considers use of naughty words and questions like "If you have sex in the dark is that a form of birth control?" pornography but the average person would not. It must really annoy you that you are just an internet troll that slings empty threats doesn't it SFB. Even someone was actually breaking some rule you would be to lazy to do the leg work needed to actually report them. True sign that you are a lazy ignorant lying deceitful arrogant willfully ignorant creationist troll.

DS · 10 November 2008

Thanks PvM.

Malcolm · 10 November 2008

cobby said: ... I dont go to 'sunday school' i am not a christian. not religious. you are wrong again.
You keep saying that, but I going to go with the evidence. You make the same idiotic claims as the creobots. You show the same lack of scientific literacy as the creobots. Its safe to assume you are a creobot until proven otherwise.