Over on the opposingviews.com website, Casey Luskin of the DI tries to rebut the
Kitzmiller decision by re-fighting Behe's spectacular implosion on the issue of the evolution of the vertebrate immune system. To review, in his 1996 book
Darwin's Black Box, Behe claimed that:
"As scientists we yearn to understand how this magnificent mechanism came to be, but the complexity of the system dooms all Darwinian explanations to frustruation." (Darwin's Black Box, p. 139)
"We can look high or we can look low, in books or in journals, but the result is the same. The scientific literature has no answers to the question of the origin of the immune system." (Darwin's Black Box, p. 138)
As the debate over "irreducible complexity" developed in the next decade, the most detailed arguments would go basically like this:
ID: Gradual evolution by natural selection can't produce IC structures because any structure missing a part would be nonfunctional
Evo: You are ignoring cooption of structures with different functions, which has a been a major feature of the evolutionary explanation of complex structures ever since the Origin of Species.
ID: Cooption explanations are too improbable.
Evo: Why?
ID: Because we say so.
Evo: But homology evidence shows that "IC systems" lacking parts can still have other functions, and therefore your claim that structures missing parts would be nonfunctional is wrong
ID: OK well I don't have a comeback on that point, so instead I will claim that evolutionary cooption explanations aren't detailed & tested enough to satisfy me.
Evo: Here's a bunch of detailed & tested research papers on the evolution of system X.
ID: Not detailed enough. I need every single mutation & selection pressure before I admit that evolution produced this IC system rather than ID.
At this point the ID proponent has abandoned the original argument and therefore lost, even though he won't admit it. Knowing all of this before the
Kitzmiller trial, we devised ways to bring this point to the attention of the judge. The most famous example was the fabled "immune system cross". A large amount of evidence was submitted that showed how the key feature of the vertebrate adaptive immune system, rearranging immune receptors (antibodies), evolved. The adaptive immune system produces diverse antibodies by recombination of different immunoglobin (Ig) domains. In
Darwin's Black Box, Behe argued that the gradual evolution of this system was impossible because the three crucial parts (antibody genes, recombination signal sequences, and recombination-activating genes (RAGs)) could not provide minimal function unless they were all assembled at once:
"In the absense of the [RAG] machine, the parts never get cut out and joined. In the absense of the signals, it's like expecting a machine that's randomly cutting paper to make a paper doll. And, of course in the absence of the message for the antibody itself, the other components would be pointless." (Darwin's Black Box, p. 130).
The scientific literature on the origin of this system was well-known in the evolution/ID-creationism debate, primarily because various PT posters like
Matt Inlay and
Andrea Bottaro had been waving it in the faces of the ID guys for several years. The responses of
Dembski ("ID is not a mechanistic theory, and it's not ID's task to match your pathetic level of detail in telling mechanistic stories") and
Behe were pitiful, always involving retreating to an impossible, unscientific requirement for infinite evolutionary detail before evolution was accepted and ID rejected.
So, in court in the
Kitzmiller case, the obvious thing to do was take Behe through the above steps of the immune system argument, and when he reached the point of asserting there was not enough detail -- and confirming that he still believed his 1996 statements about how the literature had "no answers" on the evolution of the immune system -- a large body of literature on just this question was presented to Behe. Behe hemmed and hawed -- he couldn't just dismiss a pile of peer-reviewed research in top journals, but he also couldn't admit that it was good enough to answer his question because then his whole position was sunk. So he asserted that the literature was not detailed enough. Telling himself this tale may have helped Behe get to sleep that night, but to any objective observer this was a ludicrous and laughable response. If hundreds of pages of peer-reviewed research specifically on the origin and evolution of the vertebrate immune system, proposing, testing, and verifying a detailed model (called the transposon model) for its origin, was not enough for Behe, then clearly nothing could ever be enough and Behe was only maintaining his position by a stubborn refusal to seriously deal with the data (and he still has not dealt with the evolutionary immunology literature in any detail). Basically, Behe's verbal victory worked in his own head but was a spectacular defeat in the eyes of anyone with a vaguely rational view of what appropriate standards of evidence in science might be (that is: when you propose and test hypotheses you have good science, when you demand impossible levels of proof before accepting anything you are engaging in pseudoscience). When this was coupled to Behe's nonanswers to questions like "Well, Dr. Behe, where is the detailed, testable ID explanation for the origin of the immune system?" it was all over. The details are
here.
Well, this particular point, more than almost anything else except perhaps the discovery of the
cdesign proponentsists, really
really stung the ID guys. The fact that it made it into the
Kitzmiller decision and numerous books, articles, and the Nova reenactment only made it worse. It is just too painful for them to contemplate it unemotionally and admit that they lost on a crucial scientific point, so occasionally ID advocates will pop up with pitiful responses that try to fix the damage. What follows is one that was really pitiful. Casey Luskin has developed a line of argument that he thinks is clever and serious, but is actually a product of the very same problem that afflicted Behe: a failure to engage seriously with the literature on evolutionary immunology and deal with the massively inconvenient facts.
In the opposingviews.com essay,
Casey Luskin writes (a fair bit down the page; the opposingviews format is pretty confusing so I reproduce the relevant bit here),
In another finding which was both wrong and irrelevant, Judge Jones ruled that "Dr. Miller presented peer-reviewed studies refuting Professor Behe's claim that the immune system was irreducibly complex."(24) Moreover, Judge Jones found that Behe's claims that the immune system was irreducibly complex were refuted by a large stack of papers dumped upon him during cross-examination:
"[O]n cross-examination, Professor Behe was questioned concerning his 1996 claim that science would never find an evolutionary explanation for the immune system. He was presented with fifty-eight peerreviewed publications, nine books, and several immunology textbook chapters about the evolution of the immune system."(25)
Yet Behe never claimed that no papers or books are "about the evolution of the immune system"--indeed in Darwin's Black Box, Behe wrote that "[t]here are other papers and books that discuss the evolution of the immune system."(26) On the contrary, Behe actually testified:
"These articles are excellent articles I assume. However, they do not address the question that I am posing. So it's not that they aren't good enough. It's simply that they are addressed to a different subject."(27)
Thus, what Behe actually requested was, "a step-by-step mutation by mutation analysis" of the evolution of the immune system, for Behe said he is "quite skeptical" that the papers in the literature dump "present detailed rigorous models for the evolution of the immune system by random mutation and natural selection."(28) Judge Jones misquoted Behe and twisted his views about the state of evolutionary literature on the origin of the immune system.
One of the 58 articles dumped on Behe was an authoritative article published in Nature the year before the Kitzmiller trial which conceded that there were major questions about step-by-step accounts of the evolution of the adaptive immune system. In that recent and authoritative paper, Max Cooper, one of the fathers of immunology, wrote that the evolutionary origin of one of the most important components of the higher vertebrate "adaptive immune system," the immunoglobulin (IG) domain containing antibody, is currently "untraceable":
"In contrast, the deployment of immunoglobulin domains as core components of jawed vertebrate recombinatorial lymphocyte receptors represents an intriguing although as yet untraceable evolutionary innovation, as immune recognition of pathogens and allografts by means of immunoglobulin superfamily members have been shown only in the jawed vertebrates."(29)
IG domains perform a primary structural function in antibodies of the "adaptive immune system" used by all jawed vertebrates (such as sharks, reptiles, birds, and mammals). The paper discovered that the antibody-equivalent in the lamprey (a jawless vertebrate fish) is highly dissimilar, both in structure and how they are assembled. In fact, the lamprey uses a completely different type of protein domain for its antibody-equivalent structures. This paper therefore calls the origin of anitibodies that utilize IG domains presently "untraceable."
Furthermore, when these authors say that the usage of IG domains is "untraceable," they are not asking the question "from what were these materials co-opted during evolution?" IG domains are found throughout biology from bacteria to humans and thus it is simple to imagine where higher vertebrates might have co-opted such domains. Rather, this paper is talking about the type of deeper question Behe raises: by what Darwinian pathway did IG domains evolve into the type of IG domain used by antibodies in the adaptive immune system of higher vertebrates?
This paper had no answer to that question, yet Judge Jones claimed that Miller provided evidence demonstrating that "[b]etween 1996 and 2002, various studies confirmed each element of the evolutionary hypothesis explaining the origin of the immune system."(30) Did Judge Jones read these 58 papers plus books and other literature dumped during the trial to verify his claim? I highly doubt it. After all, Judge Jones' discussion on the immune system was copied nearly verbatim from an ACLU brief.(31) But a cursory look at one of those papers reveals that Judge Jones' finding was a bluff, and Behe's arguments were never refuted.
In the end, most of Kenneth Miller's arguments about the evolution of the immune system were based upon observing mere sequence similarity or functional similarity between proteins used by our immune system and some found in lower organisms. In other words, some of the starting material might be crudely present elsewhere in biology, but Miller did not testify about any step-by-step Darwinian pathways as Behe requested, nor did Miller testify about the vast differences between our adaptive immune system and immune systems used by lower organisms like the Lamprey.(32) Behe was never refuted, and Judge Jones' strong findings based upon such hypothetical arguments demonstrate his uncritical acceptance of the plaintiffs' literature-dump bluffs.
These episodes provide vivid illustrations why it is dangerous for courts to try to settle these scientific debates. Legal scholars agree with this basic point.
[...]
(24) Kitzmiller
400 F.Supp.2d at 741.
(25) Id, at 741.
(26) Michael J. Behe
Darwin's Black Box, pg. 138.
(27) Transcript of Testimony of Michael Behe
19 Kitzmiller, No. 4:04-CV-2688 (M.D. Pa., Oct. 19, 2005).
(28) Id. at 19, 23
(29) Nature, Vol. 430: 174-180 (July 8, 2004)
Z. Pancer, Z., C. T. Amemiya, G. R. A. Ehrhardt, J. Ceitlin, G. L. Gartland, M. D. Cooper, "Somatic diversification of variable lymphocyte receptors in the agnathan sea lamprey"
(30) Kitzmiller
400 F.Supp.2d at 741.
(31) A Comparison of Judge Jones' Opinion in Kitzmiller v. Dover...
(32) Transcript of Testimony of Kenneth R. Miller
"The significant similarity between the transib transpases and RAG core, the common structure of these transpases and others, as well as the similar size of these basically catalyzed by these enzymes directly support the 25-year-old hypothesis of a transposon related origin of the VDJ machinery."
30-31, Kitzmiller, No. 4:04-CV-2688 (M.D. Pa., Sept. 26, 2005).
A shorter version of this argument is provided in a law review article coauthored by Luskin (David K. DeWolf, John West, Casey Luskin. "
Intelligent Design will Survive Kitzmiller v. Dover," 68
Montana Law Review 7 (Winter, 2007)):
Judge Jones ruled that a pile of fifty-eight papers dumped upon the witness stand during Behe's cross-examination refuted the claim that "science would never find an evolutionary explanation for the immune system." Kitzmiller v. Dover Area Sch. Dist, 400 F. Supp. 2d 707, 741 (M.D. Pa. 2005). Judge Jones provided no reference for that claim. Behe merely requested a reasonable standard of evolutionary proof of "detailed rigorous models for the evolution of the immune system by random mutation and natural selection." Transcr. of Procs. Afternoon Sess. at 23 (Oct. 19, 2005), Kitzmiller, 400 F. Supp. 2d 707. Did the fifty-eight papers meet that standard? One of the papers, an authoritative article recently published in Nature, reveals the answer is "no," as it clearly discussed the lack of step-by-step accounts of the evolution of key components of the immune system: "In contrast, the deployment of immunoglobulin domains as core components of jawed vertebrate recombinatorial lymphocyte receptors represents an intriguing although as yet untraceable evolutionary innovation, as immune recognition of pathogens and allografts by means of immunoglobulin superfamily members [IG domains] have been shown only in the jawed vertebrates." Z. Pancer et al., Somatic Diversification of Variable Lymphocyte Receptors in the Agnathan Sea Lamprey, 430 Nature 174, 179 (2004) (emphasis added). Immunoglobu lin (IG) domains are a common structure in proteins found throughout biology from bacteria to humans. Id. at 174. When the paper found that the evolution of IG domains is "untraceable," it was therefore not asking "from what might these structures have been borrowed during evolution?" It was asking the deeper question Behe raises: by what detailed, step-by-step pathway did IG domains come into their critical function in the adaptive immune system? Judge Jones said "each element of the evolutionary hypothesis explaining the origin of the immune system" had been "confirmed." Kitzmiller, 400 F. Supp. 2d at 741. Yet Pancer's recent, authoritative paper reveals that Judge Jones's finding merely recapitulated the plaintiffs' literature-dump bluff, and that Behe's actual arguments were never refuted.
(pp. 36-37)
When this came out, I noted its sillyness in private, but no one ever got around to rebutting it in public, so apparently Luskin figured he'd made a good point and put even more weight on it in the opposingviews.com debate.
(An aside: if you're not up on your evolutionary immunology, antibodies are basically Y-shaped receptors made up of a series of Ig-domains; different domains get switched around via V(D)J recombination to generate zillions of different antibodies that can bind almost any invader; the transposon hypothesis suggests that V(D)J recombining receptors evolved from non-recombining receptors by insertion of a transposon that would snip itself out, rejoining the receptor segments in different ways. Duplication & elaboration of this basic system produced the modern system. See the figures/discussion
here and
here)
Luskin's argument doesn't make sense even if his facts were right
Here's the short version of Luskin's argument: Luskin claims that Pancer et al. (2004) showed there was a big gap in the origin of the vertebrate immune system -- that is, where did an Ig domain involved in immune recognition come from?
This question wasn't answered by 2005, claims Luskin, and therefore (this argument resembles the "Underpants Gnomes" business plan from South Park) Judge Jones was wrong to rule that "various studies confirmed each element of the evolutionary hypothesis explaining the origin of the immune system" and therefore "Behe's arguments were never refuted."
Again, this sort of thing makes the ID proponent feel better and lets them sleep at night, but it's wrong on several levels as a scientific argument.
1. First of all, the "as yet untraceable" remark in Pancer et al. 2004 was just an aside from the main point of the paper, which was about how lampreys have their own adaptive immune system which is different from the adaptive immunity of jawed vertebrates. Evolution is used throughout the methods and analysis of the paper, so it is rather strange to attempt to use it as evidence against evolution. The paper did
not do a thorough search for Luskin's "missing" Ig domain, it just mentioned as an aside that it had not been found yet.
2. Second, it is not clear exactly what Pancer et al. actually meant in their parenthetical remark. They cite Kaufman (2002), which reports on the discovery of V-type domains in
Amphioxus, but notes various differences which indicate that that particular molecule was not a super-close relative of the non-rearranging ancestor of the V(D)J receptor. So a possible interpretation, the one which Luskin adopts, is that they are still searching for a close relative of a non-rearranging V-type receptor. But Pancer et al. might merely have been saying that they didn't detect VDJ recombination in lampreys, which is unsurprising because the system much have originated at some point, and the common view has always been that it originated after jawed vertebrates diverged from lampreys. The whole point of the transposon model is to explain how that system originated.
3. Third, even if it were true that the origin of an Ig domain with an immune function was (currently) untraceable, Luskin admits that Ig domains with other functions are well-known and widespread, so there is not really much of a "leap" left. There is no requirement in the scenario that the ancestor of the rearranging antibody had an immune function as opposed to some other binding function, although probably most immunologists thought that this was the most likely option, being a particularly gradual pathway. As previously mentioned, not just Ig domains, but specifically V-type domains were discovered in
Amphioxus in 2002 (see: Kaufman, J. (2002). "The origins of the adaptive immune system: whatever next?"
Nature Immunology 3(12): 1124-1125. This article was in the
Kitzmiller immune system exhibit, so there is a summary in the
Annotated Bibliography).
4. Fourth, even in 2005 it wasn't true to say that non-rearranging V-type Ig domains, with immune functions, in organisms diverging before jawed vertebrates, were unknown. PT poster Ian Musgrave comments:
Even by 2004 several Ig-like molecules had been identified in amphioxus and sea squirts that could play the role of the ancestor of Ig. In sea squirts there are Ig fold proteins (nectin and Junctional Adehesion Molecules) with an Ig fold and a Constant-Variable domain architecture just like the immunoglobulins. Also in amphioxus there is an Ig protein which is used in innate immunity (the Variable Domain Chitin Binding proteins) that was known in 2002 (in 2006 a protein that is a very similar to the TCR and is involved in innate immunity was found in the amphioxus, but here I'm dealing with 2004 knowledge).
The most one can say is that, in 2004, non-rearranging V-type Ig domains, with immune functions, had not yet been found specifically in lampreys.
5. Fifth, nothing about a missing Ig receptor impeaches any of the other evidence that was discovered in the literature and presented at trial. To wit:
* the VVVVVVV DDDDDD JJJJJJ arrangements found in the genomes of bony fish and land vertebrates, and the VDJ VDJ VDJ VDJ VDJ VDJ VDJ VDJ arrangements found in sharks and relatives, indicated that the common ancestor was a much simpler VDJ arrangement that was elaborated by duplication.
* the hypothesis that the recombination genes (RAG) were descended from a transposon was dramatically confirmed by the discovery of just such a transposon in the wild, a transposon which we had no reason to suspect existed, except for the transposon hypothesis for the origin of recombination.
* numerous other discoveries mentioned
here
The transposon model for the origin of the vertebrate immune system was literally standard textbook material by 2005 and was strengthened even further by several discoveries in 2005. As with any complex historical process there will always be various gaps in our knowledge, but none of this weakens the major collection of positive scientific discoveries supporting the transposon model. All of the positive evidence is still there whether or not a particular gene has yet been discovered in a particular organism. Only ID proponents think that they can turn ignorance into scientific support for their position.
6. Sixth, in 2005 we didn't even have a genome sequence for lampreys and other relevant early-diverging organisms. Claiming that a missing homology is a problem is particularly dumb if the relevant sequencing hasn't even been accomplished yet.
It gets worse for ID
So Luskin's argument is excruciatingly bad even if he had his facts right. But as it turns out, he didn't have his facts right. As Luskin noted, Pancer et al. (2004) said, in an article coauthored by "Max Cooper, one of the fathers of immunology", that:
"immune recognition of pathogens and allografts by means of immunoglobulin superfamily members have been shown only in the jawed vertebrates"
Luskin and other ID proponents seem to think that such ignorance, once admitted in science, is permanent and irrevocable, and is forever a stain on an evolutionary model for a particular system.
Unfortunately for them, though, science doesn't stay still. Have a look at this paper:
Cannon, J. P., Haire, R. N., Pancer, Z., Mueller, M. G., Skapura, D., Cooper, M. D. and Litman, G. W. (2005). "Variable Domains and a VpreB-like molecule are present in a jawless vertebrate." Immunogenetics 56(12): 924-929. (PubMed | DOI | Journal | Google Scholar)
Yes, those coauthors include the very same Pancer who was the lead author on Luskin's favorite paper, as well as "Max Cooper, one of the fathers of immunology." And what do they say?
Abstract Immunoglobulins (Igs) and T cell antigen receptors (TCRs) that undergo somatic diversification have not been identified in the two extant orders of jawless vertebrates, which occupy essential positions in terms of understanding the evolution of the emergence of adaptive immunity. Using a single motif-dependent PCR-based approach coupled with a vector that allows selection of cDNAs encoding secretion signal sequences, four different genes encoding Ig V-type domains were identified in the sea lamprey (Petromyzon marinus).
Whoops. It appears that once someone had a good hard look for V-domains in agnathans, they found them. Who would have thunk it? In the conclusion, the paper also notes:
The recent description of a non-rearranging single copy gene sequence in lamprey that can be modeled to a TCR V suggests that other molecules that are related to the combinatorial antigen binding receptors may exist in jawless vertebrates (Pancer et al. 2004b).
What's that? A homolog to another V-domain was discovered in 2004 as well? The referenced paper is:
Pancer Z, Mayer WE, Klein J, Cooper MD (2004b) Prototypic T cell receptor and CD4-like coreceptor are expressed by lymphocytes in the agnathan sea lamprey. Proc Natl Acad Sci USA 101:13273-13278
Hey look, our buddies Pancer and "Max Cooper, one of the fathers of immunology" again! And what do they say in this 2004 paper? If "prototypic T cell receptor" wasn't clear enough for you, here's the abstract:
All jawed vertebrates have highly diverse lymphocyte receptors, which allow discrimination between self and nonself antigens as well as the recognition of potential pathogens. Key elements of the anticipatory recombinatorial immune system in jawed vertebrates are the TCR, Ig, and MHC genes, but their ancestral genes have not been found in more basal vertebrates. In this study, we extended our analysis of the transcriptome of lymphocyte-like cells in the lamprey to identify the TCR-like and CD4-like genes. The structural features of these genes and their preferential expression in lymphocytes make them attractive candidates for ancestral TCR and CD4 genes. The TCR-like gene contains both V (variable) and J (joining) sequences in its first exon and exists as a single-copy gene that is invariant. Thus, the TCR-like gene cannot account for the receptor diversity that is required for the immune responses reported for lamprey, but it could have been easily modified to serve as an evolutionary precursor of modern TCR and Ig genes.
So basically, the authors
answered Luskin's question in an article published in the research literature
in the very same year as the paper which Luskin has been citing at opposingviews.com, in a comprehensive pro-ID law review article, and probably elsewhere.
But, how could poor Casey Luskin have known about this discovery? I mean, after all, he is not "one of the fathers of immunology," is he? (say, I wonder what a father of immunology would say about Behe's argument?) Well, as it happens, Cannon et al. 2005 is
sitting right there in the friggin list of articles given to Behe! Pancer et al. 2004b is not (an oversight on the part of the
Kitzmiller plaintiffs' team -- we beg forgiveness: there is so much evolutionary immunology literature, it was hard to get even a decent sample of it together!), but it was cited by Cannon et al. (2005).
Conclusion
Earth to Luskin and ID guys: you screwed up. Your
very best (and basically only) scientific counterargument to Behe's immune system debacle fell apart as soon as someone took a mildly close look at the situation. You relied on scientific ignorance to maintain some smidgen of credibility for the ID movement's rejection of massive positive evidence for evolution, and, predictably, you got burned. Again. Good job.
(Even worse, we had to catch the mistake for you, proving (again) that within the entire ID community there is no one with the knowledge/gumption/scientific spirit to read just a few measly articles on evolutionary immunology to double-check a key Luskin assertion.)
Credits
Thanks to Ian Musgrave, Andrea Bottaro, and the PT crew for helpful comments.
2696 Comments
gabriel · 19 September 2008
Behe / Luskin = seriously pwned. nice work.
one small quibble: you make it sound like V(D)J recombination swaps entire Ig domains around to create antibody diversity. V, D and J segments are subdomains of the variable Ig domains found at the antibody tips.
Vince · 19 September 2008
Luskin's scientific understanding and knowledge of the literature is even worse than implied - particularly if one considers the literature on invertebrates:
Si-Ming Zhang, Coen M. Adema, Thomas B. Kepler, Eric S. Loker (2004).
Diversification of Ig Superfamily Genes in an Invertebrate. Science 305(5681):251-254.
Bryan · 19 September 2008
Thank you for a wonderful article. Several years ago I had the opportunity to give two lectures in an evolutionary biology course on the evolution of the immune system. One lecture on the evolution of the innate immune system, the second on the adaptive.
It amazes me that creationists can say "it can't have evolved" with a straight face - looking across the animal phyla there is a clear, and obvious progression from simple "barrier" immunity, to simple macrophage-like cells, to a diversified "granulocyte" immune system, to the vertebrate system with its diversified adaptive and innate immune systems.
If anything, the immune system is a prime example of how evolution can produce an irreversibly complex system.
Which I guess is why Behe et al. are asking for every mutation along the road; that's about all the ground they got left.
Draconiz · 19 September 2008
Frat job on the article Nick, thank you
Vince · 19 September 2008
Paul Burnett · 19 September 2008
Stanton · 19 September 2008
rpsms · 19 September 2008
Isn't this the point in the trial where he was forced to admit he never actually read any of the literature presented to him but that he didn't have to because the papers didn't refute his arguments?
Shirley Knott · 19 September 2008
But "jobby" honey,
NO ONE is answering "Darwin did it".
No one but your strawman, that is.
Do try to keep up.
no hugs for thugs,
Shirley Knott
iml8 · 19 September 2008
In reference to the mindset of Mr. Luskin, Ms. O'Leary, and
their kindred ...
When reading the work of an evo scientist who rabidly hates
Darwin-bashers and blasts them at length, even if the
all the venting is edited out, usually there's plenty of
interesting substance left. Donald Prothero's recent
book EVOLUTION was an excellent example: "Good book,
professor, but you might have cut back on the tirades
somewhat."
If you take the work of the O'Luskins of the world, if
you edited out the complaints and denunciations,
there would be nothing left. I've always seen their
most blatant weakness as their complete lack of
curiosity about how things work -- how anything works,
not just evo science, how a battery works, how concrete
is made, whatever.
All people who honestly like the sciences are intensely
curious. If you consider the works of Dawkins (his
science writings at least), you see a person of intense
and perceptive curiosity, who loves to figure out how
things work. Yes, he does vent and editorialize, but
mostly as asides and footnotes, and even he has admitted
he needs to tone that stuff down at least a bit.
Point this out to the O'Luskins and the only result is
a blank stare. It is beyond their comprehension.
White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html
John Kwok · 19 September 2008
snex · 19 September 2008
one has to wonder why, if these counter arguments are so powerful, they weren't brought up in court when they would have mattered the most. i guess next time luskin should do the lawyering himself.
Science Avenger · 19 September 2008
Wheels · 19 September 2008
Paul Burnett · 19 September 2008
snex · 19 September 2008
william e emba · 19 September 2008
Do not feed the trolls. Panda versus Jobby
fnxtr · 19 September 2008
One last poke at the twit-of-many-names before it's erased: I thought it had finally admitted when cornered on a previous blog that it was a Von Danikenite. Or was that one of the other little annoyances that show up around here occasionally. It's so hard to tell the idiots apart.
mark · 19 September 2008
So, does all that Katzenjammer from the Discomfited Institute mean that they are again looking for a school district to mandate teaching of Intelligent Design Creationism as if it were science? Or will the search be left to the Sword and Shield for People of Faith again?
eric · 19 September 2008
Draconiz · 19 September 2008
Kevin B · 19 September 2008
A thought.
If MET really isn't falsifiable, is Prof Behe wasting his time?
Science Avenger · 19 September 2008
pough · 19 September 2008
Paul Burnett · 19 September 2008
Nick (Matzke) · 19 September 2008
Nick (Matzke) · 19 September 2008
I meant to say, also here:
http://www.talkdesign.org/faqs/evimmune/ei_figure005.jpg
Stanton · 19 September 2008
I almost forgot:
In A Living Bay: The Underwater World of Monterey Bay by Lovell and Libby Langstroth, it's discussed that echinoderms, or at least starfish, have their own immune system which, at least in the case of predatory starfish, enable them to digest otherwise toxic sea anemones by neutralizing the preys' venom, in that a starfish that ate strawberry anemones for the very first time took about 72 hours to a week to digest them, versus a starfish that ate strawberry anemones on a regular basis, which ate and digested the little buggers within a few hours.
But I digress: what I'm driving at is that
1) Perhaps one of the original functions of the immune system of the ancestor of echinoderms and chordates was to aid in digestion, or to neutralize potentially toxic proteins that were ingested,
and
2) Does anyone know what starfish immunoglobins look like?
Henry J · 19 September 2008
To disprove NS, just find cases in which the varieties that produce more offspring don't increase their numbers faster than the other varieties.
Alternately, find another mechanism that might produce new interacting structures in organisms, but that does so in a way that can be distinguished from natural selection (and that might have happened prior to human genetic engineering), and that can be used to explain the existing data just as well as the current theory.
Henry
Science Avenger · 20 September 2008
Or more generally, find cases where all genetic variations in a population produce the same average number of fertile adult offspring.
This is one of those rare cases where ID idiocy can produce an interesting thought experiment which, once understood, would greatly enhance the understanding of evolutionary theory for someone new to the topic.
Vince · 20 September 2008
Vince · 20 September 2008
Stanton · 20 September 2008
Dave Lovell · 20 September 2008
David Stanton · 20 September 2008
Guys, with all due respect, you are just wasting your time with this troll. It has demonstrated repeatedly that it is absolutely immune to any evidence of any kind and completely lacks the reasoning skills to follow even the most rudimentary argument.
Notice how this troll has already hijacked this thread away from the real topic, the evolution of the immune system, and now has everyone discussing macroevolution and selection instead. Ask yourself, why did it do this? Now ask yourself. why should I play along? This twit is never going to answer your questions. This is the reason it has been banned. Just ignore it and it will go away.
Now if hand jobby can demonstrate that it has read the paper on the evolution of the immune system and cares to have a real discussion on the topic of this thread, I'm sure that it can be obliged. Until then, another flush cycle is in order.
David Stanton · 20 September 2008
Hate to say I told you so, but here we go again. Troll tactic 21 - try to get you to answer your own question for it.
Science Avenger · 20 September 2008
Scott · 20 September 2008
stevaroni · 20 September 2008
Actually, there are some circumstances where you can see the results of "un"natural selection, notably in those animal and plant species that are the end result of selective breeding programs.
In these cases, humans have overridden the normal "survival of the fittest" criterion to artificially guarantee survival and breeding opportunities for "intelligently designed" traits.
Sadly, these traits are almost universally optimized for the benefit of the selector, not the animals. Examples abound of laboratory mice so ill-suited for the life outside that they die when the door is left open and turkeys with breasts so enlarged that they can no longer balance well enough to mate (oddly, this doesn't seem to be much a problem in the human species, just look at Pamela Anderson).
Speaking of blond celebrities who make sex tapes, (nice segue, huh?) I couldn't help but note in yesterdays news that Paris Hilton was inconsolable over the demise of two of her chihuahuas (an intelligently designed species), lost when coyotes (a natural selected species) got into her backyard and ate them. Natural selection back at work again in the Hollywood hills.
Stanton · 20 September 2008
Well, you have to realize that the chihuahua was originally bred by Mexican Indians, including the Aztecs, to be eaten, and that women celebrities often face selection and pressure against being intelligent.
stevaroni · 20 September 2008
Stanton · 20 September 2008
stevaroni · 20 September 2008
D. P. Robin · 20 September 2008
Science Avenger · 20 September 2008
Repeating a point-missing idiocy doesn't make it any more intelligent than it was the first time. Try again.
Science Avenger · 20 September 2008
Steve · 20 September 2008
stevaroni · 20 September 2008
Eric · 20 September 2008
Paul Burnett · 20 September 2008
Paul Burnett · 20 September 2008
David Stanton · 20 September 2008
Booby the Goof Poe (aka hand jobby),
There are links to two papers about the evolution of the immune system above. Why don't you read these papers and tell us in your own words about their implications for ID? That is the topic of this thread you know.
And don't forget, no one is going to take your word that you have read the papers this time, we will require, what was that word again, oh yea, evidence.
In the meantime, I suggest that Nick follow the example set by PvM and initiate another flush cycle for the troll of many names.
stevaroni · 20 September 2008
stevaroni · 20 September 2008
Science Avenger · 20 September 2008
Eric · 21 September 2008
All experiments are simulations. They hold some variables constant that aren't constant in nature, introduce some variable that doesn't occur (or rarely occurs) in nature, or they eliminate some factors which would normally be important.
Computer simulations are no different. The only difference between a computer simulation and a real life experiment is that in a computer simulation:
(i) you can do things much faster (good)
(ii) you can study things very difficult/expensive to do in RL (good)
(iii) you have to worry about your code correctly representing the parts of reality its standing in for (bad).
But the short answer is yes, in some cases a computer simulation can prove a hypothesis. For instance, here's a classic: computer simulations have proven that the flocking of birds and the schooling of fish requires no complex genetics or design, just a simple instinct to stay close to the animals on the other side.
Wolfhound · 21 September 2008
Um...we are still tolerating the previously banned, lying, uneducable, sockpuppet troll WHY?
rossum · 21 September 2008
Frank J · 21 September 2008
Note to lurkers:
Please don't give up on PT just because they can't or won't ban the troll.
Just ask yourself what jobby's alternate "theory" might be, and how he would test it. Ask yourself whether it might be the same as Behe's, which happens to be the only one that I'm aware of that has been endorsed (however tepidly) by any DI person. That would be that a cell was designed - and constructed - ~4 billion years ago containing all the "information" necessary for its descendants, including us and the tree outside. A pseudogene for the VDJ system in that tree's cells might be compelling evidence for that alternate "theory," and bad news for "Darwinism" - even Darwinian evolution.
If a real creationist shows up - note how they almost never do when a troll takes over - you might want to ask them whether they agree with Behe, and if not what they propose instead, and why they don't challenge Behe with the same passion that they challenge "Darwinism". But I wouldn't waste your time "feeding" jobby.
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Moron, you couldn't teach a 3rd grade class. Fact is computer simulations are common tools in science, in a wide variety of fields, which you'd know if you knew, well, anything.
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
For any lurkers who may not have experience with computer simulations, here is a simple example.
Let's say someone proposed the hypothesis that, in a roll of two standard, fair, six-sided dice, the likelihood of getting a roll of 12 was equal to the likelihod of getting a 7. We could test this hypothesis scientifically by setting up a simulation which chooses two values at random between 1 and 6, adds them together to form a roll value, and repeating this process a few hundred thousand times, recording the results, and applying the appropriate statistical tests. In doing so, we could scientifically demonstrate, within a certain statistically confidence, that the hypothesis is false.
Handjobby would have you believe these results are not scientific because we didn't take the time to roll physical dice. But this argument is nonsense. To discredit a computer simulation, one would need to show that the parameters are not correct. Otherwise, it is just as valid as the physical version, as Behe and Snoke, and the rest of the scientific world, would attest.
Stanton · 21 September 2008
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Stanton · 21 September 2008
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
stevaroni · 21 September 2008
Taking up SA's aside to any lurkers out there...
Don't forget, Computer simulations don't exist in a vacuum, we live in a world where we can and regularly do verify that computer simulations are accurate.
Once upon a time, mathematical models were abstract things. People designed boat sails by trial and error, not with calculus, and even if Newton got his sums wrong,the planets were going to ignore him and keep spinning.
But today engineers deal with entire design fields where their work is waaay too complicated to attack without good models and simulations. Examples include new aircraft, like the 7E7, a machine whose aerodynamics are so subtle that Boeing proudly brags that it was designed and tweaked for years in a computer before it ever saw the inside of a wind tunnel.
Or take my field, digital logic design.
I type this on a processor chip that has maybe 40 million gates. The only way to manage this kind of design is synthetically. no matter how good the engineer, managing all those signals and logic states running around a chip, moving charge with them and interacting with all the other signals, is simply an insurmountable task without the help of gate-level simulations which methodically track all those signals and their interactions.
Without a good, accurate, quantum model of semiconductors, processors like the one you're using now are not merely difficult to build, they are actually so difficult, they simply wouldn't exist.
Without good, accurate, aerodynamic models, the new Boeing wouldn't ever get off the ground.
Without good, accurate, models of celestial mechanics, space probes would never get to their targets. How could they? Navigating a probe to a landing on a comet requires accounting for every significant source of gravity in the solar system (all of which are moving - and interacting with each other - all the time) to a level of accuracy somewhere in the parts-per-trillions.
The fact is, computer simulations simply do work, and we know they work because in many walks of life we use them to find the answers first, then we go out and verify it.
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Sylvilagus · 21 September 2008
Sylvilagus · 21 September 2008
Dale Husband · 21 September 2008
Sylvilagus · 21 September 2008
Stanton · 21 September 2008
Stanton · 21 September 2008
jobby/jacob/balanced/hamstrung/balanced is a perfect example of what happens when a person immunizes him or herself to evidence and logic.
Science Avenger · 21 September 2008
David Stanton · 21 September 2008
Over 120 posts and not one word about the immune system or the articles that were cited above. Way to go hand jobby. You have once again proven that you are emotionally exhausted and morally backrupt.
Nick, you should really flush all of this off-topic nonsense. PvM doesn't let this troll derail his threads anymore, why should you? I really don't see why anyone responds to this adolescent twit, but if you just have to, at least try to keep the bastard on topic.
Stanton · 21 September 2008
Rolf · 21 September 2008
Science Avenger · 21 September 2008
Hey, I got to talk about my simulator, that made it all worth it.
Science Avenger · 21 September 2008
stevaroni · 21 September 2008
David Stanton · 21 September 2008
Booby the Goof Poe (aka hand jobby),
Are you emoitionally incapable of telling the turth about anything? Just look at my comment of 9/20/08 at 9:09 PM. I begged you to comment on the papers about the immune system and somehow you managed to trash up the thread with nonsense about just about everything but the immune system.
I'll make you a deal fool. I will am willing to state that there is no paper published anywhere that will saatisfy you about the role of natural selection in evolution if you promise to go away and never come back (including any alias you might try to use).
Science Avenger · 21 September 2008
Dale Husband · 21 September 2008
Note that jobby didn't see fit to comment on my essay that I posted earlier. Maybe he didn't understand it.
SWT · 21 September 2008
SWT · 21 September 2008
Henry J · 21 September 2008
David Stanton · 21 September 2008
Good point Henry. I guess someone who refuses to read the relevant papers is indeed a very good example of someone who is immune to evidence. As I have noted before, this is exactly the same behavior that got Behe and Luskin in trouble in the first place.
There is no evidence whatsoever that this jerk has ever read a single scientific publication or even watched an educational video, even when links have been provided. There is even less evidence that it has ever understood any reasonable argument. It has been repeatedly demonstrated to be absolutely wrong and has never admitted it. It has repeatedly been caught in lies and has never admitted that either.
Of course that will only be obvious if we all try to keep the troll on topic and avoid letting it derail the thread, even when it tires the juvenile "I know you are but what am I" argument.
Stanton · 21 September 2008
So now can we finally get back to talking about immune memory and amnesia in starfish?
stevaroni · 21 September 2008
Science Avenger · 21 September 2008
Science Avenger · 21 September 2008
Vince · 22 September 2008
SWT · 22 September 2008
eric · 22 September 2008
Dave Lovell · 22 September 2008
Vince · 22 September 2008
SWT · 22 September 2008
jobby · 22 September 2008
well to properly answer that I would have to know what you mean ‘as described by MET’ I feel some goal posts shifting here.
... well I guess you guys love when those goal posts are movable cuz you wont even answer the above.
typical Dimwitists
jobby · 22 September 2008
SWT · 22 September 2008
stevaroni · 22 September 2008
eric · 22 September 2008
Robin · 22 September 2008
I find it remarkable that Bobby (et aliases) has developed a valid ID hypothesis and test when none of the major ID proponents, particularly those with actual backgrounds in science, have been able to do so. It is a wonder that Bobby's concept and contributions have not made international news...
jobby · 22 September 2008
Since you’ve already worked out an answer, it shouldn’t be too hard to reconstruct it. This time, why not save your work? I suspect this won’t be the last time you’ll be asked to respond to these questions.
... if my comments are so much in demand maybe they should not be erased.
jobby · 22 September 2008
For that we need to know how to distinguish manipulation from natural DNA sequences.
... signatures. just as we distinguish a degas from a monet other than by the style
jobby · 22 September 2008
There’s been no indication of any alien manipulation. Why not?
... they havent been looking for it.
Henry J · 22 September 2008
Now somebody needs to define "signature" as it would apply to a strand of DNA.
jobby · 22 September 2008
jobby · 22 September 2008
It is a wonder that Bobby’s concept and contributions have not made international news…
... if good science needs good marketing channels
Henry J · 22 September 2008
Eh? I thought the question at hand was how to identify an unknown signature. I don't see how identifying a already known sequence applies to that.
Besides that, DNA sequences don't have durability over time. They might not be bothered by floods, fashions, or terrorism, but they do accumulate changes over large numbers of generations.
SWT · 22 September 2008
jobby · 22 September 2008
Besides that, DNA sequences don’t have durability over time
........Masaru Tomita of Keio thinks they do. You should take it up with him
jobby · 22 September 2008
thought the question at hand was how to identify an unknown signature. I don’t see how identifying a already known sequence applies to that.
... by studying how know signtures are put into DNA we can develop ways to find the unknown ones. takes money tho
jobby · 22 September 2008
Futuyma’s description of the Modern Synthesis will do as a brief description of what I mean by MET (modern evolutionary theory).
... put it in your own words (if you can)
jobby · 22 September 2008
but they do accumulate changes over large numbers of generations.
.... not in the junk dna
eric · 22 September 2008
Henry J · 22 September 2008
SWT · 22 September 2008
eric · 22 September 2008
Henry J · 22 September 2008
Robin · 22 September 2008
In relation to the topic (ID movement immune to evidence) I found an interesting neurological explanation on why people tend to have a tough time letting go of beliefs even in the face of conflicting evidence. According to Dr. Robert Burton, when we get that feeling of 'knowing something', in reality very little, if any of our cognative processing center within our brain becomes active. Instead, having that feeling of knowing something is generated in our emotional centers. Burton's explanation is that just like having a 'feeling' to motivate us to eat or drink (or have sex or anything else) we have a 'feeling' associated with understanding to motivate us to rely on that understanding. Unfortunately, it is easily fooled and can become so motivating that one will refuse to alter it even in the face of evidence. Here's an interesting summary:
http://www.rburton.com/work1.htm
http://www.salon.com/env/mind_reader/2008/09/22/voter_choice/index.html
stevaroni · 22 September 2008
jobby · 22 September 2008
jobby · 22 September 2008
there’s no way to identify it.
... wrong
jobby · 22 September 2008
jobby · 22 September 2008
jobby · 22 September 2008
you shouldn’t need me to paraphrase Futuyma for you.
.... well I am afraid you might be misunderstanding him. Actually I do not think you are capable of paraphrasing his concepts. I think you could cut and paste but it does take understanding to paraphrase.
Too bad game over and you lose.
jobby · 22 September 2008
ATATTTGATTTCACGTGTCTAGCAGCTAACTTGTTAACATATAAAAGAGGGACCTGGATCGCAAGGTTTA
GTTCTTTATCTATGCCAAATGTTTATTAGTGAAATCGTCCTGAAGATATGATTCTACATATGGCGCTTTT
ATTTCACAGAATATTTAAGAAAAAGGACAACACATAGAATTGGACACAGAATTCAAAGACCACGGTACAA
CCTTCTTCTCCTTTTTTTTTTTACTTCAGCAAACAAAAAAAGTCAAATGACATGAAAAGTGGCGAGTCTT
CCGACAATAAATAATAAATTACTTTATAATTTTTGCAATGCAAGAGCGAACAAAAATGTTTCCTTTTTTT
CTCTTTATTTCCAGAGAGAGAAAACAGTCGTTTTAACCAATAACTATACACATCTTTGGGGGAAAAGTTC
TTGGACGGACACGAGTCAAACACAATCCCGAGACGCTTGTGGCAAAATAGAGGTAACCTTGTTGCAATGC
TTTCTAAAGTTGGTTTTTAAATCGGAATTCAAAAACCTTTAAAGTCGCTTCAGACTTCTTGATAGAGGAT
GGATCTCAAAAACAGAACAAAAGAGAAAGAGAGAGAGAGAGAGAAATAGAAACCAGCTATGGGGCATGCT
AAGAGACCTGGTTTTTTAGGCAAGCCCGTGGAAGAGTTCACTTTAAGCATTTCAGACCCACGCTGACCCG
CAATCCTTGCAACGTCGCTTTCCATGTCGACAGCAGCTTTGTCTCTTTCCCGGATCTTGGAGGAGCTCCG
GTTTGGCAAGGCAACGACCAATATAGAAACAGCACCATTCGGGAATCGATGAACTAGGAAAAATCTCTTT
CCCTCGGTTCCTCTCTAGATGTGCAGTGAAATGAAAATGCTCTTTTTTGAGATCCGCGAATATAAATCCT
CTACGTTTTTAAAAACTTTTTTTTCAGTACTCCTACTTGGATAGCGTTTCTGTTTGTTTGTTTGTTTTTT
AAATTCTAGTAAAATCCCATGATTGTCTTCACAGTGTTGCTACCATATCACTTTGTCATTAAAACAGACT
TCGTGCGTTTCATGGAGCGCTCATGTCTAGATTCAGTTTTCGTTAACTCGGTTGTTAAATACTTTTGCCG
CAGAGTCCGACGGTGTAACTTCCCACTTGCTCCAACGGGGAAAAGCCAAGCGGGAAGGAAAAACAAAACA
AAACAAAAATCCCTCATTCATGCCTCGATCGGACTGGCTACCATGCTGTTGGGGGTGTCTGGGAGCTGAG
AAGACATCGATGCTACTTCACTCCCGGTAGAATTGGAACCGGGGCCTCCTTCCGAAAAATTAACCTGCAG
CGAAGACGGGAGACAGAGAAAGGAAGGGGGTTAGTCCTGAGCCCAGCAGGGAGGAAACACGAGTGGGGCA
ATGTTCAGGCCTGCTGGGTCAGCCCAGGAACCCAACTCCAGGGAGACACGCGTGGCTCTGTACAGACGCC
ACGGAGCAGAAAGCGATCGCGGGCCATTGGATGCCACTGATTTCCCAACACGATGTGGCGTTCTCGAGGG
GTTCCCATGTTTGCTTCCCACAGTTTTTTGGTTTTTCCCAGCCCCTTGGGTCACTGGAATCGCTGGATTC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCCCAGCGCT
TAGAAAAGTGATCCTCCATAACCCCGTGATCCCCAGCACTTTACAAATACCATAATCACCCTTATCTCTC
GCACACACATTGTGGACTTCATCTCCTGTCTCCCTCCAGCTCCCAAAGACCTCCAGGCCTCATTATGCCC
GTATCCGCCCCCCCGCAAACATACACATCCCCAGCCCCCCAACATTGACTGCCAGTCAATCCTCCCGGGG
GAAGCCCGGATCGGGAGGGAGACAATGAGGGCCTTTCCCTGGGATAGGGGGAGGAGGGACGCTGGTTAGA
CACCCCCGGGGTTTCTTGGGGACACCATTGTTATTCAGGACTCTCTTCTTTAAACACACACGCACACACA
TTAATTTCAGGTGTAAAATTCAGTGACTAGGTGACTCCGAGTCCCTACGGTCAGGTGGGGTGGAGGAAAT
GTGCCCTCGGTAATTTGCAGCTGTAGCGCAGAAGCATCTAAAAGACCTTATCTTCCTGCTCACATCCACG
GATGGGGCCCATCACCACCACCAATTCAACAACAACAATAACAATAATAATATGTTTACTGAACACTCAC
GGGGTCCAATGCTTAGTGCTTAGCACATAATGCC
... you dont see the signature?? 'created by God 7000 BC in hexadecimal the upper right corner?
jobby · 22 September 2008
Pak Chung Wong, a researcher at Pacific Northwest National Laboratory, points out that some strains of bacteria have kept their DNA pretty much intact for millions of years.
Is Pak an 'IDiot'??
jobby · 22 September 2008
The human genome consists of the equivalent of approximately 750 megabytes of data .
this is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
Stanton · 22 September 2008
Stanton · 22 September 2008
SWT · 22 September 2008
David Stanton · 22 September 2008
So, let me get this straight. Darwin was wrong because the human genome couldn't possibly contain enough information to make a human being. Is that a fair summary of your argument? Have I got it right? Is that what you really want to claim?
Nice work dipstick. And of course still not one word about immunology. What a retard.
Here is a message from God written into your DNA:
"Thou shalt not lie."
Looks like you are having problems with the phenotypic expression of this sequence.
stevaroni · 22 September 2008
PvM · 22 September 2008
Wayne Francis · 22 September 2008
Vince · 23 September 2008
jobby · 23 September 2008
That took me a whopping 6 minutes to get to and I’ve never visited that site before so had to do some reading along the way.
Of course finding the info you indicated is fairly easy. But my point was finding the a signature is difficult.
Try using your pea brain for a second. If we wanted to place a signature in the DNA so that intelligent beings not from our culture could read it say 1 million years from now, how would we do it. Certainly not English. What then??
jobby · 23 September 2008
Your’re dithering: Simple solution: just repost your answer for all to see.
... Can you please quit spamming. It just makes things harder to read here. You are truly a troll. Look I am not going to paste answers and get them erased over and over and over. YOU copy my answers next time if they are of that great importance to you.
And please quit spamming.
jobby · 23 September 2008
obby is wrong, the information in the genome is more than sufficient to account for all of this.
Ignorance is no excuse
...YOUR ignorance is showing yet again:
Please point me to the study that validates your assertion.
jobby · 23 September 2008
Genomes are not written in binary or hexidecimal.
Well your trollness, I never said they were. Is this really that difficult for you??
jobby · 23 September 2008
The only person who can tell if Dr Pak Chung Wong is an Intelligent Design proponent or not is Dr Pak Chung Wong, himself,
... I imagine he is too smart to admit that he feels sympathetic to ID. He seems to know the politics.
SWT · 23 September 2008
jobby · 23 September 2008
Do you believe that evolution can occur as described by MET?
... YOU have to define precisely what you mean. MET can have a lot of different meanings. See this is why I think you are faking here. If you were earnest you would simply tell me what you mean. But I believe you are a troll.
SWT · 23 September 2008
Eric · 23 September 2008
Bryan · 23 September 2008
jobby · 23 September 2008
Its especially difficult if you follow the standard ID practice of never deciding what it is you want to look for, and then never actually looking for it.
... give me the funds and I will look for it
jobby · 23 September 2008
Actually, natural selection would ha e only played a partial role - the rest of evolution (drift, mutation, etc) would also have been involved.
... complex structures can be accomplished thru G drift? think before you write
jobby · 23 September 2008
Your claim is equivalent to saying that a miracle is needed for any human baby to develop into an adult.
... do you have trouble reading? when did I say that?
jobby · 23 September 2008
Robin · 23 September 2008
Time to flush Bobby again for regressing back into his trollish behavior. There is only one definition for MET that I can find doing both Yahoo and Google searches (nevermind actually knowing the definition as provided by Futuyma). If Bobby is going to act in such a manner, he should be removed.
fnxtr · 23 September 2008
What... oh forget it.
Why does anyone care what this bonehead believes anyway?
Have it your way. Space aliens did it. You win. Goodbye.
jobby · 23 September 2008
There is only one definition for MET that I can find doing both Yahoo and Google searches
... paraphrase it. Are you able to?
jobby · 23 September 2008
"Over the past decade or two, scientists have begun to suspect that there are other properties of complex systems (such as living organisms) that may help, together with natural selection, explain how things such as eyes, bacterial flagella, wings and turtle shells evolve," Pigliucci told LiveScience.
SWT · 23 September 2008
David Stanton · 23 September 2008
Of course Booby should be removed. He already was. When cornered, he reverts to juvenile word games. He now seems to realize what everyone else has known for over twenty years, that more than natural selection is involved in the evolutoon of complex structures. Big surprise.
This troll is absolutely worthless. He lies, he calls everyone else a troll, he refuses to read the literature and he absolutlely refuses to stay on topic. Ban him for good. Better yet, stop responding to his nonsense.
Eric · 23 September 2008
stevaroni · 23 September 2008
stevaroni · 23 September 2008
jobby · 23 September 2008
But this is simply not enough information to make a human. Even though it does.
... How do you know it has enough info?? Faith?
jobby · 23 September 2008
eric · 23 September 2008
PvM · 23 September 2008
jobby · 23 September 2008
Plain observation which shows how a fetus develops. Simple really
... no one is denying that fetus develops. The question was whether the DNA has enough info storage capacity to soley guide this process.
Is this really that hard to understand??
jobby · 23 September 2008
So, to repeat the question, do you believe evolution can occur as described below:
... you were unable to explain this concept in your own words and you had to cut and paste? pity
anyhow the answer is yes
Vince · 23 September 2008
OK - Let's stop feeding the Troll. Now, is anyone else up to discussing Comparative Immunology?
David Stanton · 23 September 2008
OK. Now we are finally getting some where. Evolution occurs by exactly the mehanisms proposed, but Darwin was still wrong because the little blue devil in you back pocket needs to miraculously poof every baby human into existence. Great hypothesis. Of course you have some evidence for this.
This jerk is just too stupid to know when people are laughing at it.
David Stanton · 23 September 2008
Sorry Vince. You're exactly right.
I really liked your post on comparative immunology. I had not heard of the idea that inverts could get away without an immune system because they did not live very long. Maybe there is some evidence of more elaborate systems in inverts that are long lived, such as lobsters.
eric · 23 September 2008
jobby · 23 September 2008
jobby · 23 September 2008
Devolopment isn’t part of Darwinism.
... then how did the instructions to take an animal fetus to full grown come from??
jobby · 23 September 2008
stevaroni · 23 September 2008
jobby · 23 September 2008
“A fertilized zygote, which only carries one copy of the genome, and can get no more information cannot possibly grow into an adult because there is not enough information available.”
... nutbag.. I never said that. You really have trouble reading dont you?
stevaroni · 23 September 2008
For any Lurkers out there, this is the problem with ID. They have nothing, and most of their argument is based on "just say no".
It's straight out of Trial Lawyer 101; if you have no case, just argue.
The problem is, that eventually, when the only thing you've got is reflexive denial, you eventually have to deny the obvious and you get into these idiotic corners like "Human DNA doesn't contain enough information to make a human".
And then you have to try to explain where babies come from.
It's right up there with trying to bluff your way past claiming the earth is flat.
stevaroni · 23 September 2008
jobby · 23 September 2008
“A fertilized zygote, which only carries one copy of the genome, and can get no more information cannot possibly grow into an adult because there is not enough information available.”
=== equals =====
The human genome consists of the equivalent of approximately 750 megabytes of data .
This is probably the strongest evidence against Darwinism. No where enough storage space to account for body structures and development info.
???????????
Are you nuts??
jobby · 23 September 2008
Is there are a serious inability to read here?? This is bizarre
jobby · 23 September 2008
“Human DNA doesn’t contain enough information to make a human”.
And then you have to try to explain where babies come from.
DDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHHH!!!!!!!!!!1
There could be other information sources.
Robin · 23 September 2008
jobby · 23 September 2008
Clearly there is plenty of storage space within the human genome (and all other genomes) to account for body structures and development info.
... that is an assumption not based on evidence, testing, experimentation or even calculations.
Pure gimme that ole time Darwinism Faith.
Now I have seen 'Blind Faith' in action.
jobby · 23 September 2008
Henry J · 23 September 2008
If there is another "DNA type thing" in cells, scientists will deal with it when and if somebody discovers evidence of it. In the meantime it makes more sense to assume that another major type of molecule would have been noticed already if it were there.
eric · 23 September 2008
stevaroni · 23 September 2008
David Stanton · 23 September 2008
OK hand jobby. Now, all you have to do is demonstrate that this DNA-like thingy actually exists and then you might have something. Until then, absolutely on one is obliged to believe in it, not even you. You know, kind of like that unnamed designer that everyone keeps talking about.
So, believing in the power of DNA to direct development is blind faith and belief in your little blue demon is real science. Got it. Well, until you can come up with some evidence, stick you head between your legs and kiss you butt good bye. Oh, and when are you going to stop visiting porn sites?
By the way, got any thought on the immune system yet? Are mysterious DNA thingys involved in the immune system as well? Inquiring minds want to know.
jobby · 23 September 2008
Where did the information come from if not the DNA?
The world of physics is much stranger than what our intuitive knowledge can comprehend. We have gone from atoms to electrons to quarks to strangeness to kaons etc. At each stage they were surprised that smaller and smaller particles. The DNA was a big shock. One gig is cannot store enough info to account for the mappings or all the body structures AND the the physiology. A computers OS cannot run on one gig how can an animals body. And that does not include the developmental instructions. I know you want to believe in your world view. But your faith is making you blind.
jobby · 23 September 2008
and belief in your little blue demon is real science.
... when did I ever bring up a blue demon?
So, believing in the power of DNA to direct development is blind faith
... it is faith to believe it can miraculously do things which it does not have the capacity to do.
David Stanton · 23 September 2008
Just in case anyone thinks that the delusional hand jobby has even the faintest idea of what he is talking about, there are about 3 billion bases in the haploid human genome. For every base position there are 4 possible nucleotides (not including methylation, base modifications, acetylation patterns of histones, mitochondrial DNA, maternal effects, etc.) Now, how in the world could anyone get the figure 750 megabytes out of that? Care to show us your calculations retard, or did you just copy that from some creationist web site?
Keep diggin booby boy, that hole is getting deeper and deeper.
David Stanton · 23 September 2008
Well booby, you have once again failed to provide any alternatives, so we will just have to skip directly to filling in the gaps for you if you refuse to do so. It is a real time saver. Can you prove the blue demon does not exist?
Here, I'll make it real simple for you. All you have to do is come up with one protein that is used in the development of the human body that is not coded for in the human genome. That's it. Should be a piece of cake right? If you can't do that, then just shut up and go away, forever.
Is it just me, or is this nut job starting to sound a lot like realpc. Now that guy had problems.
Henry J · 23 September 2008
3,000,000,000 bases, 4 possible states each
= 6,000,000,000 bits
= 750,000,000 bytes
Though as I understand it, only a small fraction of that is coding genes.
But also as I understand it, the DNA does not have to encode the location and type of every cell, which would presumably take more than 750 meg. Instead, it gives guidelines to each type of cell on when and how much to grow. Take capillaries for example - they don't have to be at predetermined locations, they just have to be appropriate distances apart in order to deliver supplies to their client cells. So all the DNA has to specify is the spacing between them, not an exact road map.
Henry
D. P. Robin · 23 September 2008
Cleanup on aisle three!!!
Henry J · 23 September 2008
Aisle three? How does one determine the aisle number? ;)
D. P. Robin · 23 September 2008
Science Avenger · 23 September 2008
Handjobby is doing a great impersonation of the witch doctor who insists that it takes arsenic AND the magic spell to kill someone. Believing it is just the arsenic is blind faith, you see. Even if you kill someone with the arsenic supposedly without any spells, you can't prove that no one, anywhere, was casting a spell at that moment. After all, spells are complicated, and all that.
And at the risk of tossing gasoline on a blazing inferno, note that Handjobby bravely ran away from our discussion (if I may elevate it with that description) of computer simulations once I had addressed all his faulty arguments and defied him to show me the frontloading he so desperately needs to exist in my hypothetical program. I'm sure when poor Handjobby started parroting all those ignorant creationist canards about computer models he never expected to crash into someone who actually builds and uses such models who could call him on his bullshit. And yet, never the slightest acknowledgement of any of the corrections of his ignorance. It's another indication of just how intellectually dishonest he is, assuming he's not one of us just jacking around pretending to be an idiot.
Henry J · 23 September 2008
Well, then it's a good thing this blog has a spell checker...
stevaroni · 23 September 2008
D. P. Robin · 23 September 2008
jobby · 23 September 2008
Todd Moore:
How does the genetic code of the human species measure up against Microsoft Windows XP? Comparing the size of human genome to the latest operating system from Redmond may sound like a stretch, but the results might surprise you.
A DNA molecule consists of two strands that wrap around each other to resemble a twisted ladder whose sides, made of sugar and phosphate molecules are connected by rungs of nitrogen-containing chemicals called bases. There are 4 different bases that are present in DNA, which are Adenine, Thymine, Cytosine, and Guanine. These bases are always paired in such a way that Adenine connects to Thymine, and Cytosine connects to Guanine. These pairings produce 4 different base pair possibilities—A to T, T to A, G to C, and C to G.
The human genome, which is the entire sequence of DNA for the human body, consists of around 3 billion of these base pairs. This sequence is grouped into 23 distinct parts known as chromosome pairs. Our human genome is the latest in a long line of evolution, which is considered by many to be the architectural blueprint for human life.
The Windows XP operating system is the latest in a long line of operating systems from Microsoft Corporation. An operating system is the life force of a personal computer’s collection of hardware. It enables the running of applications, management of information, provides for data sharing and communication, and much more. The Windows XP operating system is grouped into over 5,000 distinct parts known as system components, libraries, and applications.
Computers store data in a binary format (0’s and 1’s) which can be thought of as rows of light switches either turned off or on. These 0 and 1 bits are usually grouped together to form larger numbers or structures--the smallest being a “byte” which consists of 8 bits. The computer industry denotes storage requirements in terms of bytes. Windows XP installed and configured requires around 1,500,000,000 bytes that can be stated as 1.5 gigabytes or 1,500 megabytes.
In order to represent a DNA sequence on a computer we would need to be able to represent all 4 base pair possibilities in binary form. This can be done using a minimum of 2 bits, which yields 4 different bit combinations (00, 01, 10, and 11). Each 2 bit combination would represent one DNA sequence. A single byte (or 8 bits) can represent 4 DNA sequences. In order to store the entire human genome on a computer without compression would require around 3,000,000,000 / 4 = 750,000,000 bytes of storage or 750 megabytes.
The human genome requires 750 megabytes of storage compared to 1,500 megabytes of storage for Windows XP. Microsoft’s latest operating system requires twice the storage space than the genetic blueprint of the human species. This does not imply that Windows XP is more advanced or complex than the human genome, in fact, there is little correlation between the complexity of an organism and the length of its DNA sequence. A simple creature known as amoeba dubia has a genome that is over 200 times larger than the human genome.
In conclusion, the Microsoft Windows XP operating system contains more code for operation of a personal computer than the human genome contains for the creation of life.
Jeez say he is off by a factor of 1000 say it stores 750 gigs. still not enough.
jobby · 23 September 2008
Wiki:
The human genome is the genome of Homo sapiens, which is stored on 23 chromosome pairs. Twenty-two of these are autosomal chromosome pairs, while the remaining pair is sex-determining. The haploid human genome occupies a total of just over 3 billion DNA base pairs and has a data size of approximately 750 Megabytes,[1] which is slightly larger than the capacity of a standard Compact Disc. The Human Genome Project produced a reference sequence of the euchromatic human genome, which is used worldwide in biomedical sciences.
If you feel this is incorrect you can go to wiki and correct it yourself.
jobby · 23 September 2008
Eberhard Passarge, M.D. is Professor of Human Genetics, Institute of Human Genetics, University of Essen, Essen, Germany:
He estimates 900 mb. I guess all these people are wrong and are IDiots.
jobby · 23 September 2008
Dr. Hugh Deasy trained as a physicist and astronomer and is currently working as flight dynamics consultant at the European Space Operations Centre, Darmstadt, Germany.
Jeez another IDiot! They are everywhere!
"Human beings are far more complicated than bacteria, with about 10 to 20 times the number of genes. The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA - some 11.25 megabytes of ASCII." Recent attempts to add some non repetitive sequences such as non coding RNA to the tally of information carrying DNA did not increase the total information content by more than a megabyte or so. Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity. Thus fields such as Sociobiology or evolutionary psychology, which assume that behaviour is to a large extent determined by the genes face a major challenge in the light of these findings. Take for example a new born gazelle - it is able to walk and then run within minutes of being born, a skill needed to flee prowling lions. Yet such skill requires sophisticated software, certainly many megabytes in size, to run on the latest robots from Honda or Soni. So the gazelle must have the equivalent of this sophisticated software, but if its genome is only tens of megabytes, then can it all come from the genes while allowing enough data to form the muscles and other bodily components? Can its neural network learn quickly enough to flee a charging lion? The latter is negated for example by the observations of a horse owner friend: "I can't remember how long it takes a foal to run after it's been born, but I think it stands up immediately after birth while the mother cleans it. It doesn't copy other running animals - in the case of the foal sired by our stallion, it was not just trotting an hour after being born, it was racing around the field with its body at an angle of about 45 degrees as it went round corners. In other words this is all wired in, like young cats' ability to see." The latter again begs the question of where all this hard wired behavior comes from in the presence of so few genes. Are we forced to reconsider mechanisms such as Jung’s collective unconscious?
jobby · 23 September 2008
“Length-based Encoding of Binary Data in DNA,” published by the American Chemical Society:
he human genome is comprised of 22,000 genes and takes the equivalent of 750 megabytes of data. This data, researchers say, takes up only about 3% of the storage capacity of the DNA material. The remaining 97% of DNA material provides “plenty of room to encode information in a genome,” researchers say, and allows that information to be preserved and replicated in perpetuity.
Jeez! More IDiots!
stevaroni · 23 September 2008
stevaroni · 23 September 2008
eric · 23 September 2008
Yeah, you see those five posts about genome size you PT b*stards? How can you NOT see that they prove the nonmechanism nonproposed by Jobby is true!
To add insult to injury, you must also certainly admit that his nonexplanation has no gaps. No details means no gaps. Meanwhile, you don't know how every single development step is accomplished. Thats TONS of gaps! And everyone knows an explanation with no gaps is better than one with gaps!
So clearly the nonexplanation is superior. Throw in the towel, his logic is impeccable!
David Stanton · 23 September 2008
Still no answer hand jobby? I thought not. Piss off you ignorant twit.
tresmal · 23 September 2008
So jobby, how much information does it take?
1)The answer should be in the form of a numerical value.
2)And show your work or provide a source.
David Stanton · 23 September 2008
This just in: bumble bees aerodynamically incapable of flight. Film at 11:00.
No, wait, what would it look like if they really can't fly? Pretty boring film I guess.
Wayne Francis · 24 September 2008
Wayne Francis · 24 September 2008
jobby · 24 September 2008
But jobby is basically saying that without the finger of “God” a Zigote will never form into a fetus.
... I never said that. It seems that your simplistic mind says it has to be Darwinism or God. No other alternative. I do not subscribe to that primitive thinking. It could very well be a yet undiscovered natural cause. Your allegiance to Darwinism has stifled your thinking processes.
jobby · 24 September 2008
The genetic “blue print” is so robust that the builders (Cells) can cope with unexpected changes like while building the spinal cord and finding there is not far away it can merge the 2.
... and all of this is done in 750 megs of instructions!
Truly miraculous!
Dave Lovell · 24 September 2008
Jobby
So you are convinced that the human genome contains about 750Mb, and this is not enough to encode the instructions to build a human being. From your reaction to comments about "divine intervention" and "poofing", I will for now do you the courtesy of assuming the you are happy that a fertilised egg contain all the information needed to build a human, but that more information must be encoded in this egg by other means, using a non-supernatural mechanism not yet understood. Is this a fair summary of your position?
You don’t suggest how much information you think is needed, but from your comparison with a computer operating system, it seems clear that you think considerably more than 750Mb of good (i.e. junk free), information is required. To keep the arithmetic simple, I’ll assume you think we need 10 times as much information, and generously assume this new encoding system contains only 90% junk not 97/98% as you propose for the DNA. We need 50 times as much information to be stored by your proposed mechanism. If this information were somehow encoded on the DNA, it would need to store 50 bits per ATCG code letter, greater than one bit per atom. As we can be sure there are no other chemistry based structures in the nucleus within many orders of magnitude of the size of the chromosomes, you are looking to store between one and hundreds of thousands of bits per atom (no magic, remember). This is well outside the realms of biochemistry. The teams at the Large Hadron Collider are probably twiddling their thumbs at the moment pending the repair of their equipment. Perhaps you should take this part of your theory to them.
However much information is required, your comparisons with Windows are seriously flawed. A better analogy would be the source code used to generate. If stripped of its verbosity and any comments included to make the code programmer readable, it will be several orders of magnitude smaller than the installed code size you postulate. The “product” can be far harder to describe than the instructions to generate it For example, using very few bytes of code, an assembly level programmer could write a program for a 64-bit x86 processor to make it fill 4Gbytes of memory with the first 500 million non-prime numbers. I would hazard a guess that the information required to describe a functional 1Gb DRAM chip is less that that required to describe the original Intel 4004 microprocessor, because of repetition of structures. Did you see the recent article here on snake segmentation? ( http://pandasthumb.org/archives/2008/07/snake-segmentat.html ). Complex anatomies can simply be built by a looping a parameterised call to a genetic subroutine until the prescribed number of body segments has been built. Fingerprints would be very complex to describe unambiguously over the lifetime of an individual, probably taking even more than your 750 MB for that alone. But they are not specified very precisely by genes, because if you examine your hands you will see that the prints are not completely symmetrical. Identical twins do not have perfectly matched fingerprints either.
jobby · 24 September 2008
So you are convinced that the human genome contains about 750Mb,
... this is not my opinion this the estmate by mainstream scientists
jobby · 24 September 2008
Complex anatomies can simply be built by a looping a parameterised call to a genetic subroutine until the prescribed number of body segments has been built.
... big assumption. prove it! That's science.
jobby · 24 September 2008
The overall point is there should be an estimate of how many bytes of info are needed to for instance have the necessary instructions to construct and operate a human. Including the pre-programmed behavioral instructions.
There has been no quantization of this and that is not science.
To say that there is enough space in the DNA cuz 'My Darwin tells me so' is not good enough.
I know the Darwinist devotees have immeasurable faith but sorry that is NOT science.
jobby · 24 September 2008
Is this the point:
The posters here believe the DNA has enough space to have the necessary instructions to construct and operate a human. Including the pre-programmed behavioral instructions.
Is this what the posters here believe??
Dave Lovell · 24 September 2008
eric · 24 September 2008
Robin · 24 September 2008
Science Avenger · 24 September 2008
eric · 24 September 2008
David Stanton · 24 September 2008
Still no answer to my question handjobby? Well now everyone can see that you are just blowing smoke out of your butt. Game over, you lose, go away ignorant twit.
Anyone who ever responds to this fool ever again gets exactly what they deserve.
stevaroni · 24 September 2008
Surprisingly, creating these sorts of messages is a fairly well researched area. It figures prominently in the work of those interested in searching for extraterrestrial intelligence, sort of the ultimate arena for "universal communication".
One of the seminal works in the field was Carl Sagan's "Communication with Extraterrestrial Intelligence" (MIT Press, 1973, 428 pgs). It was his work in this area that led him to write "Contact".
Eric brings up an interesting point though. DNA is a bad medium for messaged because it's particularly prone to weird mutations that can shift things around. If I send out a radio signal, bits may get dropped, but at least I can know that the rest of the bits will get to their destination in the right order, and missing information will be obvious.
Not so with DNA, where the genome will be chopped up and rearranged dramatically over the eons.
Also, since all instructions in DNA will be executed as actual code, even those simply meant to be a copyright symbol, I also have to make sure that my encoding system doesn't do something stupid when the instructions are executed, like create a virulent toxin.
Henry J · 24 September 2008
Robin · 24 September 2008
jobby · 24 September 2008
here is NO indication of how much space the information required to build a human MUST take up.
... sure there is! THINK!
stevaroni · 24 September 2008
Robin · 24 September 2008
eric · 24 September 2008
jobby · 24 September 2008
As it stands, it is just and argument from incredulity.
.... So you feel that the DNA has enough space to have the necessary instructions to construct and operate a human. Including the pre-programmed behavioral instructions. ???
jobby · 24 September 2008
Which means Behe’s assumption would falsify the hypothesis of a communicative designer.
... and if the concept is falsifiable it is a 'scientific' theory.
thank you for admitting that ID is science.
jobby · 24 September 2008
But there’s no reason to assume that biological developmental “information” is even remotely analogous,
... and there is no reason to assume it is not.
eric · 24 September 2008
stevaroni · 24 September 2008
Robin · 24 September 2008
Robin · 24 September 2008
Robin · 24 September 2008
Henry J · 24 September 2008
Well, the sequence info for proteins does seem to take a certain amount of space on the DNA string. Then there's regulatory sequences that turn genes on and off. It does sort of make sense to note how many bits of computer memory it takes to store a digital representation of those things.
fnxtr · 24 September 2008
I suppose if a person programmed a CNC machine or something similar with instructions to "make more CNC machines", and you subjected this machine to environmental stresses (UV, maybe) that altered the program so that the next generation was built slightly differently than the original, this DNA/software analogy might come a little closer to actually being useful... ROMs, CD's, and hard drives, as far as I know, do not reproduce. Seems to me that in natural systems there a big blurry interface between
'software' and 'hardware' equivalents.
jobby · 24 September 2008
It would only demonstrate that the “designer” proposed by ID could not be the Christian “God” of the bible.
.... ID theory does not say it is 'God'. So your point is moot.
Robin · 24 September 2008
stevaroni · 24 September 2008
Robin · 24 September 2008
David Stanton · 24 September 2008
While hand jobby is buzy trying to find an example of a protein not encoded by the human genome as I requested, I should add a few more caveats to the list I already presented, just in case anyone thinks that hand jobby knows anything about anything.
(1) The genome is not a blueprint for building the human body, it is a set of instructions. As others have noted, this renders any supposed calculations about minimum genome size irrelevant.
(2) There are actually two strands to every molecule of DNA, so the total amount of information is actually twice what hand jobby imagines. And yes, both strands can code for proteins and yes genes can be overlapping.
(3) Humans are diploid, so there is potentially twice as much genetic information as that found in a haploid chromosome set in every human cell. And don't forget mitochondrial DNA as well, that can be present in thousands of copies per cell.
(4) Single genes can be responsible for encoding many different proteins. Until you can account for this ability you are just blowing smoke in the wind.
(5) Humans don't develop from DNA alone, they develop from a fertilized cell. There is lots of information in the maternal cytoplasm, so any calculation must account for this.
Of course, even in the absence of all of this, hand jobby still has not provided any possible alternative, let alone any evidence, Until then, who cares?
Henry J · 24 September 2008
stevaroni · 24 September 2008
Science Avenger · 24 September 2008
Wayne Francis · 24 September 2008
David Stanton · 24 September 2008
Well, still no answer from hand jobby, big surprise. Here is something that is sure to exclude him from the conversation permanently, a scientific reference. If anyone is interested in overlapping genes here is an example from cetaceans:
Nuc. Acid Res. 30(13):2906-2910 (2000)
Of course it supports the close relationship of cetaceans to artiodactyls, another favorite subject that hand jobby loves to butcher. It really must be hard trying to argue with scientists when you really don't have a clue what you are talking about.
Wayne Francis · 24 September 2008
Wayne Francis · 24 September 2008
Wayne Francis · 24 September 2008
Henry J · 24 September 2008
Henry J · 24 September 2008
David Stanton · 24 September 2008
Henry,
Actually that was my point 3 which is distinct from point 2. So I guess, in a sense, there is potentially at least four times as much information in each human cell as hand jobby claims. What a shock.
Henry J · 24 September 2008
Another thought here - wouldn't that 3,000,000,000 total have been computed so as to already include all the strands?
Henry
Wayne Francis · 25 September 2008
Dave Lovell · 25 September 2008
Dave Lovell · 25 September 2008
jobby · 25 September 2008
1. No, science requires more than just Popper’s falsifiability criteria.
... OK then what do you feel it requires??
jobby · 25 September 2008
So, um, Jobby, then your saying that biological development information is the same sort of thing as a big long string of computer code,
... I am not saying this. It is mainstream science. Of you might not accept science.
jobby · 25 September 2008
Seems to me that the amount of information to make a human might only require 1 byte of space TOTAL and thus our genome may well have 749.99999 MB of space left.
... I just love this one. Wow all the instructions for the human body plan, the physiology and behavior insturctions in one little byte. Truly truly miraculous.
And you think that feeding 50 people with a couple of fish and loaves is a miracle.
jobby · 25 September 2008
Your expert, Dr. Hugh Deasy says “human genes are coded in only about 1.5 % of our DNA - some 11.25 megabytes of ASCII.”
.... why is that wrong??
jobby · 25 September 2008
That we abandon all theories until someone can figure out exactly how much DNA is needed?
... when did I say that? Please stop the hyperbole. However we should not avoid researching that because it seems to conflict with Darwinism.
jobby · 25 September 2008
I am not a biologist, this contradicts something I thought I understood. Are you not confusing chromosomes with DNA stan
... this is typical of the level of understanding of biology and science here. Couldnt pass bio 101.
eric · 25 September 2008
eric · 25 September 2008
Robin · 25 September 2008
Robin · 25 September 2008
jobby · 25 September 2008
he fact is, the information could be 1 byte in size. You don’t know, Jobo, so quit pretending that you know something that real scientists don’t.
... one byte, one letter of the alphabet is enough info for even the design of a fingernail? you are totally ignorant.
jobby · 25 September 2008
*Doing* experiments rather than waiting for someone else to do them for you.
... what experiments have Darwinists done to validate their theory??
... please, please show me them
jobby · 25 September 2008
Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development.
.....feel free to post the names of real who are scientists who are studying the information space requirements for biological development.
eric · 25 September 2008
eric · 25 September 2008
David Stanton · 25 September 2008
So, with all the bluster and name calling, our good friend and constant source of amusement hand jobby has failed to even address one of my points. Well, here is a news flash for you hand jobby, you have to undeerstand all of the available mechanisms before you can say that they are inadequate. So come on troll, expalin RNA editing and alternative splicing for us.
Anyway, all of this is completely irrelevant. Hand jobby claimed that his stupid idea is somehow proof that Sarwin was wrong about something. Well Darwin didn't know anything about DNA let alone information requirements. How in the world does any of this have anything to to with Darwin?
jobby · 25 September 2008
Your statement sounds like so much BS, but feel free to post some actual statements by real scientists showing that those scientists refuse to study the information space requirements for biological development.
.....feel free to post the names of real who are scientists who are studying the information space requirements for biological development.
jobby · 25 September 2008
The Wong and Mi abstract discussed information required for development. You said you read it, right?
... have you read it?
stevaroni · 25 September 2008
jobby · 25 September 2008
Henry J · 25 September 2008
stevaroni · 25 September 2008
eric · 25 September 2008
Robin · 25 September 2008
Robin · 25 September 2008
jobby · 25 September 2008
The Wong and Mi abstract discussed information required for development. You said you read it, right?
… have you read it?
typical. lazy and whats others to do the work!
jobby · 25 September 2008
know of no biologist who claims DNA information space requirements aren’t enough.
... and have there been studies to show that it IS enough??
oh I forgot. studies arent needed just FAITH!
Dave Lovell · 25 September 2008
jobby · 25 September 2008
For example, how much information do you think a very large mass of water would need to completely fill the world’s oceans up to current sea level if it were poured onto a dry earth from space?
... this can be estimate.
stevaroni · 25 September 2008
jobby · 25 September 2008
CJO · 25 September 2008
The creobot is trying to solve the halting problem, experientially. Could be awhile.
Dave Lovell · 25 September 2008
Robin · 25 September 2008
jobby · 25 September 2008
Anyhow, the idea that DNA is sufficient is a concept which has not been proven.
And in science we need PROOF not FAITH
stevaroni · 25 September 2008
stevaroni · 25 September 2008
Robin · 25 September 2008
jobby · 25 September 2008
jobby · 25 September 2008
Your guy, the one you quoted, say’s that you are wrong. He say’s there’s plently of leftover space.
.........Read it you numskull. Thats not what he said.
jobby · 25 September 2008
the fact is from a scientific standpoint no proof that DNA has sufficient storage capacity is needed or for that matter cared about. Science can only disprove an incorrect explanation;
..OK prove that the assertion that DNA does not have sufficient space is incorrect.
jobby · 25 September 2008
Even beyond Jobo’s idiocy in not understanding the quote he posted, the fact is from a scientific standpoint no proof that DNA has sufficient storage capacity is needed or for that matter cared about.
... All coming from a person who thinks that one byte of info can direct the body plan of a human. hahahaha bwahahah hahaha
that is REALLY STUPID!!
stevaroni · 25 September 2008
jobby · 25 September 2008
jobby · 25 September 2008
OK, now, stick with me here, we’re the ones that are working with the assumption that DNA does have enough space, in part, because your expert, Dr Deasey, says so.
Deasey never 'said so' dummy. learn to read.
So we are supposed to accept the fact that DNA has enough space on FAITH??
David Stanton · 25 September 2008
Three days now and poor little hand jobby still can't find an example of even one little protein that isn't coded in the human genome that is necessary for human development. Oh well, who cares? He also failed to address the other twelve points that I made that completely invalidate all his nonsense.
And of course, still not one word about how any of this relates to Darwin (that was the original claim) and not one word about the immune system.
stevaroni · 25 September 2008
jobby · 25 September 2008
Dr. Hugh Deasy: “The human genome is encoded in 3 billion base pairs - or 750 megabytes of ASCII. But human genes are coded in only about 1.5 % of our DNA “
... dummy, did you read the article??
jobby · 25 September 2008
jobby · 25 September 2008
David Stanton · 25 September 2008
Hand jobby wrote:
"So we are supposed to accept the fact that DNA has enough space on FAITH??"
No. If you had read any of my posts you would realize that:
1) The burden of proof is on you to prove that your hypothesis is correct. The assumption that there is enough DNA to account for human development is the default value in this discussion. This assumption is based on evidence and experience, no faith is involved. (By the way, do other organisms have enough information or is it only humans who don't)?
2) You have no idea how much information is needed to make a human being. All you have is lack of imagination and "one suspects". Well many suspect that what the one suspects is suspect. Until you have a calculation with explicit assumptions you as just making stuff up.
3) There is a lot more information storage capacity in a human genome than you have calculated.
4) There are many genetic mechanisms that render your calculation irrelevant. You have not demonstrated that you understand any of these mechanisms, nor have you incorporated them into you "calculations".
In short jobby boy, there is absolutely no reason for anyone to take you seriously. Go figure. Now, do you have an example of a protein yet or not? If not, go away and don't come back.
stevaroni · 25 September 2008
jobby · 25 September 2008
The point is that most scientists believe the DNA contains about 800 megabytes. About as much as the average CD.
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
Remember the average bio 101 textbook is around 800 megabytes.
David Stanton · 25 September 2008
Hand jobby,
How do you know that 800 megabytes is not enough? Are we supposed to take it on FAITH???
Anyway, you first claimed that it was 750. Now you claim 800. Which is it? Why should anyone believe you when you keep changing your mind?
I suspect that a recipe as big as a biology textbook would allow you to make quite a cake.
Got an example of a protein yet? Have you considered any of the other mechanisms involved yet? Got any reasoin to take you seriously yet?
jobby · 25 September 2008
jobby · 25 September 2008
I suspect that a recipe as big as a biology textbook would allow you to make quite a cake.
.. and the intro text book only describes the basics of biology. just imaging how large a book would have to be to explain how to construct a human. terabytes at the minimum
The DNA simply does not have the capacity
jobby · 25 September 2008
well observers what do you think:
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
My answer is a definite no.
Why can't any other poster state an educated guess on this?
Science Avenger · 25 September 2008
David Stanton · 25 September 2008
Can a bumble bee fly? Anyone care to hazard a guess? Hand jobby votes no apparently.
David Stanton · 25 September 2008
HAnd jobby,
Is "all" of your behavior coded in your DNA? If so, then perhaps you have some excuse.
Wayne Francis · 25 September 2008
Wayne Francis · 25 September 2008
Wayne Francis · 25 September 2008
stevaroni · 26 September 2008
The thing is jobby is hung up on is that he's conflating the final product, which can be very complicated, and the process that creates it.
THe complexity of the two are not necessarily related. For instance, check out this picture, and tell me how much information is in it.
http://upload.wikimedia.org/wikipedia/commons/3/37/Mandel_zoom_14_satellite_julia_island.jpg
At first guess, you'd probably say a lot. The image is 2,560 × 1,920 pixels, the full file size is 4.93 MB, it's big even as a jpeg. But even if you said that, you'd still be dramatically underestimating it's complexity, because it's actually infinitely intricate.
Complicated, huh?
Not really. For those who are unfamiliar with it, it's a function called a "Mandlebrot Set", and it can be created with one equation.
That one equation can be expressed in about 30 characters.
Now, that's "data compression".
So, Jobby, Google "fractal" and learn something.
And before you start spouting about the fact that equations need to be executed before you see the results, well, so do genes.
tresmal · 26 September 2008
Jobby is fractally wrong.
jobby · 26 September 2008
1st you don’t seem to realize that that scientist you keep quoting does not have a problem with the less than “15Mb” of DNA to make a human.
... wrong!
Deasey:
Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.
jobby · 26 September 2008
1st you don’t seem to realize that that scientist you keep quoting does not have a problem with the less than “15Mb” of DNA to make a human.
... wrong!
Deasey:
Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.
cobby · 26 September 2008
1st you don’t seem to realize that that scientist you keep quoting does not have a problem with the less than “15Mb” of DNA to make a human.
... wrong!
Deasey:
Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.
cccccc · 26 September 2008
1st you don’t seem to realize that that scientist you keep quoting does not have a problem with the less than “15Mb” of DNA to make a human.
... wrong!
Deasey:
Thus the final total will almost certainly be still below 15 megabytes. This is not a lot of information. Many relatively trivial programs use more data storage. On its own it scarcely seems sufficient to specify the complexity of the body, let alone the brain/mind. In fact, if one were to reconstruct the body using a computer program and data files, one suspects that terabytes might be more appropriate, without ever touching the brain/mind complexity.
jobby · 26 September 2008
At first guess, you’d probably say a lot. The image is 2,560 × 1,920 pixels, the full file size is 4.93 MB, it’s big even as a jpeg. But even if you said that, you’d still be dramatically underestimating it’s complexity, because it’s actually infinitely intricate.
Complicated, huh?
Not really. For those who are unfamiliar with it, it’s a function called a “Mandlebrot Set”, and it can be created with one equation.
... DUH of course! I can write a program 2 lines:
10. print random number
20 go to to
that will print an infinite series of numbers. but you forgot to enter the complexity of the compiler that interprets the code. and the complexity of the hardware that translates your mandlebrot code into a computers screen. very, very complex and could not evolve.
jobby · 26 September 2008
I’m quiet sure that the book would end up orders of magnitude smaller then the orignal.
... there is limit to how far info can be compressed
you never answered:
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
Why cant you just say yes or no?
I said no. I am forthcoming and not a coward to make a claim.
Obviously you are neither
jobby · 26 September 2008
We are finding out more about this every day but the fact is brain/mind has a lot to do with environment.
... wrong again
Deasy:
Take for example a new born gazelle - it is able to walk and then run within minutes of being born, a skill needed to flee prowling lions. Yet such skill requires sophisticated software, certainly many megabytes in size, to run on the latest robots from Honda or Soni. So the gazelle must have the equivalent of this sophisticated software, but if its genome is only tens of megabytes, then can it all come from the genes while allowing enough data to form the muscles and other bodily components? Can its neural network learn quickly enough to flee a charging lion? The latter is negated for example by the observations of a horse owner friend: "I can't remember how long it takes a foal to run after it's been born, but I think it stands up immediately after birth while the mother cleans it. It doesn't copy other running animals - in the case of the foal sired by our stallion, it was not just trotting an hour after being born, it was racing around the field with its body at an angle of about 45 degrees as it went round corners. In other words this is all wired in, like young cats' ability to see."
jobby · 26 September 2008
Deasy:
But since the Human Genome Project completed in 2003, we know that there are only 22,000 genes corresponding to about 10 megabytes of data. But this data is scarcely sufficient to specify the complexity of the 200 different types of cell in the body, it's 12 or more physiological subsystems and all the (rough) structure of the brain. That is true even if the non-coding RNA is considered to have a control function
Science Avenger · 26 September 2008
jobby · 26 September 2008
Dave Lovell · 26 September 2008
Robin · 26 September 2008
jobby · 26 September 2008
BZZZZT!!! Sorry, that’s the same crap as the “you designed the experiment with your intelligence so it really supports intelligent design” nonsense. It’s just another case of goalpost moving.
... do you feel that a computer program can produce output with out a complier for the program and hardware?
jobby · 26 September 2008
you never answered:
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
Why cant you just say yes or no?
I said no. I am forthcoming and not a coward to make a claim.
Obviously you are neither
Robin · 26 September 2008
Robin · 26 September 2008
Robin · 26 September 2008
Robin · 26 September 2008
Robin · 26 September 2008
Robin · 26 September 2008
fnxtr · 26 September 2008
Well, Yobbo, since you make the claim that there must be something else -- though you're very careful never to state clearly what that something else might be, it is nevertheless up to you to find it. All this whining to the effect of "why doesn't somebody do want I want them to" is not going to change anything. DIY.
fnxtr · 26 September 2008
...what I want them to...
for better comprehension. Morning fingers.
jobby · 26 September 2008
The only thing such demonstrates is that you are obviously not scientist or a logical and educated individual but rather just a speculative, linear-thinking individual who really has no clue what he’s talking about.
... Well unlike you I do not think that all the human anatomy could be constructed with ONE BYTE OF INFORMATION!
hahaha! bwahahaha haha!
Science Avenger · 26 September 2008
jobby · 26 September 2008
Well, Yobbo, since you make the claim that there must be something else – though you’re very careful never to state clearly what that something else might be
... no wrong again:
The curiosity for a planet beyond Neptune began with a man named Percival Lowell, who believed that there exists a "Planet X" somewhere in the outer reaches of our solar system, based on calculations done with the study of the motions of Uranus and Neptune.
.... many times discoveries were made simply because they knew something was there but not knowing what. that is science. not putting your head in the sand.
jobby · 26 September 2008
can’t stop yourself from responding to each and every one of your critics’ posts, except of course the ones that nail you to the wall, like my challenge to you to identify the supposed frontloading you claimed was in my dice simulator. Those posts you run from like the plague.
.... altho there is high demand for my responses I have other duties and avocations which insist on my time. so I cannot respond to all of them. sorry.
jobby · 26 September 2008
You are assuming that data in the genome is analogous to data in a computer, but that isn’t scientific or logical.
... wrong again. a byte or bit of data is a universal concept regardless of the media. hash marks on a cell wall being each one bit of data. and each byte in the Mayan math system being 20 bits. these are univeral concepts
Science Avenger · 26 September 2008
jobby · 26 September 2008
ou think you get to substitute “god” into anything you don’t personally understand, which sadly, is quite a bit.
... I never have since I am an agnostic.
Stanton · 26 September 2008
jobby · 26 September 2008
You also have never, as all Darwinism proponents have never, explained exactly what measure of information you are applying to human genetics.
Stanton · 26 September 2008
Science Avenger · 26 September 2008
Science Avenger · 26 September 2008
Science Avenger · 26 September 2008
Science Avenger · 26 September 2008
Robin · 26 September 2008
stevaroni · 26 September 2008
Robin · 26 September 2008
Robin · 26 September 2008
Science Avenger · 26 September 2008
jobby · 26 September 2008
You just insist that there MUST be an analogy between computer storage formats and the human genome, but there’s no actual evidence to suggest such.
... in your opinion do you think that DNA is a code that gives instructions to a cell on how to grow and do physiological functions?
jobby · 26 September 2008
Or to put it more briefly, you don’t get to discount Galileo’s hypocraphal gravity test of dropping weights from the Tower of Pisa by noting that the tower was designed.
... of course not. you really do not understand ID theory
jobby · 26 September 2008
Or to put it more briefly, you don’t get to discount Galileo’s hypocraphal gravity test of dropping weights from the Tower of Pisa by noting that the tower was designed.
... do you feel 500 megs is enough info to construct a human?
Robin · 26 September 2008
Robin · 26 September 2008
stevaroni · 26 September 2008
jobby · 26 September 2008
jobby · 26 September 2008
stevaroni · 26 September 2008
jobby · 26 September 2008
Since you have NO concept of what constitutes a “bit” of genome information or how that information is stored in DNA, your entire premise holds no validity.
Can a word or phrase be written into DNA?
jobby · 26 September 2008
A byte isn’t even univeral… there have been 4-bit bytes, 32-bit bytes, 9-bit bytes
... DUH reading problem! never said that all bytes have a specific # of bits
stevaroni · 26 September 2008
Robin · 26 September 2008
jobby · 26 September 2008
jobby · 26 September 2008
David Stanton · 26 September 2008
No hand jobby, the tap dance is you refusing to answer the reasonable question and instead copying and pasting the entire post without responding to the question. Now that is a tap dance.
Got an example of a protein yet? Got an answer for whether a bumble bee can fly yet?
stevaroni · 26 September 2008
Science Avenger · 26 September 2008
Science Avenger · 26 September 2008
Robin · 26 September 2008
Dave Lovell · 26 September 2008
jobby · 26 September 2008
jobby · 26 September 2008
So this sets an upper limit of about 750MB of raw information in human DNA. Is this enough to build a human? It seems to work millions of times every day, so surely the question for a scientist is to try to explain how, as there is no other source of larger amounts of information without resorting to particle physics (or homeopathy).
.....wrong again: how do you know there is no other source?
jobby · 26 September 2008
That question doesn’t make any sense, Bojo. What is a “word” or a “phrase” from an amino acid standpoint?
... Study Harder:
Using the same code that computer keyboards use, the Japanese group, led by Masaru Tomita of Keio University, wrote four copies of Albert Einstein’s famous formula, E=mc2, along with “1905,” the date that the young Einstein derived it, into the bacterium’s genome, the 400-million-long string of A’s, G’s, T’s and C’s that determine everything the little bug is and everything it’s ever going to be.
jobby · 26 September 2008
If you claim X meg is ---sufficient--- for task A, you must show your work. Where are your formulas? What are your assumptions? What are the justifications for them? You don’t get to play Berlinski and just make up figures like 50,000 morphological changes “on the back of an envelope”.
Mathematical arguments require math. Where is yours?
jobby · 26 September 2008
JPEG image of Indian Flag File Size = 1981 Bytes DNA bases = 7924 In example. 2, a JPEG image if Indian Flag having file size of 1981 Bytes have been encrypted in terms of DNA bases. A total of 7924 DNA bases (4-base/Byte) are required to encrypt the complete image. Since the sequence is large, fragmenting the sequence into smaller segments is required.
REFERENCES 1. Lalit M Bharadwaj*, Amol P Bhondekar, Awdhesh K. Shukla, Vijayender Bhalla and R P Bajpai. DNA-Based High-Density Memory Devices And Biomolecular Electronics At CSIO. Proc. SPIE: vol. 4937, pp 319-325 (2002).
David Stanton · 26 September 2008
So there you go. Hand jobby has proven that it takes less than 8,000 bases to get a picture of a flag. So that should be the same amount that you need to get a picture of a human being. So there you go. 750 - 800 megabytes is plenty of information to make a picture of a human being. (Not counting compression algorithms that could drastically reduce the amount of information needed). What, making a human is not the same as making a picture of a human? Really. Then the argument is inappropriate and hand jobby has proven absolutely nothing.
How do you know that there isn't a little blue demon involved? I challenge you to prove that there isn't. Asking others to show their work when you have not is just hypocritical. Anyway, here is my calculation - one page recipe for a cake, 3000 page recipe for a human. Yea, that sounds about right, one suspects.
Last chance troll of many names. Got an example of a protein or not? Got an explanation for RNA editing and alternative splicing or not? Got an answer to any of my questions or not? You have exactly one hour to come up with an answer or you lose. What, that isn't enough time? You had five days already.
Four hundred posts and not one word about the topic of the thread. Go home to mommy.
jobby · 26 September 2008
So there you go. 750 - 800 megabytes is plenty of information to make a picture of a human being.
........ DUH. were not making pictures here. We are constructing a very, very complicated machine.
fnxtr · 26 September 2008
Henry J · 26 September 2008
jobby · 26 September 2008
fnxtr · 26 September 2008
.. and what do you mean by written, anyway? Like Venter did? That depends on a convention of the abbrevations for certain amino acids generated by the particular DNA strand in question.
Each "letter" in a 21-aa alphabet would take 3 base pairs. But if you just want to write the word CAT over and over, it only takes 1 for each letter.
If there are conventional protein name abbreviations (I don't know), it would take one hell of a lot more. See where I'm going here? Your question is pointless.
Science Avenger · 26 September 2008
fnxtr · 26 September 2008
jobby · 26 September 2008
fnxtr · 26 September 2008
(shrug) Okay, so you meant ASCII. Why didn't you just say so in the first place?
And... so what?
jobby · 26 September 2008
tresmal · 26 September 2008
jobby: Did you hear a whooshing sound when you were responding to stevaroni's comment with the Mandelbrot set? That was the sound of another point going over your head. His point was that a code doesn't have to contain a lot of information to produce complex results. A code can have the ability to generate information. A lot of information. Your objection to the comment: ..."you forgot to enter the complexity of the compiler that interprets the code. and the complexity of the hardware that translates your mandlebrot code into a computers screen. very, very complex and could not evolve" fails on two points. 1) the cell's biochemistry is plenty adequate to perform the analogous functions. 2)your original point was about the size of the code, which is the point addressed by stevaroni. Your original point was about software and when that was addressed you moved the goalposts by claiming "oh yeah, you gotta account for the hardware too!"
As for your question my answer is that 750MB - even the 1.5 percent of that number mentioned here - is plenty big enough for the functions ascribed to it by scientists.
jobby · 26 September 2008
Sorry handjobby, you don’t get to always shift the burdon of proof to someone else. Science can’t prove things, it can only disprove them. YOU made mathematical claims of insufficiency, and you need to back them up with math. If you don’t, there is simply no reason for anyone to take you or them seriously.
... You are saying that the burden of proof is on me to validate my assertion but you do not have the same burden?
My point is that whether the DNA has enough info is unkown. However you are saying you KNOW it does.
Must we accept what you say on FAITH or do you have evidence to back up what you believe in?
jobby · 26 September 2008
That was the sound of another point going over your head. His point was that a code doesn’t have to contain a lot of information to produce complex results. A code can have the ability to generate information. A lot of information.
... you are confusing information with data. I can generate much data with one command PRINT RANDOM NUMBERS. However there will be little information
.... Study much harder.
jobby · 26 September 2008
As for your question my answer is that 750MB - even the 1.5 percent of that number mentioned here - is plenty big enough for the functions ascribed to it by scientists.
.... And I must accept your belief on FAITH? Any tests to back up your belief?
jobby · 26 September 2008
As for your question my answer is that 750MB - even the 1.5 percent of that number mentioned here - is plenty big enough for the functions ascribed to it by scientists.
... yet many comptuer operation systems need gigs of info and you are saying the human body can grow, and be contructed, and execute on 12 MB?
... "Extraordinary claims require extraordinary evidence" was popularized by Carl Sagan (1934 - 1996)
.... show me that extraordinary evidence.
David Stanton · 26 September 2008
Jobby. Jobby, Jobby. Quote mining a post that appears just above yours is not a good strategy. Everyone can see thatyou just missed the point once again.
Now, the clock is running. Only one half hour left. Got any answers for me or not?
Science Avenger · 26 September 2008
Science Avenger · 26 September 2008
jobby · 26 September 2008
Science Avenger · 26 September 2008
jobby · 26 September 2008
No amount of study can make ill-defined terms meaningful. There is simply no content to what you said above. You are just tossing around verbage, a la Palin.
... you feel that 10,000 randomly generated numbers are 'information'?
jobby · 26 September 2008
Since it is witnessed happening all the time, it would seem at a most basic level a very UNextraordinary event.
... witnessing what?
jobby · 26 September 2008
Science Avenger · 26 September 2008
jobby · 26 September 2008
You have been saying over and over again that the information is insufficient you pathetic liar.
... show me where!
.... but that is not important. why cant you answer the following question. I can: my answer is: there is no evidence.
anyhow. You admit that there is no evidence that there is enough space in the DNA to contruct a human?
Science Avenger · 26 September 2008
Science Avenger · 26 September 2008
jobby · 26 September 2008
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
My answer is a definite no.
... Yes I feel that 800 megabytes is not enough. Do I know? No! Of course not. I would have to run an experiment or see a study and I do not believe there are any.
However YOU do believe that there is enough info in the DNA. without see an experiment. That is because you have strong FAITH in Darwinism. I do not. I think the whole issue of origins has little proof. Either way. If you believe in Darwinism or ID or Creationism or whatever it is a matter of faith and not science.
jobby · 26 September 2008
As to my other comment, we witness fertilized eggs becoming people,
... of course we do! But we do not know that the info that constructed them is solely in the DNA. That is your FAITH position.
jobby · 26 September 2008
anyhow. You admit that there is no evidence that there is enough space in the DNA to contruct a human?
[sigh] I’ve “admitted” no such thing Mr. Reading Comprehension. Let’s see if you can actually digest it this time.
... so please explain: are you saying you actually know of the evidence but will not say that you know it?
.... Do you believe there is such evidence? Have you seen the experiment??
David Stanton · 26 September 2008
ENOUGH. Your time is up fool. You have had long enough. You have no answers, just inane drivel.
There is no protein needed for human development that is not coded in human DNA, period. It is not something taken of faith. We have sequenceed the entire human genome. Scientists have been studying development for over two hunderd years. Hand jobby is ignorant of all of this research so he arrogantly assumes that everyone else is as well. Don't play his foolish little words games filled with hypocricy. He knows nothing and he wants you to know nothing.
He has been banned for breaking the rules of civilized discourse here. Make the ban stick. Just say NO to the hand jobby.
jobby · 26 September 2008
fnxtr · 26 September 2008
WTF? Is it a bot? I'm thinking maybe it's a bot.
jobby · 26 September 2008
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
...I can answer: intuitively I think not since the OS of a computer operating system takes gigs. However I never have seen an experiment to prove it either way. So I think to believe that it does or does not is a FAITH issue.
... why cant other posters state their opinions? Why are they so afraid??
fnxtr · 26 September 2008
No-one's afraid, Yobbo, they just don't care what you think.
David Stanton · 26 September 2008
Ban the boob.
PvM · 26 September 2008
It seems that Jobby has missed an important distinction between the information in a book or a hard drive and information in the genome which interacts with chemical and physical processes. So in other words, when during the developmental phase, the body plan is constructed, it achieves this by setting up gradients of chemicals, and switching on and off regulatory genes, which suppress or enable proteins. In other words, simple rules based on complex chemistry and physics. So in other words, the genome interacts with the environment, such as gravity to generate the body plan.
As such, the information requirements are much lower than when one has to specify every single cell individually. Now all that is needed are gradients, and surrounding tissues which by themselves constrain or enable.
That's why developmental theory is so important. A single change in shutting off a particular gene can affect the length of a whole limb, including all the structures within.
Bobby, unfamiliar with much of anything related to evolutionary theory may thus be confused.
No problem, we should help him understand the vacuity of his position. It's not that hard really.
Stanton · 26 September 2008
David Stanton · 26 September 2008
PvM,
I and others have pointed this out in great detail. This fool has ignored every argument. Why is it impossible to ban it? Do we lack the technology or the will? I must say that this does not inspire confidence in the administration of this site if they allow such an abnoxious troll to hijack every thread. Why allow over four hundred off-topic posts, many of which are insanely repetitive? Please ban the boob - permanently.
Science Avenger · 27 September 2008
Mike Elzinga · 27 September 2008
Wayne Francis · 27 September 2008
Wayne Francis · 27 September 2008
sylvilagus · 27 September 2008
jobby · 27 September 2008
obby. Jobby, Jobby. Quote mining a post that appears just above yours is not a good strategy. Everyone can see thatyou just missed the point once again.
... that is not 'quote mining' Shows you do not even understand the term.
Dave Lovell · 27 September 2008
jobby · 27 September 2008
I could then say binary value 01 = all the information to make up the earth, binary value 10 = chocolate cake, binary value 11 = Season 7 episode 1 of Smallville. WOW in 1 byte (binary value 00011011) I have stored the information about 4 of my favorite things!!! The aliens only have to understand how I encoded that data!
... well that is contrary to mainstream info theory. basically your decoder is more complex than your code. well you can go on tap dancing on this but it really doesnt matter.
jobby · 27 September 2008
jobby · 27 September 2008
What is the point of arguing about numbers using words the numerical meaning of which you consider to vary by a factor six? When you are being interviewed for your first job and your prospective employer makes you a salary offer of a million Dollars, it would be prudent to establish this is US and not Zimbabwean Dollars before trying to negotiate an extra 10%.
...Whatever:
Do you feel that 800 megabytes is enough info to instruct the creation of a human, all the body parts, all the physiology, and all the behavior?
jobby · 27 September 2008
So DNA runs on the OS & Hardware of Chemistry.
... how fortunate that that chemistry thru pure happenstance is able to do that. How fortunate indeed.
David Stanton · 27 September 2008
Ban the boob.
jobby · 27 September 2008
jobby · 27 September 2008
I was trying to define the meaning of words you and others were using, but you seem to have a need to argue for argument’s sake.
... the point is that the size of a 'byte' is arbitrary and based on 'convention' rather than a fixed math property like PI or 'e'. just as numbering systems are based on culture and convention.
the overall point is moot. whether DNA contains 10MB or 10,000 MB it certainly appears to be not enough and to accept that SOMEHOW thru some miraculous method DNA can perform all those functions is an act of FAITH not science.
Dave Lovell · 27 September 2008
Dave Lovell · 27 September 2008
stevaroni · 27 September 2008
iml8 · 27 September 2008
There's this concept in software development called
"code equivalence", mostly used as a metric for
programmer productivity. This issue relates to the
fact that some programming languages are more efficient
at some kind of tasks than others -- there are computer
languages I've worked with where I could write in one
line a program that would take pages of code in others.
So what they do is come up with standard benchmarks and
implement them in different languages, then compare how
much code it took. That gives conversion factors to
allow comparing programmer productivity depending on the
language used.
I was sitting marveling at the idea of comparing the
size of the human genome and MS Windows. Ah, so let's
determine the code equivalence between a computer and
... something that's not remotely a computer.
How about a miles-per-gallon comparison between me and
my Toyota?
I wondered if there were actually any creationist
websites that promoted this argument. I spent a little
time Googling and couldn't find any.
But I only mention this for the amusement value.
Everyone knows we're just playing games here. And
not very clever ones at that.
White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html
iml8 · 27 September 2008
I got to thinking -- we COULD do a miles per gallon
comparison between a human and a car: "If you drink
a gallon of beer, then how far can you walk?"
However, the number of miles would actually FALL as the
gallons of beer increased.
White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html
fnxtr · 27 September 2008
fnxtr · 27 September 2008
hahahahaha.
snipped, not sniffed.
I really should have my morning caffeine before I start typing. :-\
jobby · 27 September 2008
jobby · 27 September 2008
Ah, so let’s determine the code equivalence between a computer and … something that’s not remotely a computer.
.... Does the DNA contain instructions?
iml8 · 27 September 2008
fnxtr · 27 September 2008
PvM · 27 September 2008
PvM · 27 September 2008
iml8 · 27 September 2008
PvM · 27 September 2008
stevaroni · 27 September 2008
jobby · 27 September 2008
Yep. But we don’t know the code equivalence factor.
.. so you disagree with PVM who thinks they do not??
stevaroni · 27 September 2008
iml8 · 27 September 2008
PvM · 27 September 2008
PvM · 27 September 2008
jobby · 27 September 2008
It’s as meaningful as comparing my MPG with that of my car.
.... wrong! yet again!
... both have miles per kilocalorie. and we can calculate in both cases.
human 4 miles per 500,000 calories
car 20 miles per 40 million calories
obviously from a use of fuel point of view a human is much more efficient unless you factor in the weight differential
but to move one human by car or by foot the human is about 20 times more efficient. hence the green advantage of travelling by foot. biking is even better. since a human can do about 10 miles with 500,000 calories. which would be 50 times more efficient.
and again these are ball park figures
jobby · 27 September 2008
They do not what? Contain instructions like a computer? Again you have to read my response
...the information for creating a human is not in the DNA??
iml8 · 27 September 2008
OK. Now calculate the code equivalence between the genome and a computer.
stevaroni · 27 September 2008
iml8 · 27 September 2008
fnxtr · 27 September 2008
So now apparently KCal=gal. Interesting. Gallons of what? American or imperial gallons?
iml8 · 27 September 2008
fnxtr · 27 September 2008
But you're right, albino bunny (can I call you albino bunny? How about Ted?).
What benchmark would we use? How about a routine to sort a list? What kind of list? What kind of sort?
Yobbo? Any ideas?
PvM · 27 September 2008
iml8 · 27 September 2008
PvM · 27 September 2008
iml8 · 27 September 2008
PvM · 27 September 2008
PvM · 27 September 2008
How much information is contained in a recursive subroutine?
stevaroni · 27 September 2008
iml8 · 27 September 2008
iml8 · 27 September 2008
eric · 27 September 2008
PvM · 27 September 2008
tresmal · 27 September 2008
You realize, of course, that jobby doesn't want to understand, don't you? Understanding might make the aliens go away.
jobby · 27 September 2008
jobby · 27 September 2008
Where did the additional information come from? The environment and the laws of physics. Much of the same applies to DNA and organisms, with the added understanding that organisms contain many more intricate networks of interactions.
... interesting hypothesis. show me the peer reviewed study which validates this.
jobby · 27 September 2008
Do you think behavior is programmed in?
If the answer is ‘no’ then your storage problem drops significantly.
If your answer is yes, then homosexuality is not a sin because its not a free choice - its programmed in.
.. much behavior is programmed and much is not. ... is the real issue here homosexuality? it that really the underlying point?
jobby · 27 September 2008
wow are there a lot of trolls here.
does anyone want to SERIOUSLY discuss these issues??
David Stanton · 27 September 2008
Ban the boob.
stevaroni · 27 September 2008
jobby · 27 September 2008
In Bobby’s world, lengthening an arm would require the additional information to specify the paths for the longer veins, nerves, bones and other tissues, whereas science realizes that this is merely a self unfolding cascade where the length is determined by a single or few on/off switch(es).
... no I am quite aware of Hox genes etc.
but you are still believing that the DNA has enough space without proof that is still my point. we can argue a priori all day.
where is your test to validate your assertion?
jobby · 27 September 2008
well any neutral party reading this could see that my opposition has little but wise cracks
stevaroni · 27 September 2008
stevaroni · 27 September 2008
Wayne Francis · 27 September 2008
Wayne Francis · 27 September 2008
jobby · 27 September 2008
jobby · 27 September 2008
Our test is there has not been found 1 protein produce in any cell that we have ever found that doesn’t come from that cells DNA. This is what we call “Protein synthesis.
... producing a protein does not produce a body plan. the proteins are like bricks in a building
jobby · 27 September 2008
Your guy Deasey says that only 15% of that space seems to hold necessary information.
... no he does not. learn to read
stevaroni · 27 September 2008
stevaroni · 27 September 2008
PvM · 27 September 2008
PvM · 27 September 2008
PvM · 27 September 2008
PvM · 27 September 2008
jobby · 28 September 2008
Surely you can do better than that and explain to us why you believe DNA does not contain sufficient information?
... there seems to be enough reason to surmise that it is possible that there is not enough room in the DNA to justfiy doing experiment to validate that hypotheses instead of accepting that hypothesis as fact only on FAITH and a priori reasoning.
At one time most learned individuals assumed the geocentrism based on a priori reasoning. To know in this modern day to accept tenets as fact based on a priori reasoning is certainly a throwback to the middle ages.
jobby · 28 September 2008
Let me ask this:
Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc?
For instance the human genome had only 100 bytes would that be enough? I get the impression here and have heard it said that even ONE byte of info would be enough to construct the human body. Is that the general consensus here?
David Stanton · 28 September 2008
Just so no one will think any different, this boob has refused to answer at least 37 different questions that I posed to it, one of which I asked over a dozen times. Now he whines and cries and wonders why no one is interested in answering it's nonsensical questions.
Don't fall for the off-topic nonsense of this gramatically challenged fool.
Ban the boob.
jobby · 28 September 2008
Science Avenger · 28 September 2008
Another thread turned into Dorkfest. What purpose does this serve? It only takes one exchange to reveal handjobby's infantile games. After that it is all a rerun, hardly likely to attact new readers. No one on this site has ever given a sound, complete reason why this idiot isn't banned completely, for good, no exceptions. The only one I can think of is that you are trying to drive away your readers.
stevaroni · 28 September 2008
phantomreader42 · 28 September 2008
phantomreader42 · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
stevaroni · 28 September 2008
PvM · 28 September 2008
jobby · 28 September 2008
pick one of those research papers out that validate Darwinism. and lets go over it
... it has been claimed here there is overwhelming proof for Darwinism. I am simply asking for any of the posters to specify a study which they would like to go over and see if there really is proof there. This has never happened.
jobby · 28 September 2008
Let me ask this:
Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc?
... no answer yet. Seems like a simple question to me.
Science Avenger · 28 September 2008
Wouldn't you love to see what this guy actually looks like, where he works, and what his coworkers think of him, presuming he is even just one person instead of several? I can't imagine anyone with an even remotely fulfilling life would carry on so. Can you imagine his wife looking over his shoulder saying "Wow, you sure did that well"?
jobby · 28 September 2008
Ah but ID proponents have no answers, they at best have questions which originate from their poor understanding of science.
... I am not an ID nor Darwinism proponent. I am a science proponent.
well I have answered this:
Is there an amount of DNA space that any one here would consider to low to be able to carry out the instructions for growth, body plan, innate behaviors etc?
I answered that I thought the minimum about of info would be in the terabytes or petabyes.
... but no answer from the Darwinists. So how can the first sentence here be true??
jobby · 28 September 2008
Geocentrism was disproven by data and observations.
... that is exactly what I said. It was not disproven by a priori reasoning.
Is this too difficult of a concept for the Darwinists to grasp?
David Stanton · 28 September 2008
Just for the record, I never made any of the comments that hand jobby is attributing to me.
This jerk still hasn't answered one of my questions and still demands that everyone answer his questions. It even copied and pasted the comment where I pointed out that it hadn't answered the questions and still didn't try to answer even one of them. It just kept repeating the same irrelevant nonsense about FAITH. How is anyone supposed to infer that it has any intelligence or understanding at all if it won't answer reasonable questions, FAITH???
Ban the boob.
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
stevaroni · 28 September 2008
PvM · 28 September 2008
jobby · 28 September 2008
Less than 700Mb, troll.
That’s a simple answer.
Now, you show me where that’s not enough.
... why do you believe that less than 700 MB would not be enough info? FAITH?
stevaroni · 28 September 2008
Oh, and while I'm at it, start with this paper, troll.
Darwin's greatest discovery: design without designer.
http://www.ncbi.nlm.nih.gov/pubmed/17494753
or this one
Darwin's artificial selection as an experiment.
http://www.ncbi.nlm.nih.gov/pubmed/16473266
or this one
The modern theory of biological evolution: an expanded synthesis.
http://www.ncbi.nlm.nih.gov/pubmed/15241603
or this one
Endosymbiosis, cell evolution, and speciation.
http://www.ncbi.nlm.nih.gov/pubmed/17046345
or this one, an oldie, but a goodie on symbiotic evolution.
From extracellular to intracellular: the establishment of mitochondria and chloroplasts.
http://www.ncbi.nlm.nih.gov/pubmed/36620
Now, it's your turn troll.
Either show me your evidence that 700Mb is not big enough or shut up.
(Note, I know he will not actually answer the question, of course, he'll just say the papers are insufficient and change the subject. At this point, I'll just cut and paste my question again, since it's not good to let him play the martyr.
Since he'll never answer the question {he can't answer it}, our exchange may get even more tedious than it has been, so I'll apologize in advance, and suggest the moderator simply close this thread.)
jobby · 28 September 2008
In other words, a clear argument from personal incredulity.
... no from comparisons to other machines.
What do YOU feel would be too little MBs?
stevaroni · 28 September 2008
stevaroni · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
stevaroni · 28 September 2008
jobby · 28 September 2008
Either show me your evidence that 700Mb is not big enough or shut up.
....Either show me your evidence that 700Mb is big enough or shut up.
I feel there is no solid evidence either way on this.
How about YOU???
jobby · 28 September 2008
Oh, and while I’m at it, start with this paper, troll.
Darwin’s greatest discovery: design without designer. http://www.ncbi.nlm.nih.gov/pubmed/17494753
.... lets start with this one. have you read it??
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
To understand how science has been expanding its understanding of how genes form networks of interactions, see for starters
Notes: Graphical Gaussian Models for Genome Data
these gene networks are part of the answer to Bobby's argument from ignorance.
Let's see how Bobby deals with science.
jobby · 28 September 2008
As to the paper, it shows how Darwin, by providing scientific explanations for the facts of evolution allowed for ‘design’ without the requirement of an intelligent designer (read God).
... it seems that this article is a discussion and not an experiment or analysis of data of any kind. Can you show me where data is analyzed??
jobby · 28 September 2008
Now Jobby is moving from “700 mb is not enough” to “there is no evidence that DNA contains sufficient information”.
... well do YOU have evidence it does contain enough info MBs? Or do you base your belief on FAITH?
.... I have said many times before there is not convincing evidence either way. If you have any can you show us???
jobby · 28 September 2008
jobby · 28 September 2008
Is there any evidence 750 MB are sufficient or is this again a matter of FAITH?
stevaroni · 28 September 2008
jobby · 28 September 2008
...Can you give me a test that would falsify your assertion that 750 MBs are sufficient.
Of course you know if you cannot, then your hypothesis is not scientific.
jobby · 28 September 2008
One more time, J. How much space do you say we need?
... I answered this already. And I am of course guessing. There would have to be an experiment to validate.
jobby · 28 September 2008
I’ve made my view clear. By direct observation, the container is no bigger than 700Mb. There are no other apparent sources of significant “information”, nor do any more sources seem to be necessary.
... weasel words: apparent, seem.
GOT ANY VERIFIABLE EVIDENCE??
jobby · 28 September 2008
So again, why do you think the available space is inadequate, the cornerstone of your entire argument?
... I answered this already. Look thru the posts.
PvM · 28 September 2008
jobby · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
Once again Bobby has shown us how he proceeds from a position of ignorance while ignoring valid contributions to science. He refuses to acknowledge the data presented to him
What a crock
jobby · 28 September 2008
jobby said:
I’ve made my view clear. By direct observation, the container is no bigger than 700Mb. There are no other apparent sources of significant “information”, nor do any more sources seem to be necessary.
… weasel words: apparent, seem.
GOT ANY VERIFIABLE EVIDENCE??
First you…
... again I do not believe there is sufficient data to say either way on this issue.
... DO YOU AGREE WITH THAT??
jobby · 28 September 2008
My point is to show how you deal with science. I bet you did not even realize the existence of these models.
It’s an attempt to educate you. Perhaps I am expecting too much here.
... I think you are diverting.
… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE?
.... Is there any evidence 750 MB are sufficient or is this again a matter of FAITH?
these are the main focus areas of the thread
PvM · 28 September 2008
PvM · 28 September 2008
jobby · 28 September 2008
...Many people believe ID is not science because they feel it is not falsifiable.
....Do any here agree with that analysis??
jobby · 28 September 2008
As I have shown, it is not a matter of faith, it is a matter of plain observation based on many studies of embryological development.
... you have shown me a test that demonstrates that only 750 MB are are needed? I did not see that.
jobby · 28 September 2008
In other words, science has shown so far that evolutionary development seems sufficient in explaining the formation of an embryo,
... *** seems *** ?????? And many people think life *** seems *** designed. I think we should do some testing. Are you against that?
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
PvM · 28 September 2008
On Pharyngula, PZ Myers has provided us with a fascinating example of how a vulva in the nematode C. Elegans evolves.
The fate maps of the c elegans are well known and science is now filling in quickly the developmental pathways that generate these maps.
PvM · 28 September 2008
stevaroni · 28 September 2008
stevaroni · 28 September 2008
stevaroni · 28 September 2008
Stanton · 28 September 2008
Stanton · 28 September 2008
stevaroni · 28 September 2008
Now, now, now, Stanton, be nice.
It's not jobby's fault that he didn't know what to ask for, after all this is probably the first time he's dealt with science.
I see this all the time in my work, where people come in all day long insisting that they need widget X, and after you talk to them you realize that what they're really after is something completely different, it's just that they don't know the subject, they only know the name of widget X.
Management types, mostly, who think they know a lot more about it than they really do because they read about it in "Popular Science".
I suspect that doctors feel like this all the time when patients come in for erectile dysfunction products. But I digress.
Anyhow, don't feel bad jobby, data confusion happens to us all at one point or another. After all, that's the only explanation, otherwise you'd have to chalk it up to malice or incompetence.
I mean, really, you'd have to be pretty stupid not to understand the scope of a research paper, and we know that isn't the case, right J?
What jobby wants is a definitive picture of the globe, but he's asking for a streetmap. But maps aren't big enough to show what J wants to see. What he needs is an atlas, an anthology of street maps, right J?
After all, I can only assume you're totally motivated by the search for answers, right?
Science Avenger · 28 September 2008
Intelligent design is not science because it is a political creation that amounts to creationism stripped of all its overt references to the gods (in an attempt to get into classrooms past the courts), and all its predictive power (so it can't be disproven). Let's not pretend we haven't caught the magicians at their tricks and don't know exactly what they are doing.
Wayne Francis · 29 September 2008
Wayne Francis · 29 September 2008
Stanton · 29 September 2008
Also, trying to "convert" DNA into binary or ASCII like jobby/bobby/jacob/hamstrung/balanced/goff is trying to do ignores the fact that the genomic product may be a protein, or some sort of RNA, nor would assuming that a gene is simply biological computer code give any hint of the conformation or structure of the genomic product. And any biologist worth his amylase will tell you that knowing the conformation of a protein or RNA-ase is vital for understanding its function.
But, if you ask me, jobby/bobby/jacob/hamstrung/balanced/goff is just yanking our chains with his claim of how the human genome isn't enough information to produce a human. It's a moronic rehash of his moronic arguments of "why can't a whale go from terrestrial to aquatic in 1000 years," or "if you can't tell me how many miles per hour a whale's nostril moves with each generation, Darwinism doesn't exist," or "transitional forms don't exist" that he was spouting 5 months ago.
He refused to acknowledge anyone's points correcting his maliciously stupid claims then, and he refuses to acknowledge the corrections to his maliciously stupid claims now, as well.
Stanton · 29 September 2008
jobby · 29 September 2008
jobby · 29 September 2008
What we are saying is that 1bit could be used to represent ~3,000,000,000bp and that IS enough to produce a human.
... any studies to validate this? Or again just FAITH?
jobby · 29 September 2008
I have shown that the information content in DNA appears to be sufficient when studying embryological development.
... where have you SHOWN this?
jobby · 29 September 2008
In other words, science has shown so far that evolutionary development seems sufficient in explaining the formation of an embryo,
...'SEEMS SUFFICIENT'?? sure I agree that a logical case can be made for that. But where is the supporting experimentation? SCIENCE is not based on a priori reasoning. Well at least not since the rennaisance.
jobby · 29 September 2008
the inability of ID to predict anything about the designer,
... Behe never said this.
jobby · 29 September 2008
Well lets see where we are at:
UNANSWERED:
1…Many people believe ID is not science because they feel it is not falsifiable.
.…Do any here agree with that analysis??
2… but I was told there were hundreds of studies with experiment and analysis of data to validate Darwinism. Can you show me one of THOSE?
3… again I do not believe there is sufficient data to say either way that DNA has info info to construct and operate a human.
… DO YOU AGREE WITH THAT??
phantomreader42 · 29 September 2008
jobby · 29 September 2008
David Stanton · 29 September 2008
Ah yes, the "I know you are but what am I" argument rears it's ugly head once again.
Ban the boob.
fnxtr · 29 September 2008
Man I hope this guy gets laid soon.
phantomreader42 · 29 September 2008
SWT · 29 September 2008
phantomreader42 · 29 September 2008
jobby · 29 September 2008
So, he’s explicitly said this at least twice, on two separate days, and yet he feels he can get away with lying about his own statements.
... where liar??
Robin · 29 September 2008
ben · 29 September 2008
PvM · 29 September 2008
PvM · 29 September 2008
PvM · 29 September 2008
stevaroni · 29 September 2008
jobby · 29 September 2008
Dembski did, geez, I banned you from my thread and then you repeat the nonsense claim here with no reference.
... where? give me the quote! and why are you spamming here?
jobby · 29 September 2008
So your homework is to find the thread in which I responded to your first question.
... you never answered it
PvM · 29 September 2008
jobby · 29 September 2008
In my previous postings addressing fate maps, developmental biology etc.
jobby said:
I have shown that the information content in DNA appears to be sufficient when studying embryological development.
… where have you SHOWN this
---------------- no you have not. quit lying.
PvM · 29 September 2008
PvM · 29 September 2008
jobby · 29 September 2008
Science just doesn’t care about the issue since there is no indication that there is insuffient space.
... so if there is no indication you ASSUME the assertion is true.
SORRY that is not SCIENCE that is FAITH
PvM · 29 September 2008
PvM · 29 September 2008
jobby · 29 September 2008
n your confused world, anything with which you do not agree appears to be faith
... no I believe since needs data that supports hypotheses. Obviously you do not.
...... Show me the studies that show:
1.750 MB is sufficient
2. complex body plans can evolve from simpler ones via NS
go ahead!
jobby · 29 September 2008
Remember how complex a snowflake is
... a snowflake has little info content while the human body does. really have you ever really studied any of this?
PvM · 29 September 2008
PvM · 29 September 2008
PvM · 29 September 2008
Robin · 29 September 2008
jobby · 29 September 2008
What assertion? There is no assertion about the storage being suffient.
... You do not feel the storage is sufficient?
PvM · 29 September 2008
jobby · 29 September 2008
jobby · 29 September 2008
The claim that a snowflake has little information content appears to be a common fallacy,
... mainstream science seems to think so. well of course you might not be in step with them.
PvM · 29 September 2008
PvM · 29 September 2008
PvM · 29 September 2008
jobby · 29 September 2008
The snowflake is an very simple example of self-assembly. There is no blueprint or genetic code that guides the growth of a snowflake, yet marvelously complex structures appear,
.... well of course those information-poor repetitive structures can happen but not an asymetrical complex plan like the human body. 2 different scenarios
... anyhow enough apriori.... where is your experiment to validate your hypothesis.... you do believe in the scientific method.. dont YOU??
jobby · 29 September 2008
Let’s not confuse Dembski with ‘mainstream science’.
... never said Dembski was mainstream... really where do you get these ideas??
Robin · 29 September 2008
David Stanton · 29 September 2008
It shows that there is more that enough information in the snowflake genome to produce the structure of the snow flake!!!
jobby · 29 September 2008
Surely you do not seem to believe that to add another inch of leg, millions of bytes of information are necessary.
... adding another inch of leg is not that easy. it would require at least megs if not gigs.
... you do know the femur and and the tibia are not uniform in shape and width thru its length. and the nerve attachments are in different places and the plantaris adheres in a very odd way and the capella.
it is far, far, far more complex than adding another layer of bricks to a wall. even the skin which is prob the most simplistic organ has myriads of variations and structure differentiations.
have you studied any of this at all?
phantomreader42 · 29 September 2008
phantomreader42 · 29 September 2008
David Stanton · 29 September 2008
Is there enough information in the human genome to make that guy who played "mini me" in the Austin powers movies? Now, is there enough information in the human genome in order to produce Shaqeal ONeil? Now, is the amount of DNA in each genome the same? Now, will somebody please ban the boob?
PvM · 29 September 2008
jobby · 29 September 2008
jobby · 29 September 2008
Once again, since you’re obviously stupid and illiterate as well as dishonest, YOU are the one who has been claiming the storage is insufficient FOR AN ENTIRE WEEK, without even attempting to provide the slightest speck of evidence in support of this idiotic assertion.
... you must be hallucintating. where did I claim the storage was insufficient?
DO YOU FEEL THE STORAGE IS SUFFICIENT???? Y/N???
jobby · 29 September 2008
Dave Lovell · 29 September 2008
jobby · 29 September 2008
Well observers: we can see that none of the posters will say that 750 MB is enough storage. And they cannot even say 1 MB is to few.
Here is the reason: this cannot be falsified. And tho they claim ID cannot be falsfied and therefore not science in reality this storage amount cannot be falsified making also Darwinism not science by this criteria.
jobby · 29 September 2008
Are you aware that some people have their limb length corrected by breaking bones and slowly jacking the ends apart at the bone grows? Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely?
.........DDDDDDDDDDDDDDDDDDUUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHH!!!!!!!!!!
that lengthening is done by ID. The amount of bits of information used by the humans doing that is enormous.
You really dont get all of this do you?
PvM · 29 September 2008
PvM · 29 September 2008
PvM · 29 September 2008
fnxtr · 29 September 2008
POE!
jobby · 29 September 2008
however the reconstruction is done through natural processes
... the setting of the bones is done by humans. PUUUULLLLLEEEEZZZZZ!
jobby · 29 September 2008
the complexity in proteins emerges from the properties of independent base nucleotides and the laws of physics, where the various angles and rotations are determined by the interaction of all the nucleotides.
.....SO WHAT!!
the proteins a merely bricks in the building. JEEEZZZ!
David Stanton · 29 September 2008
RIGHT. PROTEINS ARE MERELY BRICKS. HA HA HA.
Now, according to hand jobby, Shaqeal should have a genome size about five times the size of Vern's. And it expects us to accept this on FAITH!!!
Ban the boob.
jobby · 29 September 2008
PvM · 29 September 2008
This is rather helpful as it shows the level of scientific vacuity to which Bobby is willing to sink. If he does not even understand how the information of the DNA is expressed in the organism and refuses to learn then indeed, he is doomed to ignorant 'observations' and 'claims'.
PvM · 29 September 2008
r · 29 September 2008
jobby/bobby/whatever reminds me of some students I knew at university who would disagree about anything and who did not care (or perhaps know) how inane their arguments were. They clearly thought they had reached the pinnacle of debating ability and astuteness; as far as I was concerned they were a juvenile bunch of oxygen thieves.
David Stanton · 29 September 2008
Nice try PvM. I tried to get this dill weed to learn something about alternative splicing about four days ago. Good luck. Oh well, at least you are doing a good job of preventing it from contaminating other threads.
Ban the boob.
Science Avenger · 29 September 2008
Science Avenger · 29 September 2008
Hamdjobby reminds me of some ignorant biker chicks I lived with in college who thought "never losing an argument" meant "never willing to STFU". The idea of an objective, logical standard of measurement never occurred to them.
Wayne Francis · 29 September 2008
Wayne Francis · 29 September 2008
tresmal · 29 September 2008
Stanton · 30 September 2008
Wayne Francis · 30 September 2008
jobby · 30 September 2008
Dave Lovell · 30 September 2008
jobby · 30 September 2008
Any FAITH you think posters here have would disappear instantly if EVIDENCE to the contrary was presented.
.... well at least you are admitting they accept their hypothesis without evidence. That is FAITH!
... and you really should look up what quote mining is. you do not seem to understand the term
eric · 30 September 2008
jobby · 30 September 2008
There is no code for building a tibia.
.... Wrong!...If that were true then the bone would not know how to grow into that shape.
David Stanton · 30 September 2008
Well at least now we know what problem hand jobby has with whales. They are just so frickin huge that they couldn't possibly be coded for in the whale genome. Since the position of every brick, er I mean protein, must obviously be described in detail in the DNA, science must be completely wrong about everything. We've all been so blind. Now I'm sure we all see the light, thanks to hand jobby and it's amazing powers brought about by the bricks in it's head.
Hey, let's go for a new record on this thread. I say we can keep the boob spewing out nonsense for over 1000 posts. That should keep him off of other threads. Maybe it will eventually learn what quote mining is.
Dave Lovell · 30 September 2008
fnxtr · 30 September 2008
Wayne Francis · 30 September 2008
Wayne Francis · 30 September 2008
Wayne Francis · 30 September 2008
jobby · 30 September 2008
There is no code for building a tibia.
.... Wrong!...If that were true then the bone would not know how to grow into that shape.
jobby · 30 September 2008
jobby · 30 September 2008
Since the position of every brick, er I mean protein, must obviously be described in detail in the DNA,
... now that was a really stupid statement!
Robin · 30 September 2008
eric · 30 September 2008
PvM · 30 September 2008
PvM · 30 September 2008
Oh an Bobby, you still owe us an estimate of the information contained in the human body.
I assume you are still working on this so I will remind you regularly until you have done so.
After all, you claim to be interested in science and data...
jobby · 30 September 2008
…and the result would be tibias of different length-diameter ratios. Which is what we see in humans. In fact even identical twins can be different heights, a result of same genetic instructions leading to different sized bones when the ‘development experiment’ is run twice.
... DUH!!!! how does the bone know to grow into the shape of a tibia rather than the shape of a femur without instructions.
PvM · 30 September 2008
jobby · 30 September 2008
It’s called emergence based on the local gradients of chemicals combined with the neighboring cells which cause embryos to ‘grow’. In that sense there are no more instructions than for forming a snowflake.
... DUH! again how a tibia know what shape to assume?
jobby · 30 September 2008
Oh an Bobby, you still owe us an estimate of the information contained in the human body.
I assume you are still working on this so I will remind you regularly until you have done so.
After all, you claim to be interested in science and data
.... And you have never stated whether your thought 750 MB would be enough and not ONE study showing how complex animals can evolve by NS. You are such a liar.
PvM · 30 September 2008
PvM · 30 September 2008
eric · 30 September 2008
PvM · 30 September 2008
SWT · 30 September 2008
PvM · 30 September 2008
Dan · 30 September 2008
jobby · 30 September 2008
jobby · 30 September 2008
The same way a loaf of bread “knows” to be rectangular: because there’s physical impediments (a pan), raw material limitations
.... so where is the mold for instance for the pelvis??
jobby · 30 September 2008
None of you here really understand this concepts do you?
jobby · 30 September 2008
Look at fig 2..
So how do these bacteria know to form such patterns…
.... there are no complicated interconnected parts there.
PvM · 30 September 2008
PvM · 30 September 2008
PvM · 30 September 2008
PvM · 30 September 2008
jobby · 30 September 2008
Don’t project your ignorance onto others my dear confused friend. it just makes you look foolish.
... Oh stop it. You are just faking here. You cannot even come up with one study to show that NS evolves complex structures.
... And comparing a simple structure like a snowflake to a digestive system shows complete ignorance.
PvM · 30 September 2008
So Bobby remind us again of your progress:
How much information is contained in the human body.
Chirp Chirp...
jobby · 30 September 2008
These complex patterns form from the simple interactions of local as well as global signalling, combined with diffusion/reaction partial differential equations, leading to the emergence of these intricate patterns.
... oh stop the bull. Where is the pattern for the tibia stored? Where is the differential equation stored? You really are ignorant.
jobby · 30 September 2008
PvM · 30 September 2008
jobby · 30 September 2008
Just calling the snowflake ‘a simple structure’ without any logic or reasoning is not going to help your argument here, other than admitting that the tibia is just ‘a simple structure’ as well.
... the tibia is a complex structure and snowflakes are not. Read up on it
PvM · 30 September 2008
PvM · 30 September 2008
PvM · 30 September 2008
jobby · 30 September 2008
The pattern of the tibia is not stored anywhere, just like the patterns for snowflakes. They emerge through the processes of physics and boundary conditions.
... so how does the human skull know not to grow into the shape of a chimpanzee skull? has nothing to do with the DNA??
minimalist · 30 September 2008
jobby · 30 September 2008
Your belief that the instructions for a human embryo to develop a human skull and a chimpanzee to develop a chimpanzee skull are not in the DNA is ludicrous.
jobby · 30 September 2008
Where are the tiny, shape-changing elves who hide inside my TV and act out the nightly sitcoms for me? You are so ignorant.
... so you also believe the directions for forming the skull are not in the DNA? THAT seems ignorant to me!
PvM · 30 September 2008
jobby · 30 September 2008
Instead, Thewissen and his colleagues conclude, whales’ hind limbs regressed over millions of years via “Darwinian microevolution”: a step-by-step process occurring through small changes in a number of genes relatively late in development.
... nice hypothesis. Any experimentation to back it up?
PvM · 30 September 2008
jobby · 30 September 2008
Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. However, much of the information to form the limb emerges from the ‘simple’ processes of physics combined with local conditions, neighboring (boundary) conditions, feedback loops and more. The importance of DNA is to express when to start and stop, and to determine the relevant axis of the organism, which combined with the laws of physics lead to emergence of relatively complex patterns and yet the DNA does not guide the formation of every single cell, which is a somewhat naive view of genetics
.... so the form of the human skull is not stored in DNA and the form of the chimpanzee is not stored in its DNA??
PvM · 30 September 2008
PvM · 30 September 2008
PvM · 30 September 2008
PvM · 30 September 2008
PvM · 30 September 2008
jobby · 30 September 2008
What part of Now you are missing the point, of course DNA plays a role, through the turning on and off of protein expression, feedback and feedforward loops, the skull development is regulated. confuses you?
... and where are the instructions when to turn off and on these various feedback loops and protein expressions stored??
PvM · 30 September 2008
jobby · 30 September 2008
jobby · 30 September 2008
‘partial differential equations’
... have you ever worked with those. DUH!!! the variables need hard values! you seem like you are BSing your head off.
PvM · 30 September 2008
PvM · 30 September 2008
jobby · 30 September 2008
PvM · 30 September 2008
jobby · 30 September 2008
OK How in a developing human is femur instructed to stop growing lengthwise and in diameter?
David Stanton · 30 September 2008
Perhaps PVM and hand jobby could both post a short description of exactly what it is that they hope to accomplish here. Then the rest of us, (if any one still cares), can let each of them know what their chances are of success.
(Hint to PvM: please remember the original topic of this thread - immune to evidence.)
Other that that, the only interest in this thread is whether the moderator wil allow it to get to 1000 posts or not. I am hoping it will get to 1000, but then again I will probably only read number 1000.
PvM · 30 September 2008
Henry J · 30 September 2008
jobby · 30 September 2008
Researchers concluded that FGFs act as instructive molecules by examining the expression of a gene called Meis1 found at the proximal portion of the developing limb bud.
... how were these created and where was the info stored that created them?
PvM · 30 September 2008
fnxtr · 30 September 2008
Is it just me or is Yobbo now asking how the sea knows to be salty?
PvM · 30 September 2008
David Stanton · 30 September 2008
I once made a picture of a flower with a spirograph. It was really cool. Was the information for the structure of the flower in the genome of the spirograph?
Wayne Francis · 30 September 2008
PvM · 30 September 2008
tresmal · 30 September 2008
Ban jobby? No, instead restrict him to this one thread, henceforth known as the jobby thread. (somehow that sounds dirty) People who feel the need to beat their heads against a wall (such as myself apparently) can come here and contend against jobby's invincible obtuseness to their hearts' content. Since this is very clearly important to jobby, and it does keep him off the street and away from potential mates and since he is not actually evil, this one thread does seem to be too much of sacrifice. I have found that grappling with the impenetrable murk of jobby's thinking has helped me to clarify my own.
Wayne Francis · 30 September 2008
Wayne Francis · 30 September 2008
tresmal · 30 September 2008
So has anyone (besides jobby) not notice the irony of the subtitle to this thread: "immune to evidence"?
Wayne Francis · 30 September 2008
Henry J · 30 September 2008
Stanton · 30 September 2008
PvM · 30 September 2008
I ran across an fascinating post by PZ Zygotic genes which shows how patterning happens as well as reminds us of the relevance of 'maternal genes'. So in fact, this is one example of where not all information is stored in the DNA of the zygote, but rather comes from the mother.
Wayne Francis · 30 September 2008
PvM · 30 September 2008
Stanton · 30 September 2008
tresmal · 1 October 2008
I noticed that jobby likes to position this by saying that it is either proven or it's "FAITH". This is, of course, a false dichotomy. In between these two extremes is a wide range in degrees of certainty. A large part of what science does is to establish what levels of confidence we can have for various scientific explanations. With regard to "is 750MB enough etc. etc.":
1) Nobody has found a protein with no gene in the DNA.
2) Everything that is known about embryology (which is far from everything)is explained by the interplay of DNA, regulators, cellular biochemistry and the embryo's environment.
3) There are no candidates for this extra information. No organelles of unknown function, no large quantities of complex chemicals sitting around with apparently nothing to do. Remember jobby's guess is that the information required is at terabyte levels or greater. That's a minimum of a thousand times the amount in DNA. Where is it?
4) This "dark information" is not making its presence detectable in any way. There are no known secondary effects, no metabolites, no indirect evidence, nothing.
A job is undeniably being performed. Only one thing is observed performing that job. There are no hints of anything else performing that job. Best fit with the evidence? That one thing is enough to do the job. Does this prove it? No. Is it "FAITH" then? Absolutely not. It is much closer to the proven end of the spectrum than the "FAITH" end.
Dan · 1 October 2008
Wayne Francis · 1 October 2008
jobby · 1 October 2008
2) Everything that is known about embryology (which is far from everything)is explained by the interplay of DNA, regulators, cellular biochemistry and the embryo’s environment.
... circular logic! that is exactly what I am saying: we do not know where much of the instructions are coming from. you just said that in your above statement
jobby · 1 October 2008
I don’t know why jobby’s second question is relevant, but, yes, The Origin of Species was extensively reviewed by Darwin’s peers. Also by Darwin’s non-peers, such as Wilberforce.
... And I am sure that Behe, etc were reviewed by his peers and non peers as a 'book' You know I am talking about experimental proof in journals. Not a discussion of a hypothesis.
jobby · 1 October 2008
A large part of what science does is to establish what levels of confidence we can have for various scientific explanations.
... and show me the p values for these experiments test Darwinism please. NO a priori!
jobby · 1 October 2008
Did you not read? This came from experiments on dolphin and whale embryos.
... I am asking for experiments to specifically prove that NS causes complex body parts.
CAN YOU READ??
jobby · 1 October 2008
ach of the roughly 800 ommatidia in the compound eyes of fruit flies has a basically fixed number of cells that are programmed, or patterned,
....OK how many bytes of info are needed just to create this eyes? Let start quantifying and quit BSing.
jobby · 1 October 2008
Going over Hand Jobby’s comments you have to come to the conclusion that he thinks that to build anything you would need a plan bigger then what is being built.
.... of course I do not think that! I can have a blueprint for a brick and build a million of them from that. And I can have a blue print for a protein and build a million.
But how those pieces are assemble cannot be instructed with ONE BYTE as is the consensus here.
.... QUANTIFY!! How many minimum bytes to construct the human eye?????????????? 1 BYTE. you dont see how ridiculous that claim is.
jobby · 1 October 2008
... Lets take just the SHAPE of a bone. assuming it is homogeneous. no blood vessles nerves marrow etc.
and assuming it is cylindrical: it would take at least 2 bytes: one for the diameter and one for the length
jobby · 1 October 2008
Going back to conjoined twins Hand Jobby’s statements would say that the “Plan” was for the twins to be conjoined from the start.
... no I never said anything like that. In that case the plan was followed and an error occured in the exectution of the instructions.
jobby · 1 October 2008
Absolutely not. It is much closer to the proven end of the spectrum than the “FAITH” end.
... QUANTITIZE!! complete faith being zero and undisputable fact beint 10 give a number to your belief that all the necessary info is in 750 MB of DNA
jobby · 1 October 2008
What has intrigued scientists is Runx2 is expressed in fetal progenitor cells as early as embryonic day 10, or well before its curtain call to orchestrate chondrocyte and osteoblast differentiation.
... and where did the info come from to create Runx2. QUANTITIZE! how many bytes to create Runx2??????????
jobby · 1 October 2008
1. Bobby is unable to quantify the information in the human body, despite his claims.
.... # of cells = ~ 10^14
ok now YOU quantitize! how many bytes to instruct the development of the thumbnail???? can you even do that???
wad of id · 1 October 2008
Bytes do not create anything.
wad of id · 1 October 2008
Bytes do not instruct.
wad of id · 1 October 2008
Bytes mean nothing without its context. Your hard drive comes rated for billions of bytes. Take the hard drive by itself. It's worthless.
wad of id · 1 October 2008
So the requests to calculate bytes is an exercise in wasting time.
wad of id · 1 October 2008
jobby comes with the premise that not calculating bytes in a genome is a fault of current science. It's not an accepted premise. It is an IDiotic premise. We do not play his juvenile game because science proceeds without it.
wad of id · 1 October 2008
Here's an example: how many bytes are there in the physical processes required to generate Hurricane Katrina?
Now, are those bytes sufficient to instruct or create Katrina?
See how stupid these requests are?
jobby · 1 October 2008
I think the argument here is like this. We can make a plan to build a wall with bricks. It can be very simple like this:
first tier: half-brick, 20 full bricks, half-brick
next tier: 21 full brick
next tier :half-brick, 20 full bricks, half-brick
continue on for 50000 tiers
no of course we do not have to have in the blueprint and instruction for each individual brick but we need SOME kind of instructions
i could give the above to a bricklayer: 4 lines of instruction and do not have to give 50000 lines of instruction. this is the fallacy that the opposition here keeps hyperbolizing on
but the reverse cannot be inferred that we only need one line of instruction
hope the observers see this point ( and why do you call them 'lurkers'?? that is so negative!)
wad of id · 1 October 2008
Or here's another example: how many bytes are there is the water molecules required to generate a snowflake?
Now are those bytes sufficient to instruct or create a snowflake?
See how stupid these requests are?
jobby · 1 October 2008
Bytes do not instruct.
... bytes are a measure of info. the info of a size of 'one byte' DOES instruct.
... so you are saying there is no info in the DNA??
wad of id · 1 October 2008
Your example is fallacious because it does not measure the amount of pre-stored instructions in the workers you asked to build the wall.
Plus we're dealing with natural processes where no other source of information extrinsic to the genome has been detected.
Apples and oranges, jobby
Apples and oranges.
wad of id · 1 October 2008
No, I'm not saying there is no "info" in DNA.
Read: Bytes do not instruct.
Can you understand those 4 words?
jobby · 1 October 2008
Or here’s another example: how many bytes are there is the water molecules required to generate a snowflake?
... of course they are things in nature that self-organize. but the human body is not one of those.
... are you really saying that occasionaly human bodies appear without millions of years of evolution??
wad of id · 1 October 2008
Here, jobby. What does your hard drive with its 750 GB instruct you to do?
LOL
wad of id · 1 October 2008
Self organization doesn't require bytes? REALLY?
Are you that dense. Everything has bytes. A snowflake has bytes.
Take a JPG of the snowflake. It has bytes.
You can describe its fractal shape ... using bytes.
jobby · 1 October 2008
Read: Bytes do not instruct.
Can you understand those 4 words?
DDDDDDDDDDDUUUUUUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHH!!!!!!!!!
if I say it takes a gallon of gasoline to go 20 miles I am not saying the 'gallon' enables the car to go 20 miles. gallon is a unit of measure just as byte is.
.... that was just a plain stupid comment
wad of id · 1 October 2008
Human bodies do not "occasaionally" appear in "millions of years". Just like Hurricane Katrinas do not "occasionally" appear every second.
jobby · 1 October 2008
Self organization doesn’t require bytes? REALLY?
... no outside instructions. of course the result can be expressing bytes.
... you are just trolling now and making stupid comments
wad of id · 1 October 2008
No the person who is stupid is you. You just admitted the impotency of the byte.
The byte is not a fuel like gasoline. It does not generate heat. It does not create energy. It is just a mathematical construct.
jobby · 1 October 2008
Plus we’re dealing with natural processes where no other source of information extrinsic to the genome has been detected.
....DDDDDDDDDDUUUUUUUUUUUHHHHHHHHH!!!
... so we would need even more info!!
wad of id · 1 October 2008
You are just being stupid. You make an arbitrary distinction between a "self-organizing" system and one which evolves.
In the evolutionary world, both are critical mechanisms at play. Your hard drive has a measure of "self-organizing behavior" Those disk platters don't just magically form. Self-organization. It is what allows bytes to be measured.
wad of id · 1 October 2008
Exactly. It could be possible that the whole information content of the Universe since the start of the time went into generating the genome as it is today.
wad of id · 1 October 2008
What you don't get is that bytes have no causal role.
Are you still stupid, or do you get this point by now?
wad of id · 1 October 2008
jobby, hello are you there?
wad of id · 1 October 2008
is this getting to you yet?
jobby · 1 October 2008
Here’s an example: how many bytes are there in the physical processes required to generate Hurricane Katrina?
.... who knows. certain things in nature happen spontaneously.
.... do you really believe human body happen spontaneously or do they need a long process to evolve them??
wad of id · 1 October 2008
I like the byte just as much as the liter. How many liters is the genome???
Did you know that there are more liters in the human body than in the genome???
Where do all those liters come from???
Maybe it comes from the liters out of the Universe!! LOL
jobby · 1 October 2008
You make an arbitrary distinction between a “self-organizing” system and one which evolves.
... we can observe some things self-organizing. how you seen a human body self-organize lately???
wad of id · 1 October 2008
Have you ever seen an electron jobby?
How do you know that an electron exists.
wad of id · 1 October 2008
Have you ever seen a phasor, jobby?
Do you know that they exist?
wad of id · 1 October 2008
You didn't answer my question, jobby.
How many bytes are in the physical processes which instructed the creation of the Hurricane Katrina.
Do you really concede that "certain things in nature happen spontaneously"???
LOL. You are a believer in magic.
jobby · 1 October 2008
wad of id · 1 October 2008
BTW, do you believe in the spontaneous generation of life too?
Pasteur disproved that theory a long long time ago.
Maybe you haven't heard of Pasteur.
wad of id · 1 October 2008
I love you jobby. I would love to fuck you jobby. You turn me on.
wad of id · 1 October 2008
jobby, are you going to have a discussion with me or not?
jobby · 1 October 2008
Do you really concede that “certain things in nature happen spontaneously”???
... you are the one that says the human body magically self-constructs without instructions. I am the one that says it need instructions.
You are just playing here and an observer could see that. BYE!
wad of id · 1 October 2008
hello are you there?
there are a number of substantive counterarguments to your ramblings that you haven't even touched.
wad of id · 1 October 2008
I am not playing... You cannot even show me where I said "the human body magically self-constructs without instructions"
But you did admit that you believed in magic. Why do you subscribe to magic, jobby? Isn't that a bit immature?
I want to continue having this deep philosophical discussion with you.
Don't leave me. You make my life meaningful.
wad of id · 1 October 2008
Jobby, why do you think the Hurricane Katrina was created?
Who made all those bytes to instruct the construction of the Hurricane Katrina?
wad of id · 1 October 2008
What deep magic went into the Hurricane Katrina?
Did it come from the White Witch of Narnia?
wad of id · 1 October 2008
jobby, where are you?
wad of id · 1 October 2008
Jobby, are we still going out tonight? I've got a special room booked just for the two of us. It's going to be a Magical night.
wad of id · 1 October 2008
Let's talk about phasors: http://en.wikipedia.org/wiki/Phasor
It is a widely used engineering concept. It describes how common RLC circuits can affect the phase of a sinusoidal input voltage.
Why don't you know about phasors Jobby?
Are you just a one-trick pony, talking about information information information?
You should broaden your mind.
wad of id · 1 October 2008
Jobby, we can have snowflakes tonight. I can draw all sorts of snowflakes on your spontaneously constructed body.
wad of id · 1 October 2008
Like you, the snowflakes will be exquisitely designed.
wad of id · 1 October 2008
wad of id · 1 October 2008
Well guys, if you don't mind, I'd like to be the only person to have a discussion with jobby. I am sure jobby doesn't care. You all can get on with the rest of your lives and do something more useful than bashing a White Witch follower.
wad of id · 1 October 2008
j ... o ... b ... b ... y
I know you're reading this. Your IP address shows up on the monitor.
Why are you avoiding me?
We had such a fulfilling meaningful deep discussion about the mysteries of life.
Where are you hiding from me?
Wayne Francis · 1 October 2008
wad of id · 1 October 2008
The more important point is that when scientists say something is unknown it doesn't automatically default to some other Magical answer. We don't know. Jobby certainly doesn't know.
So what? We don't where Jobby crawled out of his Mommy's pussy. But it doesn't mean he was divinely created.
Wayne Francis · 1 October 2008
wad of id · 1 October 2008
Exactly instruction is nothing more than a mechanism. It's a natural, material concept.
"F = ma" is an instruction
It instructs the mass to generate a force proportional to its acceleration.
The word "instruction" is devoid of meaning aside from its rhetorical effect.
jobby · 1 October 2008
If at that that time you want to add up the number of base pairs in those genes, and divide by 8 to come up with a number of bytes that it would take to encode the original DNA you will still not have an accurate representation of the process even though all the information flows from that DNA.
.... so the hypothesis is not falsifiable. glad you agree. that was my point.
jobby · 1 October 2008
wad of id · 1 October 2008
Where does the instruction for "F = m a" come from?
Nobody knows. Must be magic.
wad of id · 1 October 2008
There you are jobby. I have missed you. I knew you were peeping from afar.
Do you know where "instruction" F = ma comes from?
jobby · 1 October 2008
wad of id · 1 October 2008
Here's another instruction for you: V = IR
wad of id · 1 October 2008
But you are more ill than I, jobby. I am here to cure you of your illness. It's an illness called stupidity.
wad of id · 1 October 2008
Here's another instruction for you: circumference = diameter * pi
wad of id · 1 October 2008
Now there's an interesting instruction. How many bits of information are there in pi?
I think it's infinite. Do you know what is the shortest encoding of pi which will generate all of its digits instantaneously?
So does that mean everytime I take a compass and draw a circle, I am imparting infinite information on the piece of paper???
Magic.
wad of id · 1 October 2008
Here's another instruction with infinite bits: area of circle = pi * radius squared
Mind boggling
wad of id · 1 October 2008
Or how about the trigonometric functions?
Take sine. It is represented by (*gasp*) an infinite polynomial.
Did you know, jobby, that the instruction for a simple pendulum has a sine function in it???
How can a pendulum operate with infinite bits of information???
wad of id · 1 October 2008
I don't know about you, jobby my dear. But it looks like there's more to this "information" business than you know.
Your silence is deafening.
wad of id · 1 October 2008
Ooh, here's a lovely instruction: exp(pi*i) = -1
Here an infinitely informative function acts on an infinitely informative constant through an imaginary number to tell it to reduce the integer -1. Always.
How do you like them apples?
wad of id · 1 October 2008
j . . . o . . . b . . . b . . . y
Where are you?
You've run off again, just when the schooling started.
Where are you afraid of learning?
David Stanton · 1 October 2008
So, hand jobby runs away when it thinks that someone is just playing with it, but it wonders why on one will answer it's questions when it plays silly games like taking both sides of an argument or quote mining and then lying about it.
As for falsifiability, hand jobby has had over a week to come up with an example of one protein needed for human development that is not coded for in the human genome. He has failed, therefore his "hypothesis" is falsified.
Oh well, what can you expect from someone who thinks that proteins are "merely bricks". Here is a clue for you hand jobby: proteins are bricks and brick makers, brick layers and foreman supervising the brick laying. Go figure.
Well, I was hoping that this thread would get to 1000 posts. Still, WAD is so prolific that he might just make it on his own.
Wayne Francis · 1 October 2008
wad of id · 1 October 2008
I don't get why people are obsessed with the bit. What happened to the liter? It's got a richer history. And it's just as informative.
wad of id · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
jobby · 1 October 2008
I think here is the basic problem:
The posters here believe that the DNA has sufficient storage capacity to construct a human body.
Then I ask: how do you know that?
A: Because there are no other sources for info.
Q: How do you know there are no other sources?
A: Because we have not found any
Q: Just because you have not found any does that mean they do not exist?????????????
wad of id · 1 October 2008
jobby, jobby, jobby. Your perception of the "problem" is way off.
It's not that we "believe" DNA has "storage capacity" to construct a human. It is that we don't think you know what is actually stored in there. The DNA genome is not sufficient for life. There's a whole proteome. Then there are mechanical laws that all of these chemicals follow.
Get it?
jobby · 1 October 2008
There is only a 1.5% difference in monkey and human DNA.
That is only about 14 MB of info that makes us so superior to monkeys. Truly miraculous!
jobby · 1 October 2008
Show me how to falsify this hypothesis:
The 750 MB of info in the human DNA is enough to construct a human.
jobby · 1 October 2008
Robin · 1 October 2008
fnxtr · 1 October 2008
First you have to tell us what the information actually is, Yobbo. You really don't get that, do you. That's what the guys and gals who actually do the work -- you know, not Aristotlean mind-wankers like you -- are finding out. And what they have been trying to tell you.
David Stanton · 1 October 2008
I think here is the basic problem:
The posters here believe that the DNA has sufficient storage capacity to construct a human body.
Then I ask: how do you know that?
A: Because of the last two hundred years of research
Q: Let's just ignore all of that because I don't know anything about it. How do you know there are no other sources?
A: Because we have not found any in two hundred years of research
Q: Just because you have not found any does that mean they do not exist?????????????
A: Just because you think they might exist doesn't mean they do.
As has been pointed out repeatedly, the burden of proof is on you. You have not even attempted to meet that burden, therefore evreryone has given up on you long ago an is now just making fun of you because you have demonstrated that you should not be take seriously.
Wayne Francis · 1 October 2008
wad of id · 1 October 2008
Robin · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
jobby · 1 October 2008
jobby · 1 October 2008
jobby · 1 October 2008
Robin · 1 October 2008
Robin · 1 October 2008
wad of id · 1 October 2008
It's about as scientific as saying that the volume of the genome is "enough to construct a human".
eric · 1 October 2008
David Stanton · 1 October 2008
So, hand jobby finally gets it. His feeble attempt at converting bases into megabytes is NOT A SCIENTIFIC HYPOTHESIS. Finally, some progress.
jobby · 1 October 2008
jobby · 1 October 2008
I think what he’s asking is for a complete, millisecond by millisecond description of how the DNA in a single fertilized cell produces an adult human. Evidently no less comprehensive study is convincing, because every time PvM provides one, he asks, “x may explain y, but where did x originate?”
... no I am not! Such hyperbole! Is that all you got??
jobby · 1 October 2008
Hurricanes do not spontaneously occur.
... are they programmed?? as life is??
PvM · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
David Stanton · 1 October 2008
Hand jobby has just proven my point for me. The authors describe the genomes in base pairs not megabytes. DNA is not an ASCII code. Why can't this entity ever get around the bricks in it's head?
Of course, every in vitro fertilization ever done disproves the hypothesis that 3 billion base pairs is not sufficient to specify the development of a human being.
phantomreader42 · 1 October 2008
PvM · 1 October 2008
Yes, his argument that the difference between a human and a chimp is 14Mbytes and finds this incredible suggests that Jobby's common 'scientific argument' is one of personal incredulity due to ignorance of science.
Fascinating but in the end, doomed to remain as vacuous as its foundation, Intelligent Design.
For that we should thank Bobby as he continues to underline that ID is not a scientifically relevant position and in fact relies on ignorance of science to make 'claims' that 'well heck I could not possibly understand how this could be the case'. When people attempt to clarify the ignorance, the subject refuses any attempt to educate.
In order to present a scientific argument Bobby has to show that the information content in the genome (which he guestimates to be 750mb), is at odds with the information content of the human body (which he claims is complex but refuses to estimate).
So far there has been no evidence of a conflict and much evidence of the contrary and yet, Bobby's argument? Are you sure...
Science is never 100% sure, but its explanations surely beat the ignorance approach chosen by Bobby. And for what reason?
jobby · 1 October 2008
jobby · 1 October 2008
DNA is not an ASCII code.
... dummy: you can have bits and bytes without an ascii code.
Robin · 1 October 2008
Robin · 1 October 2008
Robin · 1 October 2008
Robin · 1 October 2008
jobby · 1 October 2008
It’s not a scientific hypothesis, beandip.
... dummie: why not??
PvM · 1 October 2008
jobby · 1 October 2008
Life isn’t programmed, beandip.
.... dummie: Then what is the purpose of the DNA??
jobby · 1 October 2008
In Drosophila, “Christiane Nüsslein-Volhard and Eric F. Wieschaus identified and classified 15 genes of key importance in determining the body plan and the formation of body segments of the fruit fly Drosophila melanogaster. Edward B. Lewis studied the next step - homeotic genes that govern the development of a larval segment into a specific body segment. “
This information can be easily accessed from Wikipedia. Only 15 genes, determine the body plan and body segmentation of the fruit fly. How could this possibly be?
.... read more carefully 15 genes determine the body segments. not the actually details of those segments
PvM · 1 October 2008
PvM · 1 October 2008
The following website at the Max Planck Institute for developmental biology outlines the relevance. The basic model of patterning was predicted before the biochemical details were available and the data ended up largely supporting the original model, however the model itself generates additional requirements and predictions about how polarity is transmitted and more.
Actually, somewhat ironically, the patterning of stripes is in this case not a Turing pattern. You remember Turing who pointed out that reaction diffusion models away from equilibrium can form patterns? The wave like patterns were indeed suggestive of such a model, which science found, in this case to be flawed. The site provides links to three pdf papers which outline the basics.
Still with us?
jobby · 1 October 2008
dvise me also when you have your estimates of information content of the human body available. We are still waiting patiently
... YOU are making the claim. I am saying it seems unreasonable. Then you say that you feel it IS reasonable. This again is all, all a priori. We can debate about it forever.
UNTIL
You show me how you can falsify your assertion that the DNA contains enough info to construct a human body. Ptolemy came up with tons of explanations which his geocentrism was true. But an experiment proved him false.
Where is your experiment??
jobby · 1 October 2008
jobby · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
jobby · 1 October 2008
This is based on both positive evidence from embryology as well as a lack of evidence of 1) insufficiency of DNA information 2) ways DNA information is to be supplemented.
... the amount of data that can be store in the dna is 750 MB and you are saying that is enough. and your reasoning is that there is a lack of evidence that it is not enough.
circular logic again
... I can say I can jump 10 feet and you ask me to prove it. And I say that since there is no evidence that I cannot then I must be able to.
jeez!!
jobby · 1 October 2008
How many MB are needed to construct a fingernail?
Could it be done in 1 MB??
PvM · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
Robin · 1 October 2008
jobby · 1 October 2008
jobby · 1 October 2008
Because no scientist has put it forth as an hypothesis, beandip. That there appears to be information in the genome equivalent to about 750 (or 700 or 800 or 18000 or whatever) MBs is merely a metric. It has nothing to do with any hypothesis, beandip.
...dummie: merely a metric?? like the earth is not 7000 years old, just a dumb old metric that year thing.
....dummie: science is based on metrics! that's what the inverse proportionality of gravity is based on, dummie!
jobby · 1 October 2008
Bmp4 signaling plays an important role during the recruitment of mesenchymal cells into the condensations forming the terminal phalanges, whereas Msx2 affects the length of nails and claws by suppressing proliferation of germinal epidermal cells.
... and where do Bmp4 and Msx2 get the info to perform their tasks??
jobby · 1 October 2008
Can natural selection add information to the genome??
Robin · 1 October 2008
jobby · 1 October 2008
Robin · 1 October 2008
Robin · 1 October 2008
Robin · 1 October 2008
fnxtr · 1 October 2008
jobby · 1 October 2008
Burden of proof fallacy, beandip.
.... dummie: So YOU have not burden of proof??
fnxtr · 1 October 2008
oops. Okay, "attach to", not "form on".
jobby · 1 October 2008
jobby · 1 October 2008
The human genome consists of 3 billion base pairs, which is equivalent to about 750 MB. Our genome contains genetic information from more primitive organisms (bloatware?) just as our physical structure has primitive antecedents.
fnxtr · 1 October 2008
fnxtr · 1 October 2008
Mb means Mega-BASES, dolt. 5 million bases long. It's a measure of DISTANCE.
And you haven't answered my questions at all. Not that I really thought you would.
jobby · 1 October 2008
Robin · 1 October 2008
David Stanton · 1 October 2008
This just in, I have found the reference tht hand jobby keeps demanding:
U. R. A. Dolt et al. (2008) Human genome size and human development. Journal of Metaphysics 1(6):660-666.
From the Abstract:
We performed in vitro fertilization under normal conditions as a control. We also perfored an identical experiment inside a stasis field specifically designed to prevent the entry of any information from any outside source, natural or supernatural. The developmental rates were identical between the two treatments and there was no statistically significant difference in mortality rates. We conclude that the amount of information in a diploid human genome is sufficient to generate a human individual without the need for any further information from any other source.
From the Future Research section:
We are planning to convert the information in the human genome into ASCII code and attempt to generate a human being using the information is this form. Preliminary results suggest that this approach will be unproductive.
Robin · 1 October 2008
Robin · 1 October 2008
jobby · 1 October 2008
“MB” above refers to “Megabases” not “Megabytes”, beandip.
dummie a megabase is roughly equivalent to a megabyte. look it up dummie.
jobby · 1 October 2008
NS is not the driving force that adds info??
No, beandip, it isn’t.
.... so one celled animals could have evolved into humans without NS???
that is one of the stupidest things i have heard
hahahah bwahahah!
eric · 1 October 2008
Robin · 1 October 2008
PvM · 1 October 2008
phantomreader42 · 1 October 2008
Robin · 1 October 2008
phantomreader42 · 1 October 2008
jobby · 1 October 2008
Once again, you are wrong beandip.
... dummie: what was i wrong about??
PvM · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
phantomreader42 · 1 October 2008
David Stanton · 1 October 2008
So let's review shall we? So far the troll of many names has claimed that proteins are "merely bricks" and that one mega base is the same as one megabyte. Is it any wonder that no one will take it seriously when it tries to argue about human development?
Now I propose an experiment. Let's try to determine the information content in the 10 megabytes of garbage that it has spewed all over this thread. That shouldn't be so hard considering the highly repetitive nature of it's ranting.
Closing in on 1000. Yea.
Robin · 1 October 2008
Paul Burnett · 1 October 2008
jobby · 1 October 2008
Can natural selection add information to the genome??
Yes, once variation exists, the process is all but inevitable
.... information has been added gradually since millions of years ago so that what was a reptile eventually became a human?
jobby · 1 October 2008
Megabase is a length. It has nothing to do with storage, beandip.
... dummie. are you saying that 2 Megabases have the same info storage as 1 megabase??
jobby · 1 October 2008
jobby · 1 October 2008
Information copying or transmission via complementary base-pairing.
.... and it does not store info???
jobby · 1 October 2008
What I am showing here is how nails not only show a fascinating example of evolution, but also show how the genes involved are reused. In other words, your guestimates of information content, which are based on ‘storage requirements’ are flawed since they fail to incorporate 1. multiple splicing 2. multiple re-use of the same protein pathways.
.... when a human sperm unites with a human egg how does that cell know to become a human??
Stanton · 1 October 2008
Stanton · 1 October 2008
jobby · 1 October 2008
.… when a human sperm unites with a human egg how does that cell know to become a human??
Have you ever tried reading a biology textbook to find out?
dummie: does that mean you do not have and answer??
jobby · 1 October 2008
You were the one who claimed that the information contained within the genome is insufficient, and you have not presented evidence to support this claim, and you have not explained how genomic information is insufficient.
... you have not provided evidence to support YOUR claim either.
Dan · 1 October 2008
jobby · 1 October 2008
You know I am talking about experimental proof in journals.
As a matter of fact, no, I’m not a mind reader. I don’t know what you mean, I only know what you say.
I answered the question you asked. If you intended to ask a different question, you should have asked that one instead.
... then you have not been following the thread
PvM · 1 October 2008
PvM · 1 October 2008
Stanton · 1 October 2008
Stanton · 1 October 2008
jobby · 1 October 2008
jobby · 1 October 2008
wad of id · 1 October 2008
yup, i'm convinced. jobby said it, therefore it must be true.
ROFL
Stanton · 1 October 2008
Stanton · 1 October 2008
jobby · 1 October 2008
Then how come you are unwilling to provide evidence that the genome is somehow insufficient for the growth and development of the (human) body?
....Then how come you are unwilling to provide evidence that the genome is somehow sufficient for the growth and development of the (human) body?
Stanton · 1 October 2008
jobby · 1 October 2008
We have already presented you with lots of evidence, but, you have consistently ignored all of them.
...Bull! show me one piece of evidence
jobby · 1 October 2008
If you really had evidence that the genome is truly sufficient for storing the information needed for the growth and development of the (human) body, you should have been able to have presented this evidence over 800 comments ago.
PvM · 1 October 2008
Stanton · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
Stanton · 1 October 2008
jobby · 1 October 2008
Nope, that’s what i was attempting to walk you through. Perhaps your argument is that science has not all the answers but there is surely no evidence that DNA is not sufficient to explain the fetus.
Simple fact.
.... but there is surely no evidence that DNA IS sufficient to explain the fetus.
jobby · 1 October 2008
The latter assertion is disproven by the facts that indeed such evidence was provided and understandably ignored
... sorry wrong.
PvM · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
PvM · 1 October 2008
jobby · 1 October 2008
A better statement is that reptiles and humans share common ancestor not reptiles became humans.
... are you saying reptiles are not ancestors of humans??
jobby · 1 October 2008
If you deny that we have not, then there is little hope for you, however anyone reading this thread can read and observe that such information was shared with you.
.... if you think the unrelated cut and pastes you presented were proof that the DNA has sufficient info there is very, very little hope for YOU
PvM · 1 October 2008
PvM · 1 October 2008
fnxtr · 1 October 2008
You know, there's a much simpler solution to the puzzle of why Yobbo acts the way he does: he's crazy. Just plain nuts. Unhinged. Fits all the facts.
Adjusted your tinfoil hat lately, Yobbo? After all the aliens who created you can surely read your mind if you don't keep changing the jamming frequency.
tresmal · 1 October 2008
Henry J · 1 October 2008
tresmal · 1 October 2008
PvM · 1 October 2008
Stanton · 1 October 2008
Stanton · 1 October 2008
Theory," though he claims that he isn't an Intelligent Design proponent.Wayne Francis · 1 October 2008
Paul Burnett · 1 October 2008
Stanton · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
Paul Burnett · 1 October 2008
Stanton · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
Paul Burnett · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
David Stanton · 1 October 2008
Wow, 1000 posts. WOW. And not one of them on the topic of the thread. WOW, JUST WOW. Still no sign of any evidence from hand jobby, not even an example of one protein to support it's silly claims.
The answer to it's inane question is yes, 3 billion base pairs is plenty of information to direct the development of a human being, given the proper environment. Too bad it can't just admit this and grow up. I guess it sees little blue demons everywhere and wonders why the rest of us can't see them.
One last question for you hand jobby, are 5,000 genes enough to make a fruit fly? You can use all the bricks in your head to ponder that one. Don't take too many megabites.
Wayne Francis · 1 October 2008
Wayne Francis · 1 October 2008
Ok I'm now fully caught up from last night.
Do I get a prize for being the 1,000th poster? :P
Definition of insanity : doing the same thing over and over but expecting different results.
I would be insane if I thought I or anyone else could educate him because he does not want to be educated. I post here purely for the lurkers.
I think this whole thread has been on topic. Blow Jobby is totally "immune to evidence".
jobby · 2 October 2008
jobby · 2 October 2008
You have to define what you mean by “Information” before conclusion can be made.
.... read up on what 'information' is when used in science.
jobby · 2 October 2008
Blow Jobby is totally “immune to evidence”.
... how mature! A true scientist!
jobby · 2 October 2008
Oh - you’ve met jobby? Are his knuckles closer to the ground than normal humans?
.... shows the maturity level here.^^
jobby · 2 October 2008
You can read an article in Nature and read a similar sized article in the Inquirer. Which one do you think will have more information?
... according to information theory: about the same.
you really do not understand these things do you?
Wayne Francis · 2 October 2008
Wayne Francis · 2 October 2008
Wayne Francis · 2 October 2008
Dan · 2 October 2008
Wayne Francis · 2 October 2008
eric · 2 October 2008
jobby · 2 October 2008
Blow Jobby Jobby Jobby!!!
... how mature!
jobby · 2 October 2008
ike your you yelling in this post, isn’t that right Blow Jobby. I expect this type of responce from you and immature 5 year olds.
... show the maturity level here.
jobby · 2 October 2008
What has more “information” 10,000 pennies or a 100 dollar bill? What are you defining as “information” when I ask that question.
... are these posters retarded?
jobby · 2 October 2008
I feel sorry for serious young students who might to this site expecting adult conversation. And this site is highly rated. I really have not seen such bad behaviour since I taught junior high in the inner city. You should be ashamed of yourselves!
David Stanton · 2 October 2008
I completely agree hand jobby. Your behavior has been almost as bad as your grammar.
Stanton · 2 October 2008
Wayne Francis · 2 October 2008
Stanton · 2 October 2008
Wayne Francis · 2 October 2008
Stanton · 2 October 2008
Henry J · 2 October 2008
Henry J · 2 October 2008
fnxtr · 2 October 2008
Hey, Yobbo,
Did you know you can save hard drive space by converting all your text files to a smaller font? Less information, right?
jobby · 2 October 2008
jobby · 2 October 2008
jobby · 2 October 2008
One last question for you hand jobby, are 5,000 genes enough to make a fruit fly?
... the point is we cannot answer these questions based on what we 'believe' in. We need experimentation and data studies. Right now we cannot determine the answer to the above question. And to say as you want to to support your FAITH that it is enough it not science.
Henry J · 2 October 2008
I said nothing whatsoever about Hylonomus. A few minutes of googling, though, and it's fairly clear that Hylonomus is within the reptile clade, well after it separated from the line leading to mammals.
Henry
Stanton · 2 October 2008
jobby · 2 October 2008
PvM · 2 October 2008
Stanton · 2 October 2008
The fact that you have ignored all of the evidence we have presented to you does not make them go away, nor can it make up for the fact that you have not bothered presenting any form of support for your claims, nor can it somehow magically shift the burden of proof onto us.
So, then, why can't you present any evidence to support your claim that the genome is informationally insufficient?
PvM · 2 October 2008
I note that Bobby once again has given up supporting his claims and has resorted to spamming
He served his purpose well my friend.
Thanks Bobby.
PvM · 2 October 2008
PvM · 2 October 2008
Henry J · 2 October 2008
Henry J · 2 October 2008
Apparently Bobby and bobby are two entirely different people.
phantomreader42 · 2 October 2008
Henry J · 2 October 2008
I meant there's another poster who goes by "Bobby", so capitalizing "bobby" might cause others to not know which one you're talking about.
phantomreader42 · 2 October 2008
David Stanton · 2 October 2008
Got you hand jobby. We have sequenced the entire fruit fly genome and it is one of the most intensely studied developmental systems ever. We know in great and excrutiating detail exactly what proteins are coded, when and where the genes are expressed, what mechanisms control their expression, how they generate morphological features and how changes in the genes change the morphology. In two hundred years of intensive study that has been accomplished not one single example of any protein that is needed for fruit fly develoment has ever been found that is not coded in the fly genome. You have a lot of reading to do to catch up on all of this research.
There is plenty of evidence that about 5,000 genes are completely sufficient to make a fruit fly. There is absolutely no evidence whatsoever that any other information is required. If you believe that more information is needed than your belief is based solely on FAITH.
Bye bye troll.
jobby · 2 October 2008
how they generate morphological features
... they do not know how it generates the shape of the wing
jobby · 2 October 2008
The fact that you have ignored all of the evidence we have presented to you does not make them go away, nor can it make up for the fact that you have not bothered presenting any form of support for your claims, nor can it somehow magically shift the burden of proof onto us.
So, then, why can’t you present any evidence to support your claim that the genome is informationally insufficient?
.... why do you think you have no burden to prove your claims? do you feel your FAITH is enough?
PvM · 2 October 2008
Dale Husband · 2 October 2008
Perhaps bobby could explain to us why he thinks our support for evolution is based on faith. That seems like an odd assertion to me. Then again, almost everything he says is odd assertions. He lives in his own little world where science is religion, religion is science, and Big Brother rules all ("War is peace; Freedom is slavery; Ignorance is strength.")
David Stanton · 2 October 2008
Perhaps you can explain it to us.
jobby · 2 October 2008
David Stanton · 2 October 2008
For anyone who is really interested in drosophila wing development, a quick google search turns up 187,000 references. The very first hit contains the following references:
Aegerter-Wilmsen, T., Aegerter, C. M., Hafen, E. and Basler, K. (2007). Model for the regulation of size in the wing imaginal disc of Drosophila. Mech. Dev. 124(4): 318-26. PubMed citation: 17293093
Butler, M. J., et al. (2003). Discovery of genes with highly restricted expression patterns in the Drosophila wing disc using DNA oligonucleotide microarrays. Development 130: 659-670. 12505997
Campbell, G., Weaver, T. and Tomlinson, A. (1993). Axis specification in the developing Drosophila appendage: The role of wingless, decapentaplegtic and the homeobox gene aristaless. Cell 74: 1113-1123. 8104704
Cohen, B., Simcox, A.A. and Cohen, S.M. (1993). Allocation of the thoracic imaginal primordia in the Drosophila embryo. Development 117: 597-608. 8330530
Fuse, N., Hirose, S. and Hayashi, S. (1996). Determination of wing cell fate by the escargot and snail genes in Drosophila. Development 122: 1059-67
Kiger, J. A. Jr., Natzle, J. E., Kimbrell, D. A., Paddy, M. R., Kleinhesselink, K. and Green. M. M. (2007). Tissue remodeling during maturation of the Drosophila wing. Dev. Biol. 301(1): 178-91. Medline abstract: 16962574
Ren, N., Zhu, C., Lee, H. and Adler, P. N. (2005). Gene expression during Drosophila wing morphogenesis and differentiation. Genetics [Epub ahead of print]. 15998724
Sturtevant, M. A. and Bier, E. (1995). Analysis of the genetic hierarchy guiding wing vein development in Drosophila. Development 121: 785-801. 7720583
I know that hand jobby will be fascinated by these studies. I have FAITH that he will read all of these papers.
jobby · 2 October 2008
jobby · 2 October 2008
For anyone who is really interested in drosophila wing development, a quick google search turns up 187,000 references. The very first hit contains the following references:
... yes of course a lot is know but they do not know how the shape is formed.
PvM · 2 October 2008
Stanton · 2 October 2008
David Stanton · 2 October 2008
Hand Jobby wrote:
"… yes of course a lot is know but they do not know how the shape is formed."
Come now hand jobby, if you haven't read all of these papers, how could you possibly have any idea what is known and what is not known? More importantly, if you are completely ignorant of all of this research, why on earth should anyone care about your opinion?
Exactly how much evidence would be good enough to convince you? Remind me again, how much evidence do you have for your "hypothesis"?
Still gramatically challenged I see and still immune to evidence as well.
Henry J · 2 October 2008
tresmal · 2 October 2008
PvM · 2 October 2008
Dan · 2 October 2008
- Observe
- Form a hypothesis
- Make predictions
- Test those predictions
Careful observers of jobby's writing will note that, despite his avowed support of the scientific method, jobby has yet to do any of these things. At his most coherent, he has said that natural selection can be responsible for the observed facts of biology, but that there might be other, unknown and unnamed, phenomena that might also be responsible. This is trivially true. For example, Zeus could have created all living things, but Zeus created the things in such a way that they appear to have evolved. More frequently, however, he has used his own "method":PvM · 2 October 2008
David Stanton · 2 October 2008
The scientific method according to hand jobby:
Ask a question
Ignore all evidence
Insult the person who answered (using bad grammar)
Claim that the evidence was not sufficient (even though it did not look at it)
Ask the question again
Ignore all evidence again
Argue against it's original position
Claim that others don't understand when they point out the hypocricy
Quote mine responses
Accuse others of quote mining
Ask the same question again
Ignore all requests for evidence and ignore all evidence presented
Ask the same question again
Repeat for 1000 posts
Now you know why this turd has been banned on every other thread.
Dale Husband · 3 October 2008
DaveH · 3 October 2008
jobby · 3 October 2008
Perhaps bobby could explain to us why he thinks our support for evolution is based on faith.
... because you accept things as fact without proof.
jobby · 3 October 2008
emergence.
... explains many things but not complex inter-working parts as in the human body.
jobby · 3 October 2008
jobby · 3 October 2008
The scientific method as usually understood (http://en.wikipedia.org/wiki/Scientific_method) is
* Observe
* Form a hypothesis
* Make predictions
* Test those predictions
.... yes exactly. now show what predictions the following make and how they are tested:
1.the DNA has sufficient info to construct a human body
2. NS can change a simple body plan to a complex one.
Go for it!
jobby · 3 October 2008
Also the fear of accepting computer simulation
... well I would not call it fear but not science. computer simulations are not proof. read the literature. they are good to form hypotheses but testing has to be done in real life.
jobby · 3 October 2008
… they do not know how it generates the shape of the wing
I think I get it now. PvM (I think, I’m not trawling back through all these posts!) hit the nail on the head. jobbie simply does not get emergence.
.... you think the shape of a wing comes from 'emergence'??
better read that wiki article again!
jobby · 3 October 2008
Dan · 3 October 2008
jobby · 3 October 2008
This is a common misconception. The oldest and most precise science of all, astronomy, never performs an experiment, but only makes observations.
... no they do experiments. you have a misconception about what an experiment is.
wiki
The essence of an experiment is to introduce a change in a system (the independent variable) and to study the effect of this change (the dependent variable). Two fundamental considerations of experimental design are:
* That the independent variable is the only factor that varies systematically in the experiment; in other words, that the experiment is appropriately controlled - that confounding variables are eliminated; and
* That the dependent variable truly reflects the phenomenon under study (a question of validity) and that the variable can be measured accurately (i.e., that various types of experimental error, such as measurement error can be eliminated).
David Stanton · 3 October 2008
Hand jobby the worthless troll of many names wrote:
"no: scientific method means that hypotheses must be verified by experimentation."
So why won't you read any of the papers about those experiments? Why won't you admit that experiments have actaually been done by real scientists? Why won't you admit that we actually understand some things? Why won't you do any experiments to suppoert your "hypothesis"? Why do you use the methods I described if you know that that is not the way to understand anything? If you have so got a brain then why don't you use it?
Did you teach your students to do experiments? Did you teach your students to read the scientific literature? Since you have demoinstrated that you are incapable of doing so, the evidence makes it clear that you did not. More is the pity.
Still grammatically challenged I see and still immune to evidence . Man I hope it never taught english. That just ain't right.
fnxtr · 3 October 2008
fnxtr · 3 October 2008
... and still, after all this time, not once has Yobbo ever clearly stated "I think this happened, at this time, through this mechanism, and here's my evidence". Like a typical ID nutjob, he just dances around with bullshit like "I don't think evolution can do X".
Loser.
Stanton · 3 October 2008
jobby · 3 October 2008
… and still, after all this time, not once has fnxtr ever clearly stated “I think this happened, at this time, through this mechanism, and here’s my evidence”. Like a typical Darwinist nutjob, he just dances around with bullshit like “I think evolution can do X”.
Loser.
jobby · 3 October 2008
Then why do you refuse to provide evidence for your own claim of the genome being genetically insufficient? Do you honestly expect us to take your word on faith?
... I said the data is inconclusive on this point. Do you think the data is conclusive in supporting that the genome is sufficient? Can you show me that data??
jobby · 3 October 2008
So why won’t you read any of the papers about those experiments?
... show me just ONE!
jobby · 3 October 2008
Did you teach your students to read the scientific literature? Since you have demoinstrated that you are incapable of doing so
.. I have read much of the literature, have YOU?
... show me a good study that supports the positions I have asked about!
jobby · 3 October 2008
eric · 3 October 2008
Science Avenger · 3 October 2008
I can't believe you are all still at this. You might as well argue with a Furbie.
Ban this fucking idiot. It's not complicated. If you can't block his IP address, then just keep deleting his posts until he gets tired of intellectually masterbating. If you think that makes PT like UD, well sorry, you're an idiot too.
Henry J · 3 October 2008
Henry J · 3 October 2008
1089 replies and counting...
How long does it take to point out
1) the validity of a conclusion does not depend on being able to convince an amateur who decides to declare himself as judge of it.
2) a scientific principle isn't proven by an individual experiment, but is supported by determining where contradictory evidence should be (or have been) found if the principle is wrong, followed by failure to find that contradictory evidence.
Henry
Vaughn · 3 October 2008
tresmal · 3 October 2008
OK jobby: Consider a 300 base segment of non-coding, non-regulatory "junk" DNA, and a 300 base segment that codes for a 100 amino acid protein. Both require the same amount of disk space to be stored. Does that mean they have the same amount of "information"?
Science Avenger · 3 October 2008
David Stanton · 3 October 2008
Hand jobby wrote:
"… show me just ONE!"
I showed you six, each with a medline link. Did you read them? If you didn't, how do you know that they are not sufficient to answer your question? Do you subscribe to the Behe method? You said you understood the scientific method. If you don't read the papers then you are proven to be wrong again.
I certainly have no further reason to respond to any nonsense you care to write until you prove that you have read the papers I presented. Of course, you never have in the past, so I don't really expect you to now either. Then again, I don't really care what you do. I'm just happy that you are being kept off of other threads.
jobby · 3 October 2008
jobby · 3 October 2008
jobby · 3 October 2008
David Stanton · 3 October 2008
Hand jobby.
"… did you READ any of the six??"
jobby · 3 October 2008
jobby · 3 October 2008
jobby · 3 October 2008
...oberservers: note how the posters make fun other other peoples handles like addressing me as 'handy jobby' and 'blow jobby' I think this makes them look like awkward junior high boys. I have never seen true academics, scholars or scientists use this kind of language esp in a website trying to promote 'science' not 'beavis and butthead' I just picture B & B everytime they say 'hand jobby' etc.
they are very immature
tresmal · 3 October 2008
1) You derailed this thread with the claim that the human genome was 750 MB, and that this wasn't "enough information to construct a human". That 750 MB figure comes from the amount of disk space required to store the genome as an ASCII file. One major unspoken premise in your argument is that file size is somehow equivalent to "quantity of information".
2) If the coding DNA segment contains more information than the non-coding segment of the same size, then the 750 MB genome can contain more than 750 MB of "information", a lot more. Enough,in fact,to do all the things that you are incredulous about it doing.
jobby · 3 October 2008
That 750 MB figure comes from the amount of disk space required to store the genome as an ASCII file.
... wrong? where did you get that idea. do you even know what ascii is?
David Stanton · 3 October 2008
Sorry hand jobby. I didn't mean to offend you. It's just that, if you use made up names and different made up names, then everyone is going to make fun of them. If you were not such a coward and used your real name, or if you at least chose to obey the rules and used just one name, then maybe people wouldn't make fun of you. Otherwise you are being disrespectful in your dealings with people here so you can't really expect them to treat you with respect now can you?
As for your request, I recommend that you start with the Ren et. al. paper:
Genetics (2005) 171(2):625-38
However, this is just one of over a million papers on this topic, If you expect to find all of the answers in just one paper then you are just fooling yourself. That is why you must become an expert in a field and become familiar with the literature before anyone is going to take any of your unsubstantiated claims seriously.
Here, I'll help to get you started. From the abstract of the paper:
The simple cellular composition and array of distally pointing hairs has made the Drosophila wing a favored system for studying planar polarity and the coordination of cellular and tissue level morphogenesis. We carried out a gene expression screen to identify candidate genes that functioned in wing and wing hair morphogenesis. Pupal wing RNA was isolated from tissue prior to, during, and after hair growth and used to probe Affymetrix Drosophila gene chips. We identified 435 genes whose expression changed at least fivefold during this period and 1335 whose expression changed at least twofold. As a functional validation we chose 10 genes where genetic reagents existed but where there was little or no evidence for a wing phenotype. New phenotypes were found for 9 of these genes, providing functional validation for the collection of identified genes. Among the phenotypes seen were a delay in hair initiation, defects in hair maturation, defects in cuticle formation and pigmentation, and abnormal wing hair polarity. The collection of identified genes should be a valuable data set for future studies on hair and bristle morphogenesis, cuticle synthesis, and planar polarity.
tresmal · 3 October 2008
Jobby said:"… wrong? where did you get that idea?"
Here:
Science Avenger · 3 October 2008
BAN IT!
Science Avenger · 3 October 2008
I actually make it a personal policy to not alter people's names, even the obnoxious ones. I don't use IDiot, GOoPers, or call him Dumbski. It is juvenile on some levels, not on others.
I call this idiot handjobby because his entire approach is one giant case of mental masterbation. He's not having dialogue. You could swap his reponses around and not even notice, there is so little content, so little evidence that he even read what he responds to. Dialogue requires substantive responses, and consistent application of rhetorical rules, in response to what the other person is saying. The only rule he follows is "never accept the burdon of proof".
That's not dialogue, that's mental masterbation, and that's why he'll always be handjobby to me, regardless of what he goes by next week.
Stanton · 3 October 2008
tresmal · 3 October 2008
1) He is apparently posting from a library somewhere which presents difficulties to a site that wishes to ban him.
2) While he has turned this into the "jobby thread", he has left other threads on this site pretty much unmolested by his unthought.
3) People who argue with him with some idea of persuading him or just getting him to understand other viewpoints are going to be frustrated, because that is, of course, impossible. On the other hand, if you see him as an automated unthinking sparring partner your experience will be different. I don't argue with him to get through to him, I do it to sharpen and improve my own thinking and skills.
4) Some people like beating their heads against a wall. :)
5) This is obviously very important to him. As an act of simple human kindness, let him have this one thread.
btw: I agree with you on the fun with names business.
David Stanton · 3 October 2008
Here is an oldy but a goody:
Williams, Bell and Carroll (1991) Control of Drosophila wing and haltere development by the nuclear vestigial gene product. Genes and Development 5:2481-2495.
After you are done reading the first eight papers I recommended you can move on to this one. I'm sure you will find a paper that convinces you that someone understands fruti fly development eventually.
By the way, I warned you guys that this troll would argue both sides of an argument. Apparently it doesn't think that anyone will notice when it conradicts itself.
Alan Kellogg · 3 October 2008
Lying Troll,
DNA does not encode the whole thing, DNA encodes the instructions for building the structure, and the instructions for when the construction instructions will be carried out. Much like the plans for a building, which allow the erection of a structure much larger than one would think possible. The recipe for kiln fired bricks is a simple one, but with it you can make tons of kiln fired bricks.
Stanton · 3 October 2008
Wayne Francis · 3 October 2008
Wayne Francis · 3 October 2008
Actually...My above post is technically wrong. The human genome can be represented in 750Mb of ASCII so Jobby is wrong. It jus isn't represented as a string of "A" "C" "G" "T" but it still can be represented as ASCII
Stanton · 3 October 2008
jobby/bobby/jacob/balanced/hamstrung/goffTroll to look back at a previous post is tantamount to asking him to lay a golden egg that will hatch out into Diana Ross II. In fact, it would be far easier to askjobby/bobby/jacob/balanced/hamstrung/goffTroll to lay a golden egg that will hatch out into Diana Ross II than to have him look at a previous post.DaveH · 4 October 2008
It was simply beyond irony that I turned from reading jobbie's demands for a single paper showing that the last 60 years of research into genetics wasn't based on a false premise, to this obituary yesterday.
http://www.guardian.co.uk/science/2008/oct/03/genetics.universityofsheffield
The troll honestly believes that it is more insightful and has greater knowledge than John Thoday.
dobby · 4 October 2008
jobby · 4 October 2008
'That 750 MB figure comes from the amount of disk space required to store the genome as an ASCII file'
... this is the statement I say was incorrect. Any neutral observer can see how the opposition here squirms to backtrack their ignorances.
jobby · 4 October 2008
What keeps happening here over and over is ask for studies backing up their claims. The 2 now is the 750 MB one and the NS one. Then they google for studies using key words and those areas and the presenting me with a list of studies that have the key words and then saying: here is your proof.
The problem is that those studies although in the right general direction really do not answer the question I asked.
The opposition needs to state in their own words how those studies back up their positions.
I have never seen them do that.
DaveH · 4 October 2008
David Stanton · 4 October 2008
Hand jobby wrote:
"The problem is that those studies although in the right general direction really do not answer the question I asked. The opposition needs to state in their own words how those studies back up their positions. I have never seen them do that."
Once again hand jobby, you have shown no evidence whatsoever that you have even attempted to actually read the paper, even though I supplied you with the entire abstract. You said you would read it. You said you wanted to discuss it. Well...? I told you that the answer would not be contained completely in one paper. But, if you won't read even one paper then how will you ever know if the answer is there or not?
OK, in my own words. The papers show that cascades of gene expression are sufficient to produce the wing of a fruit fly. The references I cited come from a web site that describes most of the important proceeees involved:
http://www.sdbonline.org/fly/aimorph/wing.htm
The site lists over 200 proteins that are involved in wing morphogenesis and describes in detail how their expression is regulated. The point is that every one of the proteins is coded for in the fly genome and is regulated by other genes in the fly genome. There is no need for any other information at all, period. And before you start ranting that there would not be enough genes to make the rest of the fly, you must understand that many of these genes are also important in producing other structures as well. You see Bobby, (if that is your real name), proteins are not "merely bricks". They also regualte developmental pathways and catalyze chemical reactions. If you knew anything at all about biology you would understand this basic concept.
Now you worthless sack of crap, one last time just to be fair, do you have any evidence that more information is required or not? If not, then demanding it of others is simply insane. Read the papers or not, no one really cares. But you can't claim that there is not evidence just because you are too stubborn to look at it or too stupid to understand it.
When you are done whining about development, there is a stack of papers on the evolution of the immune system that you really should read. That was the original topic of this thread, 1200 comments ago.
jobby · 4 October 2008
Error: Either 'id' or 'blog_id' must be specified.
jobby · 4 October 2008
Now you worthless sack of crap, one last time just to be fair, do you have any evidence that more information is required or not? If not, then demanding it of others is simply insane.
... I never said I had evidence. My point is that the data on this is inconclusive. It might have enough or it might not. From my observations and a priori reasonings I would say not. But I never claimed I know of a study that says either way.
Now you believe it does have enough info which is OK. But please do not say there is a fact unless you can come up with evidence.
David Stanton · 4 October 2008
Hand jobby wrote:
"How many bytes do you think it would take to store all those genes??"
Don't know, don't care. Why don't you tell us? How may gallons of ice cream would it take? I can tell you exactly where each gene is located in the fly genome. If you want to know how the shape of the wing is produced you will have to read the papers. Do a little research please.
Thanks for admitting that you have no evidence. I guess your conclusion is based on FAITH. Well I had faith that you would read the paper. I have lost my faith because of you. Until you produce some evidence, no one else has any burden of proof, especially since no one cares what you think.
Now you claimed that all of this nonsense somehow disproved "Darwinism". Sorry, wrong again. Of course I have faith that you don't have any evidence for that either.
Science Avenger · 4 October 2008
I have faith that this idiocy can continue for another 30 pages.
jobby · 4 October 2008
Hand jobby wrote:
“How many bytes do you think it would take to store all those genes??”
Don’t know, don’t care..
... you should care, It is essential to the theory.
jobby · 4 October 2008
jobby · 4 October 2008
Thanks for admitting that you have no evidence. I guess your conclusion is based on FAITH.
... I have said that I am not sure. I have a best guess but that is it. But YOU are certain without evidence. That is FAITH.
jobby · 4 October 2008
If you want to know how the shape of the wing is produced you will have to read the papers.
... I am not going to read 20 papers to search for evidence which I feel is not there. Why dont YOU cut and paste the pertinent paragraphs. You are familiar with these studies arent you. See I think you are bluffing. I you had read them you would paste the verbage right here:
jobby · 4 October 2008
Now you claimed that all of this nonsense somehow disproved “Darwinism”.
... again I am saying there is insufficient data. Darwinism and ID at this point cannot be proven or disproven. That is my assessment.
David Stanton · 4 October 2008
I weary of your stupidity. One last time
Cascades of gene expression establish morphogenic fields that determine cell fates and thus wing shape. This is the exactly same way that every structure in biology is formed. I provided you with a list of over 200 proteins that are required for wing development you cannot find one that isn't coded for in the fly genome. YOU LOSE PERIOD - END OF STORY - PISS OFF YOU WICKED LOSER.
You refuse to read the papers because you don't feel the answer will be there. The point is that unless you read the papers you will never know. That is your problem, You are not an expert, you won't listen to experts and you don't want ot learn anything at all. All you want to do is stand on the side lines and cry that you can't play. Fine with me, wallow in ignorance.
And no one cares if you think that there is enough evidence for "Darwinism" either. You have not provided even the faintest hint of any reason why any of this has anything to do with "Darwinism". Go masturbate somewhere else. That library chair must be getting pretty sticky.
jobby · 4 October 2008
Cascades of gene expression establish morphogenic fields that determine cell fates and thus wing shape.
... show me the study!
jobby · 4 October 2008
You refuse to read the papers because you don’t feel the answer will be there.
... well show everyone how wrong I am. paste the name of the article and the paragraphs here. I do not think you read ANY of these articles.
jobby · 4 October 2008
Go masturbate somewhere else. That library chair must be getting pretty sticky.
... this ^^ really should be deleted. What a gutter mind. Hope kids are not reading this vulgar site.
jobby · 4 October 2008
Go masturbate somewhere else. That library chair must be getting pretty sticky.
... are you a college instructor. I am telling you right now to stop this or else I will take serious action. There might be a Dave Stanton whom you are libeling. You sound like a pedophile.
David Stanton · 4 October 2008
You can't dictate anything to me bobby boy. I can write whatever I want.
As for your opinion, my opinion is that your opinion is worthless. Anyone who thinks that proteins are "merely bricks" really can't be taken seriously.
Since you spend so much time in the library you should be able to get off that chair and read one paper. I even copied the abstract for you. You said that you wanted to discuss the paper and you didn't. You lied once again.
I will never respond to anything else you write under this or any other name. You have proven that you just aren't worth the effort. You are truly a waste of protoplasm.
jobby · 4 October 2008
David Stanton · 4 October 2008
To any lurkers,
I accused it of mental masturbation and getting the chair sticky with it's drool. What other interpretation could there be?
Notice that bobby has accused me of being a pedophile. No that is libel folks. I demand that the moderator take steps to find the real identy of this person so that legal proceedings can be initiated.
David Stanton · 4 October 2008
It turns out that there is a real Dr. Stanton in Saginaw. I have contacted him and apologized for dragging his name into this. He has assured me that any libelous or slanderous statments will be dealt with in the appropriate manner. I have promised him that I will change my handle. If the moderators feel that this is inappropriate then they can ban me.
Meanwhile, I will keep my promise to not respond to bobby, jobby, jacod, observer, goff, etc. etc. I suggest that everyone else follow this example.
PvM · 4 October 2008
PvM · 4 October 2008
jobby · 4 October 2008
jobby · 4 October 2008
Stanton · 4 October 2008
PvM · 4 October 2008
Stanton · 4 October 2008
Stanton · 4 October 2008
jobby · 4 October 2008
tresmal · 4 October 2008
This is how jobby gets out of a corner.
PvM · 4 October 2008
Stanton · 4 October 2008
PvM · 4 October 2008
Stanton · 4 October 2008
bobbyIdiot does not profess to be a supporter of Intelligent DesignTheory, instead claiming that "insufficient data exists to support either ID or Darwinism (sic)" In other words, he's a fence-sitting troll who's too lazy and mean-spirited to make up his mind.jobby · 4 October 2008
You forget that bobbyIdiot does not profess to be a supporter of Intelligent Design Theory, instead claiming that “insufficient data exists to support either ID or Darwinism (sic)”
In other words, he’s a fence-sitting troll who’s too lazy and mean-spirited to make up his mind.
... well I have looked at the evidence objectively and have found insufficient for either side. According to you one HAS to choose a side? Sound very political to me!
... DS, I see you have stopped the porn.
jobby · 4 October 2008
tresmal · 4 October 2008
Stanton · 4 October 2008
AlphaOmegA · 4 October 2008
Jobby
Provided you are representing yourself and your views accurately here (which is far from obvious), it would be instructive and enlightening if you could disclose any allegiances/sympathies you might have to dualism, supernaturalism in general, or what most people would call "paranormal" or "pseudoscientific" phenomena/disciplines. Also instructive would be what, if any, religious or "spiritual" upbringing you had. This is completely void of malicious intent. I just want to know what forces shaped your current views into what they are today. If none of factors are present I am even more intrigued. Do any of the concepts involved in discussing evolution provoke an emotional response in you? Revulsion? Disgust?
Finally I am interested in what makes you doubt the well-confirmed expert explanation of biodiversity on this planet. Your suggestion that no evidence has been provided is ludicrous. Do you think that the vast reservoir of theoretical and applied research represented in peer-reviewed journals is just lots of blank paper? Do you think that millions of brilliant people who stand to become famous (and possibly very rich) by proving the scientific consensus radically wrong fail to do so because they aren't as brilliant as you? They fail because the scientific method is truth-tracking and the scientific community has mastered its application, even building in safeguards like peer review to stamp out researchers' honest (and dishonest) mistakes. Successful ideas in science remain because they have survived the INTENSE scrutiny of the world's best minds. There is no conspiracy and there is no "faith", just a ton of hard-working people who are trying to unravel the mysteries of the universe.
If you aren't satisfied with that, hit the books and learn modern biology for yourself (these people have suffered enough). When you post two minutes after another person links one (or several) complex scientific article/s or makes a complex argument and claim that it doesn't provide evidence for their position it is clear that you did not read, much less absorb, anything.
By the way, your use of the word "Darwinism" is hopelessly inaccurate and will make scientifically literate people assume you are in the camp of people who don't understand what Darwin said and more importantly DID NOT say. Don't do it if you want any kind of credibility.
Cordially yours,
AlphaOmegA
P.S. Hi Panda People
Stanton · 4 October 2008
tresmal · 4 October 2008
Stanton · 4 October 2008
bobbyLying Sack is pretending that there is insufficient evidence for Evolutionary Biology, that, and he doesn't appear to realize that there is a difference between evidence and "burden of proof."PvM · 4 October 2008
PvM · 4 October 2008
tresmal · 4 October 2008
*from Ren and Stimpy.
Science Avenger · 4 October 2008
Dale Husband · 4 October 2008
This is like a comedy club, and here's the joke:
jobby: "Show me the evidence for evolution."
science fan: "Here you go: [Link]"
jobby: "That is not sufficient. Give me MORE evidence."
science fan: "Here's some more: [Link]"
jobby: "That is not specific enough. What about this problem? [non-issue]."
science fan: "What problem? That doesn't disprove evolution at all."
jobby: "I say it does, and it is up to YOU to prove me wrong!"
science fan: "Read this, [Link]."
jobby: "That's just one man's word. How about more proof?"
science fan: "One man's word should be enough if he is right."
jobby: "You never proved him right!"
science fan: "Why are you acting so stupid?"
jobby: "PERSONAL ATTACK! You lose! This site is worthless! [More insults, lies and personal attacks]"
Look, we ALL know that jobby is a patholigical liar and bigot and it's been proven here over and over. What more damage can we do to him that's been done?
Dale Husband · 4 October 2008
Dale Husband · 4 October 2008
SWT · 4 October 2008
PvM · 4 October 2008
Stanton · 4 October 2008
jobby · 5 October 2008
Provided you are representing yourself and your views accurately here (which is far from obvious), it would be instructive and enlightening if you could disclose any allegiances/sympathies you might have to dualism, supernaturalism in general, or what most people would call “paranormal” or “pseudoscientific” phenomena/disciplines.
... willing to do that if my opposition and YOU are willing to do so
Also instructive would be what, if any, religious or “spiritual” upbringing you had.
... willing to do that if my opposition and YOU are willing to do so
This is completely void of malicious intent. I just want to know what forces shaped your current views into what they are today. If none of factors are present I am even more intrigued. Do any of the concepts involved in discussing evolution provoke an emotional response in you? Revulsion? Disgust?
Do any of the concepts involved in discussing evolution provoke an emotional response in you? Revulsion? Disgust?
... evolution has been proven.it happens everyday. it is useful. I have no problem with it.
Finally I am interested in what makes you doubt the well-confirmed expert explanation of biodiversity on this planet.
... I am not doubting 98% of the explanation
Your suggestion that no evidence has been provided is ludicrous.
... I have asked over and over for this elusive evidenc but my oppostion refuses to present it.
Do you think that the vast reservoir of theoretical and applied research represented in peer-reviewed journals is just lots of blank paper?
... Of course not!
Do you think that millions of brilliant people who stand to become famous (and possibly very rich) by proving the scientific consensus radically wrong fail to do so because they aren’t as brilliant as you?
... No one can prove the scientific consensus radically wrong.
They fail because the scientific method is truth-tracking and the scientific community has mastered its application, even building in safeguards like peer review to stamp out researchers’ honest (and dishonest) mistakes.
... politics is an important factor here that you are ignoring.
Successful ideas in science remain because they have survived the INTENSE scrutiny of the world’s best minds.
... many misconceptions have survived that 'INTENSE scrutiny' for decades.
There is no conspiracy and there is no “faith”, just a ton of hard-working people who are trying to unravel the mysteries of the universe.
... believing something without evidence = FAITH, sorry.
If you aren’t satisfied with that, hit the books and learn modern biology for yourself (these people have suffered enough).
... I know bio quite well. I think my opposition needs to study it a bit more
When you post two minutes after another person links one (or several) complex scientific article/s or makes a complex argument and claim that it doesn’t provide evidence for their position it is clear that you did not read, much less absorb, anything.
...I said that many of these studies I did not read because I do not believe my opposition has read them. I asked that they tell in their own words why these studies support their position and they have rarely if ever responded. I am familiar with many of these studies and have researched them quite a bit. A few of the studies that I have been referred to that I have read simply do not address the issues we are debating. I think my opposition simply googles key words and gets lists of studies. I have examine the abstracts and they do not address this issues of the debate.
By the way, your use of the word “Darwinism” is hopelessly inaccurate and will make scientifically literate people assume you are in the camp of people who don’t understand what Darwin said and more importantly DID NOT say.
... Dawkins, Gould and many other mainstream biologists use the term Darwnism. If you can give me another term to use I will use it. We can call it X theory if that makes you feel better. However many here are equating evolution with Darwinism and they are not the same thing. My opposition refuses to define terms and use well defined terms in these debates. What term would you like to use to refer to the theory that humans came from one-celled animals mainly thru natural selection. We can call that X theory if you have a problem with the commonly used term: Darwinism.
Don’t do it if you want any kind of credibility.
Cordially yours, AlphaOmegA
P.S. Hi Panda People
jobby · 5 October 2008
Oh, the experiments have already been done, many, many times, and have shown that such complexities can arise under the right conditions. Why? Because there is no known limit to how large and complex organic molecules can grow. NONE!
.... again SHOW me those experiments.
jobby · 5 October 2008
Can any of my opposition just pick out ONE study they have READ and lets go over it. That cant be that difficult. See I think they are just googling key words and coming up with a list. I have looked at the abstracts to some of the studies they have referred me to and found that tho the studies contained the key words they did not contain data or info that backed up their points.
So pick one, read it, explain in YOUR OWN WORDS how it supports your position and then I will read it and give you my response.
SWT · 5 October 2008
PvM · 5 October 2008
PvM · 5 October 2008
And when you are done, I will share with you a paper A.. C, O... C, C... TC (2000). "XXXXXXXX". PNAS on how science looks at the issue of evolution, complexity and such.
Cheers my science avoiding friend
Dale Husband · 5 October 2008
Dale Husband · 5 October 2008
My point, of course, is that jobby knew from the very beginning that he lacked even the most basic science education to tackle the serious issues stated in technical science papers, let alone conduct his own experiments to actually do science on his own, but wanted to challenge us anyway. That's like a five pound monkey taking on an 800 pound gorilla. No contest. But jobby keeps plugging away, refusing to admit he has no case and was already defeated, and thus proving more and more his idiocy. Indeed, his behavior is the very definition of idiocy!
jobby · 5 October 2008
We give you links to the papers, you read them, YOU show us they are not sufficient to prove our case.
...OK give me a link that to a study YOU have read. I do not see why I should read one you have not.
jobby · 5 October 2008
I think it is pretty obvious what is going on here. My opposition has NOT read any of these studies. I am not going to read dozens of studies looking for the elusive data when they could simple pick one and explain in their own words why the study supports their point and paste some of the paragraphs.
Well it AINT gonna happen. Its a huge bluff!
PvM · 5 October 2008
PvM · 5 October 2008
jobby · 5 October 2008
That’s a poor standard. Are you saying that you only read papers that would alleviate your ignorance if you believe your opponents have read them.
Figures
... I AM NOT going to read 20 papers and search them for the supposed proof that lies in them when my opposition will not even read ONE! its pretty obvious this is a bluff.
jobby · 5 October 2008
Again Jobby is blaming his opponents for his failure to read the papers.
... have YOU read any of the papers??
PvM · 5 October 2008
PvM · 5 October 2008
Stanton · 5 October 2008
Dale Husband · 5 October 2008
Dale Husband · 5 October 2008
PvM, could we have a list of the links to all the many papers presented to jobby that he has persistently ignored to further damage his credibility? It helps to have all the evidence in one place. Perhaps in the next Panda's Thumb post?
Dale Husband · 5 October 2008
tresmal · 5 October 2008
As far as reading a paper and rewriting it in our own words; that's just stupid.
1) And then you'll read it!?You mean you want us to translate it for you so you won't have to read it. Sorry but no.
2) If you want to verify whether or not someone has read a paper, the best way is to discuss it. If someone can talk intelligently and knowledgeably about it (which would be off the charts surprising in your case) then that person has read and understood it.
3) If someone was fool enough to comply with your unscientific request for a plain English translation, you would seize that as an excuse not to read the paper and would try to argue about the simplified paraphrasing instead of the precise, technical and carefully measured language of the paper. I don't think anyone here is dumb enough to fall for that.
Dale Husband · 5 October 2008
jobby · 6 October 2008
jobby · 6 October 2008
You have failed to make a positive impression on us, and that’s the first thing you must do to win us over your your point of view.
... I am sure your FAITH in Darwinism will never change no matter how cogent the argument or how overwhelming the data. I am here mainly in case some young people are reading this so they will not think that Darwinism has really been proven and hopefully their minds will be free to explore options.
jobby · 6 October 2008
f you let your ignorance be driven by your perception of the ignorance of others, then I am not surprised that you have shown little interest so far.
... well then just pick one of the studies, READ IT!, and lets discuss it.
...HAVE YOU READ ANY OF THOSE STUDIES??
SWT · 6 October 2008
PvM · 6 October 2008
jobby · 6 October 2008
PvM · 6 October 2008
PvM · 6 October 2008
Henry J · 6 October 2008
I wonder if somebody should point out that it's more important for the one arguing against the consensus to read the papers, than for the ones who figure experts know their subject better than amateurs who declare themselves to be the arbiters?
Henry
jobby · 6 October 2008
…HAVE YOU READ ANY OF THOSE STUDIES??
Robin · 6 October 2008
PvM · 6 October 2008
jobby · 6 October 2008
Time for a recap:
There are no studies that show that 750 MBytes which seems to be about the amont of info in the DNA is enough to construct a human body
and
there are no studies that validate that NS is capable of causing complex body plans to evolve from simpler ones.
If anyone knows of studies that show any of the above please lets talk about them.
PvM · 6 October 2008
Wayne Francis · 6 October 2008
jobby · 6 October 2008
That the independent variable is the only factor that varies systematically in the experiment; in other words, that the experiment is appropriately controlled
... well of course they cannot push planets around but the point is that the indpendent variable 'varies' and this can be accomplished by measuring the dependent variable when the independent one varies by natural means.
OK now show me the experiments in Darwinism where the independent variable changed and how the dependent variable was measured and you will have a true scientific experiment but unfortunately these do not exist. if you know of one please present it so the 'lurkers' will be enlightened.
tresmal · 6 October 2008
jobby · 6 October 2008
To give you an analogy; there is no evidence or reason to believe that a supersecret advanced civilization exists under the Antarctic icecap. But nobody has done any “studies” to prove that there isn’t one.
... of course that is a horrible analogy. we have no reason to believe in this subcap civilization. however we do know that the DNA stores info. and we do no that there must be some minimum of instruction to contruct the human body. these are facts. there are no facts such as these to move us to suppose there is this civilization.
tresmal · 6 October 2008
Dan · 6 October 2008
PvM · 6 October 2008
Dan · 6 October 2008
PvM · 6 October 2008
Sure, as tresmal points out, Bobby could be correct but he provides us with no evidence to support his claims while science provides us with much evidence that places doubt on said claims. Can science disprove Bobby's negative? Unlikely, but it can reduce it to a meaningless assertion through hard work.
What does Bobby intend to do to support his claim? Nothing, and that is exactly why ID is doomed to remain similarly without scientific content
Wayne Francis · 6 October 2008
tresmal · 6 October 2008
I wish to propose for the reader's favourable consideration a doctrine which may, I fear, appear wildly paradoxical and subversive. The doctrine in question is this: that it is undesirable to believe a proposition when there is no ground whatever for supposing it true. I must of course admit that if such an opinion became common it would completely transform our social life and our political system; since both are at present faultless, this must weigh against it.
[Bertrand Russell, Sceptical Essays
emphasis mine. Just snagged this from Pharyngula's Random Quotes. Posted it here for no particular reason at all. Certainly has nothing to do with anything talked about on this thread, nope nothing at all.
Wayne Francis · 6 October 2008
Wayne Francis · 6 October 2008
Dale Husband · 6 October 2008
Wayne Francis · 6 October 2008
jobby · 7 October 2008
Dale Husband:
"DNA does not store information at all."
... even creationists would disagree with that ridiculous statement. Any other posters agree with Dale?
jobby · 7 October 2008
Wayne Francis:
'There are no facts, your personal incredulity doesn’t count, that the DNA doesn’t hold enough information to account for hereditary and that the known developmental processes can’t account for the development of any living being.'
Dale Husband:
'DNA does not store information at all.'
... well who is correct???
jobby · 7 October 2008
Well here we go: they say there is enough info in the DNA to construct a human if one asks: 'Are you sure? Can you prove it?'
We are told we are being 'incredulous'
definition: 'not disposed or willing to believe; unbelieving'
Jeez just a lack of FAITH again!
Stanton · 7 October 2008
jobby · 7 October 2008
That you accuse us of having blind faith for accepting proven and demonstrated science, while trying to convince us of your moronic claims without bothering to provide evidence demonstrates to us over and over again that you are nothing more than a pathetic, moronic hypocrite.
.... do you assert that it is fact that the DNA has enough information?
..... you disagree with the other poster that there is NO information in the DNA??
... is basically all you can to is name-call?
jobby · 7 October 2008
Whatever happened to Dave Stanton? Did he realize that posting toilet mouth comments on the internet could get him in trouble at his college?
DS · 7 October 2008
I do not respond to pedophiles.
Science Avenger · 7 October 2008
Do I hear 42 pages of garbage?
Dale Husband · 7 October 2008
Wayne Francis · 7 October 2008
Hand Jobby has once again ignored that which asked for and we provided.
He chooses to ignore the vast amounts of information known about the evolution of the eye and the genetic processes which both control for its developement and the pathways that where likely to have taken place to progress from a single light sensitive cell to very complex eyes.
Blow Jobby, you are a willfully ignorant liar. A bare, bald-faced, deceptive, deceitful, deliberate liar, with malice aforethought. as Dr Rev Lenny Flank might say.
yes the DNA has enough "information" to code (not computer code Blow Jobby) for hereditary traits within a species via, but not limited to, protein coding genes, regulatory genes. You will not find 1 paper addressing the the full development of a human just like you will not find a paper covering the full history of the universe. Saying DNA isn't enough is just as stupid as saying all the elements above lithium can't be accounted for by stellar processes and there must be some other mechanism needed. This despite the fact that all the evidence we have that points to stellar processes being responsible for forming all the natural elements.
You can yell about some invisible pink unicorn making heavy elements just as much as you can for development of features. No one that understands science will listen to you until you step up...fat chance of that happening. Now avoid the video, article and papers I pointed you. you are a troll and it is clear for all to see that you are a willfully ignorant lying troll.
Dale Husband · 7 October 2008
Watch what happens next: Jobby will go into a frenzy about me not making any sense. Of course, that assumes that common sense, or conventional wisdom, is always right. But that is not necesarily the case. Think about it: If you have a 350 page book on biology that no one ever reads, can you really say there it has information about biology in it? Why? What use is something that no one ever reads? DNA, books and computer programs can PRODUCE information when they are read, but they themselves MUST be read for that information. If you have a book written in Chinese and you read only English, is that book of any use to you? Do you get any information from it? Of course not!
PvM · 7 October 2008
Dale, your use of the term information is troubling.
A common way to look at information is the reduction in Shannon entropy and DNA as such can be shown to contain 'information'. Typically information describes the redundancy, so for instance if a particular gene across many members of the same species contains the same basepairs, it can be shown to contain the max possible information in Shannon sense, of 2 bits per nucleotide.
The problem is to extend the information content to a similar concept in the human body. For that one has to show how much information is contained in the human body, using a similar measure.
As to DNA being insufficient to explain the development of an embryo, there is no evidence supporting this notion and in fact much of embryological research has shown the contrary.
It seems however that not only is jobby unwilling to familiarize himself with the science involved, but he is using his ignorance as an argument in favor of his position.
Such is the scientific vacuity of ID and jobby is a useful example.
Wayne Francis · 7 October 2008
Dale Husband · 7 October 2008
Dale Husband · 7 October 2008
Robin · 7 October 2008
PvM · 7 October 2008
jobby · 7 October 2008
Think about it: If you have a 350 page book on biology that no one ever reads, can you really say there it has information about biology in it? Why? What use is something that no one ever reads?
.... so you are saying if humans did not exist DNA would not contain any info??
Henry J · 7 October 2008
With 42 pages, you'd think this thread would have the answer to life, the universe, and everything...
PvM · 7 October 2008
tresmal · 7 October 2008
Wayne Francis · 7 October 2008
Dale Husband · 7 October 2008
Dale Husband · 7 October 2008
Wayne Francis · 7 October 2008
Dale Husband · 8 October 2008
Wayne Francis · 8 October 2008
Dale Husband · 8 October 2008
jobby · 8 October 2008
Going against the accepted dogma is fine IF you have evidence that the existing dogma is wrong. Hand Jobby’s evidence is his personal incredulity.
... exactly what is the 'dogma' you are referring to?
jobby · 8 October 2008
Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”.
... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.
Robin · 8 October 2008
DS · 8 October 2008
And so, as the last unmoderated thread sinks slowly into the sunset, we bid a not so fond farewell to the troll of many names. Segregated from decent society, it foolishly tries to convince others that willful ignorance is the key to happiness. It sits alone at a library computer terminal, desperately trying to suppress it's deviant sexual urges, all the while ignoring the volumes of books and journals around it. In a vain attempt to appear coherent, it substitutes insults, personal attacks and impotent threats as for evidence and logic.
Of course no sane person would be fooled by the nonsensical and unsubstantiated claims of this raving lunatic. It's lack of social skills and it's almost pathological reliance on poor grammar, coupled with it's inability to understand even a single scientific reference, are all the evidence that anyone requires in order to conclude that it's delusional approach to reality is as hopeless as it is misguided. I guess it's truncated genome just didn't have enough information to form a fully functional brain.
Thanks to Dale for the compilation.
Wayne Francis · 8 October 2008
Kevin B · 8 October 2008
Dale Husband · 8 October 2008
jobby · 8 October 2008
If you cannot read science papers that explain what you want to know, why are you here?
... it did not explain how the shapes are formed. Did YOU even read what you pasted here???
jobby · 8 October 2008
Your dogma that DNA can’t account for developmental process within an organism. You really aren’t very bright are you.
... never said it couldnt! Please read more carefully.
jobby · 8 October 2008
Well Dave Stanton, you are going to be in for some surprises soon!
jobby · 8 October 2008
Remind us again how ID explains these? Or Jobby? Or is his response going to be “I could not possibly imagine”.
... of course there are genes and mechanism that control the beginning and ending of growth processes but the mystery is how the actual shape is formed. You really need to dig a bit deeper.
Henry J · 8 October 2008
fnxtr · 8 October 2008
DS · 8 October 2008
More impotent threats from our mentally challenged troll.
Take a good look ladies and gentlemen, these are the depths of moral depravity to which one can stoop. Completely unable to provide any evidence for his ludicrous claims, the trool of many names proceeds to threaten in a vain attempt to deflect attention away from the fact that absolutely no one has been fooled by his foolish posturing. Completely unable to compete in the realm of science, or even understand a simple article, it lashes out with blind hatred and rage. What a pathetic waste.
There really must be some moderator somewhere who can put a stop to this nonsense once and for all. Ban this fool on every thread and we won't have to put up with it's delusional crap ever again.
Dale Husband · 8 October 2008
PvM · 8 October 2008
jobby · 8 October 2008
PvM · 8 October 2008
PvM · 8 October 2008
PvM · 8 October 2008
And I would ask everyone to be discouraged from using verbal abuse and name calling on this thread since I find it distracting, demeaning and undermining the argument. Of course, as a mere participant on this thread, that's all I can do.
PvM · 8 October 2008
jobby · 8 October 2008
David Stanton · 8 October 2008
PvM,
If you think that it is appropriate for posters here to use libel, slander and personal threats, then perhaps you could tell us all the location of the library that the troll posts from.
I know that you don't approve of the tactics that this troll has been using. After all, you already banned it to the best of your ability. I will never respond to it again. Why anyone else would is beyond me.
PvM · 8 October 2008
PvM · 8 October 2008
DS · 8 October 2008
But what of Lazarus, what of Lazarus?
Dale Husband · 8 October 2008
Well, as long as jobby, or whatever name he cares to use, keeps giving non-answers to our questions and non-data in response to our data, he is no threat. I am quite satified with the outcome and will be moving on.
Goodbye, jobby.
Wayne Francis · 8 October 2008
Wayne Francis · 8 October 2008
tresmal · 8 October 2008
jobby · 9 October 2008
It explains just what you want to know. How known processes of biochemistry dictate the shape of bones.
.... did YOU read it? Sorry but at this time the method by which bones take certain shapes is unknown. Yes they do know what starts and stops the processes but not how the actual shape is formed. Go ahead READ about it.
jobby · 9 October 2008
Dan · 9 October 2008
Wayne Francis · 9 October 2008
jobby · 9 October 2008
What Blow Jobby? You keep asking how a bones know how to grow in the shapes they do. There is the book for you. Why don’t you want to read it? Because you’ll see how much of a ignorant ass you have been?
... what a good example you are for kids who might be reading this site! what a vulgar mind you have! have YOU read the book????????????
jobby · 9 October 2008
What Blow Jobby? You keep asking how a bones know how to grow in the shapes they do. There is the book for you. Why don’t you want to read it? Because you’ll see how much of a ignorant ass you have been?
.... are you saying this book explains how the shapes are formed and not just how the signaling works to start and end the formation process???
phantomreader42 · 9 October 2008
Henry J · 9 October 2008
Hey, now we're getting the "DNA is not sufficient" argument on another thread, from somebody who has a vocabulary.
Henry
Wayne Francis · 9 October 2008
tresmal · 9 October 2008
Wayne Francis for the win. Jobby that steaming charred piece of meat sitting on that silver platter in front of you is your own ass. Prepared and served for you by the friendly folks at The Panda's Thumb. You need to come up with a new raging non sequitur of an argument to dazzle us with.
jobby · 10 October 2008
Wayne Francis · 10 October 2008
Science Avenger · 10 October 2008
44 pages, woohoo! Do I hear 45? Come on handjobby, I know you've got some gojo left.
Malcolm · 10 October 2008
jobby · 11 October 2008
Of course that isn’t how computer programs work. Sub-routines take care of repetitive actions.
.... and even with carefully designed subroutines some operating systems require gigs. but according the to trolls here the human body can be constructed on 10MB of info. simply not logical. and even if arguable if it is science the hypothesis should be tested.
... and even tho we cannot track every molecule in a liter of water we DO know within a certain tolerance how much energy it will take to raise the temp 1 degree C.
... the trolls here are simply trolls. no science ability. just sad trolls.
Wayne Francis · 11 October 2008
jobby · 11 October 2008
I’m 38 and have made a career
... youre 38 and use terms like 'hand jobby' did you watch a lot of Beavis? why do you act so immature??
jobby · 11 October 2008
You are a troll, a lying and ignorant ass the does nothing but waste oxygen for no good reason.
.... do you realize you are getting angry at a persona on the internet? and you have spend a lot of time on it rather than usefule pursuits. do you think that is mentally healthy?
jobby · 11 October 2008
How efficient do you think computer systems will be in 3,000,000,000 years Hand Jobby?
.. probably would not have junk DNA in it
jobby · 11 October 2008
Now no one expects you to write code as well as me
.. what language do you program in?
.. your statement is completely illogical since you have no idea how well or badly i 'code' if at all.
jobby · 11 October 2008
The size and complexity of computer code is tied directly with the hardware it runs upon. Again the hardware today’s programs run on has only been around for a few decades.
.. you claim to be an expert in 'coding'. give us a range for the amount of bytes needed to contruct a human body.
> 10, > 100, > 1000 < 100 terabytes??? just an estimate. surely you can do that with your background!
Dave Lovell · 11 October 2008
Malcolm · 11 October 2008
jobby · 12 October 2008
jobby · 12 October 2008
jobby · 12 October 2008
Science Avenger · 12 October 2008
Jesus, now it's trolling itself. Are there no limits to how low it can go?
tresmal · 12 October 2008
Wayne Francis · 12 October 2008
Wayne Francis · 12 October 2008
Wayne Francis · 12 October 2008
Wayne Francis · 12 October 2008
Wayne Francis · 12 October 2008
Wayne Francis · 12 October 2008
jobby · 12 October 2008
jobby · 12 October 2008
So it is VERY logical that I can make the statement with a high degree of certainty that you would not be a good coder.
.... well RD disagrees with you. And I think it is illogical to waste so much time here as you do.
Wayne Francis · 12 October 2008
jobby · 12 October 2008
....Are you saying DNA does not store information??
....Do feel that Richard Dawkins and the Jackson Lab in Maine are in error and are poor scientists and illogical thinkers??
jobby · 12 October 2008
Wayne Francis · 12 October 2008
jobby · 12 October 2008
This is why I know I’m a better programmer then you hand Jobby. Everyone you quote talks about storing DNA sequences as computer data, not computer code. Yes DNA can be analogous to computer code but when we talk about the human genome fitting on a CD that is data, not code. That 750 meg does not include all the biochemistry that is involved. You can’t grasp that a string of binary digits to represent the human genome has nothing to do with computer code.
...Code is not data??
Wayne Francis · 12 October 2008
jobby · 12 October 2008
Storing the human genome has nothing to do with the execution of said DNA. It is being stored as data.
then WHERE are the instructions stored??
jobby · 12 October 2008
... Does the DNA contain information???
Wayne Francis · 12 October 2008
jobby · 12 October 2008
That data in the environment of the cell is the OS.
....???? So where is the OS that constructs the human body stored??
Wayne Francis · 12 October 2008
jobby · 12 October 2008
Wayne Francis · 12 October 2008
Wayne Francis · 12 October 2008
Malcolm · 12 October 2008
Lets try that again.
Jobby,
Since you still seem to think that DNA is some kind of computer program, what is the spliceosome analogous to? or even the ribosome? If that's what you think of as the CPU, then that is one powerful super computer.
What about g-protein coupled receptors? I've put together a number of computers in my time, and I've never seen anything like that in there.
If I put 2 computers together, will they breed?
Its not that DNA can't be measured in bytes, its that doing so is meaningless. DNA is not analogous to a computer program because cells are not computers.
The fact that you keep on about this just shows that you have absolutely no understanding of biology, which in turn shows that your statement that you have looked at the evidence for evolution and found it lacking is a lie.
Henry J · 12 October 2008
jobby · 13 October 2008
jobby · 13 October 2008
ou have looked at the evidence for evolution and found it lacking is a lie.
... evolution is a fact: it has been observed and happens daily. I never said that evolution does not exist etc.
jobby · 13 October 2008
RD:
DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too, if we wish.
Wayne Francis · 13 October 2008
Wayne Francis · 13 October 2008
jobby · 13 October 2008
jobby · 13 October 2008
The basic instructions are things like moving data around, performing math operation on data, shifting data, comparing data and jumping around within the code.
... you are forgetting about robotics.
jobby · 13 October 2008
So please don’t quote mine
... there was not quotemining. just because a quote does not agree with you does not mean it is mining. RD views the DNA as computer-like. I do not think that an out of context quote. quit bullshitting
SWT · 13 October 2008
fnxtr · 13 October 2008
jobby · 13 October 2008
jobby · 13 October 2008
jobby · 13 October 2008
This is really nothing but a troll fest. Very little intelligent responses.
PvM · 13 October 2008
jobby · 13 October 2008
PvM · 13 October 2008
Jobby · 13 October 2008
Henry J · 13 October 2008
Being appalled by people's language is not an argument against the position those people support.
Malcolm · 13 October 2008
Science Avenger · 13 October 2008
Science Avenger · 13 October 2008
PvM · 13 October 2008
Jobby · 13 October 2008
you are again looking at things too simplisticly. 'code' is a subset of 'data' and 'data is also a subset of 'data'
just as man is a subset of man.
yes in most computers the data and the program are seperated but not always.
(why am i wasting my time. this is obviously above what this person can understand. i taught this to underclass freshmen and they got it. but here the level is just so, so low)
just as a byte is USUALLY 8 bits but that is arbitrary. just as our number base 10 is aribitrary ( i probably lost them there)
( is this a place where learning disability people congregate?0
WIKI:
Some special forms of data are distinguished. A computer program is a collection of data, which can be interpreted as instructions. Most computer languages make a distinction between programs and the other data on which programs operate, but in some languages, notably Lisp and similar languages, programs are essentially indistinguishable from other data
Jobby · 13 October 2008
Jobby · 13 October 2008
You claimed to have found the evidence that natural selection was responsible for the evolution of complex structures to be insufficient (or some such crap). You lied.
... where did i say that??? you are lying. asshole
Jobby · 13 October 2008
You obviously know nothing about computer programming either. No, in a computer code is not data. Code is a set of instruction. Data is what those instruction act upon.
... simplistic thinking! (well what else to expect from a simpleton!)
PvM · 13 October 2008
PvM · 13 October 2008
jobby · 13 October 2008
A byte is 8 bits, did you not know? And it is hardly arbitrary either. Similarly our base 10 system is again hardly arbitrary, as anyone with two hands understands
... are you REALLY saying that no computers use bytes other than 8 bit bytes and are you REALLY saying that all human civilizations use the base 10 numbering system?? (can he really be that stupid? lets see how he responds!)
jobby · 13 October 2008
Wayne Francis · 13 October 2008
Wayne Francis · 13 October 2008
PvM · 13 October 2008
Wayne Francis · 13 October 2008
sorry hit submit to fast.
Hand Jobby's comment about robotics is a non sequitur. Robotics have no impact on the basic functions of a computer.
PvM · 13 October 2008
PvM · 13 October 2008
jobby · 13 October 2008
jobby · 13 October 2008
a robot is just a mechanical device. It used to refer to devices that resembles a living creature.
... what a moron! I think he is thinking about robby the robot on TV.
... no dummy a robot does not 'resemble a living creature' ever been to a factory??
... you are astoudingly stupid
Wayne Francis · 13 October 2008
PvM · 13 October 2008
jobby · 13 October 2008
I addressed your claim of ‘arbitrarily’ which ignores the logic for both base systems.
.... DDDDDDDDDDDUUUUUUUUUUUUUUUHHHHHHHHHHHHHHHHHHHH!!!!!!!!!
.... an arbitrary choice can still be logical: like deciding every one should drive on the right side of the road. or that Greenwich is time = 0
( really whats the use. this is just getting cruel he is obviously mentally disabled)
PvM · 13 October 2008
Wayne Francis · 13 October 2008
Wayne Francis · 13 October 2008
Wayne Francis · 13 October 2008
Wayne Francis · 13 October 2008
Science Avenger · 13 October 2008
Wayne Francis · 13 October 2008
Science Avenger · 13 October 2008
fnxtr · 13 October 2008
Henry J · 13 October 2008
To a compiler, the source program being compiled is data, and the object code being output is treated as output data by the compiler itself, since it doesn't execute it.
To an interpreter, the code it interprets is in a sense the input data to the interpreter.
As for LISP, well, let's just treat that parenthetically for now.
Henry
fnxtr · 13 October 2008
Sorry, I skipped some posts so now that horse is really dead.
Wayne Francis · 13 October 2008
Malcolm · 13 October 2008
Lets go through this one step at a time:
Jobby,
Do you believe that cells are analogous to computers, yes or no?
If yes, Please provide analogies for cellular organelles and processes.
If no, what the hell is your argument?
jobby · 14 October 2008
I have to assume you are talking about the “robots” I was referring to that are made out of wood. http://myninjaplease.com/wp-content[…]ipiere-1.jpg warning the image is 3.5meg
Please, tell me where the “Instructions” are in this robot.
.... are you REALLY saying a robot does not have store instructions?????
jobby · 14 October 2008
Do you believe that cells are analogous to computers, yes or no?
... no. Did you think I said that?? do you have reading problems??
jobby · 14 October 2008
Monkeys jump!!!
Dave Lovell · 14 October 2008
jobby · 14 October 2008
No, you probably never actualy said that, but you seem to have been arguing for weeks that DNA code executed by a cell is analogous to program code executed by a computer
... probably never said that?? I NEVER said that. very poor reading skills here.
... and yes the DNA has many similarities to a computer code. I think most scientists would agree with that.
you do not think that the DNA stores instructions???
Science Avenger · 14 October 2008
Forty Seven!
Dave Lovell · 14 October 2008
Wayne Francis · 14 October 2008
fnxtr · 14 October 2008
Wayne Francis · 14 October 2008
jobby · 14 October 2008
you do not think that the DNA stores instructions???
... so it DOES store instructions! well you admitted that. and that is the main point!
...JUMP MONKEYS!!!
jobby · 14 October 2008
So Blow Jobby, take a look at that wooden robot and you tell me where the “instructions” are.
.... what functions does this 'robot' do??
JUMP MONKEYS!!
Wayne Francis · 14 October 2008
Wayne Francis · 14 October 2008
Wayne Francis · 14 October 2008
Dave Lovell · 14 October 2008
jobby · 14 October 2008
...Why does R. Dawkins say
'DNA carries information in a very computer-like way, and we can measure the genome's capacity in bits too' ???
JUMP MONKEYS!!
jobby · 14 October 2008
Forgive me (I was without Internet access for a week and a half in the middle of this thread),
... well you know Mom was going to eventually take it away from you if you kept up with your bad behavior!
JUMP MONKEYS!
Wayne Francis · 14 October 2008
Wayne Francis · 14 October 2008
http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-169899
jobby · 14 October 2008
Wayne Francis · 14 October 2008
Dave Lovell · 14 October 2008
Dave Lovell · 14 October 2008
Wayne Francis · 14 October 2008
Robin · 14 October 2008
Henry J · 14 October 2008
If driving on the right is logical, what about the British?
The choice of Greenwich wasn't arbitrary; they wanted the 180 degree line to cross as little land as possible, and that criteria put the 0 degree line through England.
http://www.worldtimezone.com/
Robin · 14 October 2008
jobby · 14 October 2008
... Conventions can be Arbitrary!!
JUMP MONKEYS!!!!
PvM · 14 October 2008
PvM · 14 October 2008
jobby · 14 October 2008
Yes, Jobby’s ‘arguments’ are seldomly free from contradiction. Such is the position of someone who seems unable to acquire knowledge and apply it.
.... PvM is the most consistent monkey but Wayne jumps quicker.
JUMP MONKEYS!!!
PvM · 14 October 2008
jobby · 14 October 2008
How funny, how sad, notice lurkers to what Jobby has been reduced just because one has asked him to support his claims.
...PvM, my best trained, has NEVER supported his claims.
JUMP MONKEYS!!
PvM · 14 October 2008
jobby · 14 October 2008
A steam engine has similarities to a computer.
... actually you are wrong. very few similarites. now DNA and computer code are very similar
JUMP MONKEYS!!!
Henry J · 14 October 2008
Re "DNA and computer code are very similar"
What's the DNA equivalent of
int f(int arr[],int size){int i,sum;for(i=0;i<size;i++){sum+=arr[i]);return sum;}
?
jobby · 14 October 2008
PvM · 14 October 2008
Another content free posting from our dear confused friend Jobby.
Remind us again J. what is the information content of the human body.
Take your time.
Looking forward to your response.
Christian Monkey
fnxtr · 14 October 2008
(Michael Palin looming over Jonathan Pryce): "We've lost him."
jobby · 14 October 2008
what is the information content of the human body.
Take your time.
... first YOU tell me the information content of human DNA!
JUMP MONKEYS!!
PvM · 14 October 2008
Stanton · 14 October 2008
Dave Lovell · 14 October 2008
jobby · 14 October 2008
Based on this you make the foolish assertion that somehow the information is insufficient.
.... did not say that! said data insufficient either way
... you are my best trained monkey. go get yourself a bannana
Where are the other monkeys??
JUMP MONKEYS!!
jobby · 14 October 2008
Which group are you in?
... hex is best.
JUMP MONKEYS!!
Stanton · 14 October 2008
jobby · 14 October 2008
s this how you teach your classes, jobby/bobby/jacob/hamstrung/goff?
By demanding that they tell you what they know of the subject, then dismissing what they said so you can insult them?
... class control is important!!
JUMP MONKEYS!!
Henry J · 14 October 2008
Where are all the monkeys that are supposed to be jumping?
jobby · 14 October 2008
Stanton · 14 October 2008
jobby · 14 October 2008
How is insulting students by calling them “monkeys” a form of class control?
...good monkey. but try to be quicker next time. no banana!
JUMP MONKEYS!!
Stanton · 14 October 2008
Science Avenger · 14 October 2008
48 pages entertaining the mentally ill. Do I hear 49?
PvM · 14 October 2008
Working on it... 49 pages... here we come.
Note that a large proportion are the usual content free contributions by Jobby, avoiding dealing with any evidence presented to him.
Children and monkeys, this is your brain on Intelligent Design, you have been warned ;-)
Henry J · 14 October 2008
Hey, monkeys aren't a monophyletic group. See http://www.tolweb.org/primates/15963
Wayne Francis · 14 October 2008
jobby · 14 October 2008
Note that a large proportion are the usual content free contributions by Jobby, avoiding dealing with any evidence presented to him.
... actually very little is from me. Mostly my monkeys jumping up and down that are taking most of the space here. But they are MY well trained monkeys.
MONKEYS JUMP!!
jobby · 14 October 2008
1st DNA isn’t binary.
.. no one said it was. but information can be represented as binary for analysis purposes!
JUMP MONKEYS JUMP!!
jobby · 14 October 2008
765bits of nothing
... where is that??
jobby · 14 October 2008
Science Avenger · 14 October 2008
My god, he's sunk to the "I knew you were going to do that" level.
And yet it continues.
Wayne Francis · 14 October 2008
tresmal · 14 October 2008
"JUMP MONKEYS" said the feces throwing macaque.
Wayne Francis · 14 October 2008
Wayne Francis · 14 October 2008
Henry J · 14 October 2008
Besides, no matter how many bananas he gives to the alleged monkeys, his claims are still fruitless.
Henry
Dale Husband · 15 October 2008
Wow, is this still going on? I've heard of beating a dead horse, but this one is already reduced to a skeleton.
Here is all the evidence that jobby has been persistently ignoring:
http://pandasthumb.org/archives/2008/09/luskin-and-the-2.html#comment-169391
jobby · 15 October 2008
So Blow Jobby just proves that he typed in 765 random bits because he doesn’t even recognize that how many bits he typed
... you counted them??? hahahahah! you dont have anything better to do than to count 1s and 0s. wow.
hey tell me how many are here:
1001010100010101010010010101011110101010101010100100
1001010100010101010010010101011110101010101010100111
10010101000101010100100101010111101010101010101001100101010001010101001001010101111010101010101010011001010100010101010010010101011110101010101010100110010101000101010100100101010111101010101010101001
10010101000101010100100101010111101010101010101001
GOOD MONKEY!!
jobby · 15 October 2008
It might take me 12 hours to respond to your idiotic posts but I do have a life unlike you.
.... you'll be back!! GOOD MONKEY!
jobby · 15 October 2008
Here is all the evidence that jobby has been persistently ignoring:
http://pandasthumb.org/archives/200[…]mment-169391
... you actually search thru old posts and then cut an paste the URL??
jeez I have better things to do
but you do entertain me!
GOOD MONKEY!!
Wayne Francis · 15 October 2008
jobby · 15 October 2008
No Hand Jobby I didn’t count them.
...GOOD MONKEY!!
... Do you believe in Darwinism??
Dan · 15 October 2008
jobby · 15 October 2008
No Hand Jobby I didn’t count them. A program counted them. Hell I don’t even read these post. My computer reads them to me. Personally I like Neospeech’s Paul voice but if I’m doing listenning to anything in french then I have the french spoken to me using AT&T Lab’s Arnaud voice before having the text translated in to English and then I use the Neospeech Paul voice.
... is this comment related to the thread??
JUMP MONKEY!!
Wayne Francis · 15 October 2008
Have fun with the troll everyone. I'm off for 5 days to Melbourne for a International Tap Festival. I can see the willfully ignorant lying troll named Hand Jobby still ignores everything pointed out to him. I'm sure I'll have some laughs when I catch up on threads when I get back.
bientôt
jobby · 15 October 2008
fnxtr · 15 October 2008
Okay, now it doesn't even care that it's wrong, it just wants attention. You broke it, guys.
phantomreader42 · 15 October 2008
fnxtr · 15 October 2008
... or just ignored like the old gum wrapper on the sidewalk.
Henry J · 15 October 2008
The sad thing here is that the chemical gradient thing mentioned earlier could have made an interesting discussion, if the environment in this thread had permitted it.
Henry
Malcolm · 15 October 2008
Cobby · 15 October 2008
Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey.
I pulled the rug from under their beliefs systems which threw them into a terrible tizzy and then came the dirty language. You can always tell when they have not logical repsonses that is when they start the primitive vulgarities.
Henry J · 15 October 2008
I see the train wreck has fallen off the front page. Will that slow it down, or has everybody bookmarked it?
iml8 · 15 October 2008
I propose to beat this record by insisting that the
Moon is made of green cheese and going to at least a
HUNDRED pages blowing off all attempts to convince me
otherwise.
White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html
Malcolm · 15 October 2008
PvM · 15 October 2008
Henry J · 15 October 2008
Stanton · 15 October 2008
Stanton · 15 October 2008
Dave Lovell · 16 October 2008
cobby · 16 October 2008
If, at some point in the future, a genetic engineer offers to create the genome that specifies your ideal partner, and grows it from a single cell before your eyes, would you consider this proof, or still claim the result was the product of an intelligent designer?.
... that would be proof. And why do you feel any doubting of Darwinism means a person infers an intelligent designer? Seems like you are thinking too simplistically. Could a third or nth alternative.
... but there as some big, big problems in the present theory and to just close your eyes and say 'Darwin-did-it' and not doubt your FAITH simply is not science.
cobby · 16 October 2008
I would suggest that you read a first year biology, biochemistry or genetics textbook. You'll usually find all of those points covered in within the first 10 or so chapters.
Until you have actually shown that you have any understanding of the subject, STFU.
... well cut and paste where these concepts are brought up or tell us in YOUR own words. Seems like you never must have taken any of these courses or else you would be aware of what the syllabi consist of.
PvM · 16 October 2008
PvM · 16 October 2008
cobby · 16 October 2008
Bobby’s ignorance of biology has been well demonstrated. What more to do?..
...actually PvM has demonstrated HIS ignorance. he is unable to read a simple text and paraphrase. he can only regurgitate!
GOOD MONKEY!!
cobby · 16 October 2008
Well basically I asked for some studies showing that NS can cause complex structures and and showing how the shape of bones are formed and also studies showing that there is enough info in the DNA to contruct a human body. None of these were produced. And I asked why the posters believed in these things without proof and when I concluded it was simply FAITH they went monkey
... the monkeys simply cannot produce validation for the above. Then they get upset and start spitting and pounding. Just watch!
Dave Lovell · 16 October 2008
Dave Lovell · 16 October 2008
cobby · 16 October 2008
So do you think there is sufficient information in a fertilised human egg cell to build a human, regardless of how the information was generated?
... could be. I really do not know. Neither does anyone. That is my point. To assume it is all in there without measuring or experimenting is FAITH not science.
cobby · 16 October 2008
Either this needs no more information, or their genome already contains detailed specifications for a huge range of possible leg lengths. Which is more likely?
... this lengthening is being controlled by an intelligence and the instructions are not completely in the DNA
s1mplex · 16 October 2008
cobby · 16 October 2008
PvM · 16 October 2008
PvM · 16 October 2008
Robin · 16 October 2008
Saddlebred · 16 October 2008
Wow.
Jump Monkeys Jump.
Just wow.
How do ya like them apples?
Henry J · 16 October 2008
But monkeys like bananas!11!one!
phantomreader42 · 16 October 2008
Malcolm · 16 October 2008
Stanton · 16 October 2008
Dale Husband · 16 October 2008
Forgive me, folks, but I'm dying of laughter here! Jobby, you MURDERER!!!!
Carry on, folks!
Dave Lovell · 17 October 2008
cobby · 17 October 2008
cobby · 17 October 2008
Would you care to give us your suggestions as to how to perform these measurements and experiments?
... it seems like you are saying it is unnecessary to do these experiments etc to validate the assertion that the DNA contains enough info.
Dave Lovell · 17 October 2008
cobby · 17 October 2008
phantomreader42 · 17 October 2008
cobby · 17 October 2008
Stanton · 17 October 2008
Stanton · 17 October 2008
phantomreader42 · 17 October 2008
Henry J · 17 October 2008
Yeah, if it wasn't sufficient, all one would have to do is show proteins that couldn't be traced back to the DNA, or body parts for which the length and width weren't determined by on/off switches in regulatory DNA combined with signal chemicals from other cells (i.e., the gradients mentioned in previous replies).
Henry
Malcolm · 17 October 2008
Dave Lovell · 18 October 2008
cobby · 18 October 2008
I think it is fair that you should answer MY queries:
I think the main point is: do we reasonable know that DNA has enough info?
The exploration of methods of validating this would be unnecessary if YOU have already determined that the DNA is sufficient.
cobby · 18 October 2008
I think that part of the problem is that the troll has absolutely no idea how chemical signaling works. In its extreme arrogance it can not imagine anyone being more knowledgeable than itself, therefore it assumes that no one understands it. Trying to educate the troll is like trying to teach a 4-year-old to do calculus. And then the 4-year-old stating that LaPlace must have been wrong, so God is required to move the planets.
....MONKEY: Of course I am aware of the signalling. Please stop the trolling and please grow up.
JUMP MONKEYS!!
cobby · 18 October 2008
DS · 18 October 2008
Henry,
Two weeks (and one thousand posts) ago a link was provided to a web site that lists over two hundred proteins involved in Drosophila wing morphogenesis. The site described in detail the interactions between the proteins in the signaling pathways and how wing shape was determined, as well as the effect that various mutations had on wing shape.
Unfortunately the microcephalic chimpanzee of many names was too busy flinging his feces around to read the article or any of the references contained therein. It also failed to identify even one protein that was not coded for in the fly genome. Now I have a hypothesis as to why this might be. I think that it believes that photons from the sun are processed in the earth's magnetic field and that this provides the information required for development. Now where on earth could it have gotten such a ridiculous idea?
cobby · 18 October 2008
The site described in detail the interactions between the proteins in the signaling pathways and how wing shape was determined, as well as the effect that various mutations had on wing shape.
... sorry charlie. there was no description on how the shape of the wings were formed. did you even read part of it?
go ahead paraphrase where this was described.
(what a liar!)
Science Avenger · 18 October 2008
And this is the subape's other tactic: pretending to have read articles he hasn't (which was proven when he claimed to have read a paper that another poster made up), and demanding that everyone else not only read them for him, but summarize them, and in 3rd grade vocabulary so he can understand. Then he claims he didn't say what he said.
And so it goes...get me 52 pages my little presimian imp.
cobby · 18 October 2008
Malcolm · 18 October 2008
PvM · 18 October 2008
Science Avenger · 18 October 2008
Malcolm · 18 October 2008
DaveH · 19 October 2008
somebody · 19 October 2008
somebody · 19 October 2008
until a feedback loop shuts them off,
.... so what feedback tells the cells that the pelvis is the correct shape??
PvM · 19 October 2008
PvM · 19 October 2008
somebody · 19 October 2008
somebody · 19 October 2008
In addition, Somebody still seems to be totally unfamiliar with how body plans arise.
... dummy: do you also think a chijuajua and a great dane have dissimilar body plans??
... dummy wont answer i am sure
DaveH · 19 October 2008
How does a developing embryo KNOW when its left femur is the right shape? That's about the level of the sockpuppet's discourse. It seems to think that there is some magic external referee that decides that the leg is long enough. If the troll had the slightest understanding of emergence and had read the papers provided for it instead of scanning the titles and rejecting the papers, it would have caught on to the fact that there is no need for an external observer who keeps things right. Cells divide when they receive signals of a certain strength. They stop when the signal falls below that strength, or when the molecules that they pump out reach a certain threshold which switches off the original signal. It's almost as if troll-face had asked "Why is the sky blue?" and people had provided lots of papers about refraction and the troll came back with: "That's just a mechanistic explanation of why it IS blue. How does the sky KNOW to be blue?"
Malcolm · 19 October 2008
Wayne Francis · 19 October 2008
Wayne Francis · 19 October 2008
Wayne Francis · 19 October 2008
Wayne Francis · 19 October 2008
Wayne Francis · 19 October 2008
Dave Luckett · 20 October 2008
My father, who was occasionally wise, remarked that there is simple ignorance, which is curable unless it is compounded by intractible foolishness; and intractible foolishness comes in two kinds. The first kind is the fool who doesn't know, and doesn't want to know. The second kind is the fool who doesn't know, but who thinks he does. Jobby is both.
Dave Lovell · 20 October 2008
cobby · 20 October 2008
dummy: do you also think a chijuajua and a great dane have dissimilar body plans??
... still no answer
cobby · 20 October 2008
cobby · 20 October 2008
YES we do reasonably know that DNA has enough info.
.... how have you determined that??
cobby · 20 October 2008
Creationists don’t care about this world/universe, and virtually none of them care about studying this world/universe.
... what is the difference between a creationist and someone who believes God created life and the universe? Or are they the same?
cobby · 20 October 2008
“So why hasn’t natural selection selected for easier birth?”
Because selection pressure for greater intelligence is stronger. There are a number of drawbacks to larger brain size - energy needs, cooling problems, difficult birth (though this is at least partially also attributable to bipedalism) and very long dependent infancy and childhood. But a larger brain makes up for them.
... and how do we know that the pressure for intelligence is stronger??
Science Avenger · 20 October 2008
cobby · 20 October 2008
Saddlebred · 20 October 2008
Wayne Francis · 21 October 2008
cobby · 21 October 2008
Not in the common usage of the term “creationist” and it is more in line with a “theistic evolutionist” unless you mean that “God” set off the “Big Bang” then at some point in the past jump started life beyond the first primitive life.
... I think a better term would be 'bible literalist' I feel that someone who believes that God created life and the universe is a 'creationist'. I think this is a purposeful misuse of terms for political reasons.
cobby · 21 October 2008
Because we see that, despite the fact that bigger brains cost more in energy, development and birthing problems, larger brains have been selected as a trait over smaller brains in the homo line over the last few million years. If it wasn’t a stronger pressure we would not be here asking these questions.
.... you are saying that the evidence that bigger brains are more adaptive than easier birth is because we see have progessively seen more of them in homo?
cobby · 21 October 2008
We don’t have any studies that say there isn’t any unicorns either.
... well we have a great deal of observations that show that tho probability of existence of unicorns is very low.
... to say like you are that since we have no evidence that DNA is not sufficient therefore it is sufficient is not SCIENCE. please review scientific method.
cobby · 21 October 2008
but rather says that life and the appearance of life can be explained by natural processes.
.... any studies that show that to be the case?
Wayne Francis · 21 October 2008
Wayne Francis · 21 October 2008
Wayne Francis · 21 October 2008
cobby · 21 October 2008
ust like you think something can be “arbitrary” and “logical” at the same time despite the 2 words being antonyms.
... sorry charlie. sometimes arbitrary decision are the most logical thing to do:
wiki:
Arbitrary decisions are not necessarily the same as random decisions. For instance, during the 1973 oil crisis, Americans were only allowed to purchase gasoline on odd-numbered days if their license plate was odd, and on even-numbered days if their license plate was even. The system was well-defined and not random in its restrictions; however, since license plate numbers have nothing to do with a person's fitness to purchase gasoline, it is still an arbitrary division of people. Similarly, schoolchildren are often organized by their surname in alphabetical order, a non-random yet still arbitrary method, at least in most cases where surnames are irrelevant.
cobby · 21 October 2008
Did you finally realise that “Body Plans” doesn’t mean what you thought it meant?
.... what do YOU think it means??
cobby · 21 October 2008
Yes, it is a whole field of science called abiogenesis. Spend a few minutes with google.
... google ME the STUDIES that prove it. of course the term exists. that does not mean it is a proven concept
cobby · 21 October 2008
No responses to the fact that I do read many of the papers pointed to by others on this blog and more importantly that the papers explain exactly what you say they don’t?
.... pick one you have read and lets discuss it!
cobby · 21 October 2008
reationist are self labeled. You can argue with them over the use of the term. The “Creation Science” movement adopted the label in the early 90’s
...creation science <> creationism. study harder
cobby · 21 October 2008
Do you understand that your meaning of “Creationist” isn’t the meaning anyone else, including said Creationist, have?
.... sorry charlie, wiki agrees with ME not YOU:
Creationism is the religious belief that humanity, life, the Earth, and the universe were created in their original form by a deity (often the Abrahamic God of Judaism, Christianity and Islam) or deities.[1] In relation to the creation-evolution controversy the term creationism (or strict creationism) is commonly used to refer to religiously-motivated rejection of evolution as an explanation of origins.[2]
Such beliefs include young Earth creationism, proponents of which believe that the earth is thousands rather than billions of years old. They believe the days in Genesis Chapter 1 are 24 hours in length, while Old Earth creationism accepts geological findings and other methods of dating the earth and believes that these findings do not contradict the Genesis account, but reject evolution. The term theistic evolution has been coined to refer to beliefs in creation which are more compatible with the scientific view of evolution and the age of the Earth. Alternately, there are other religious people who support creation, but in terms of allegorical interpretations of Genesis.
cobby · 21 October 2008
So far there hasn’t been a need for a question of “Is DNA is sufficient?”.
... DUHHHH!!! I think if you believe in the sci method you have to prove things whether you feel there is a 'need' or not
... have you seen anything that shows that pink unicorns do not exist? you are saying as long as we do not see any evidence that DNA is not sufficient it is sufficient? sorry charlie, thats not SCIENCE!
Dave Luckett · 21 October 2008
Cobby again demonstrates that he can't read and doesn't want to try.
Cobby, you were told "The naturalist would say that “life” most likely formed from “non life” in a natural process."
Note the term "the naturalist". You were being told what naturalists think. It doesn't have to be what you think. Note also the qualifier "most likely". This was not some kind of revelation, but a cautious statement of the implication of a general principle disprovable in specific instances by evidence.
This principle is that the supernatural should not be assumed without the clearest necessity for it. It arises from Occam's Razor: "entities should not be unnecessarily multiplied". There is no clear necessity for supernatural means to explain the appearance of life. On the contrary, natural means have been proposed and are being investigated. Since there is no compelling need to assume a supernatural cause, the naturalist does not assume one.
Your boot is therefore on the wrong foot. The naturalist need not prove that supernatural means are not necessary. It is for those who assume such means to prove that they *are* necessary. This they have not done. No good evidence has ever been offered for that proposition. Nothing but arid philosophising has ever resulted from it, while on the other hand investigating the natural world by assuming natural means - a pursuit otherwise known as "science" - has produced enormous gains and benefits for all humanity.
Assume whatever you want, Cobby. You're never going to make any contribution to knowledge, anyway. Me, I'm going with the winners, because I'm not a fool.
Wayne Francis · 21 October 2008
Wayne Francis · 21 October 2008
Wayne Francis · 21 October 2008
Wayne Francis · 21 October 2008
Science Avenger · 21 October 2008
Wayne Francis · 21 October 2008
Wayne Francis · 21 October 2008
Dave Lovell · 21 October 2008
Dave Lovell · 21 October 2008
cobby · 21 October 2008
By not agreeing a common vocabulary,
... YOU are the one not agreeing on a common vocabulary.
... for starts define 'evolution;.
cobby · 21 October 2008
Long ago, he was prepared to argue at length about how many bits make up a byte, claiming from 4 to at least 64, whilst simultaneously claiming seven hundred and fifty million of them were insufficient, regardless of how big they were
.... wrong again. a bytes is a collection of bits. the amount can vary but now the customary, conventional amount is 8. stop lying
cobby · 21 October 2008
So, YES we do reasonably know that DNA has enough info,
.... you do not know ! you believe! FAITH!
cobby · 21 October 2008
What I say is that there is no evidence that there is some other source needed.
.... so lack of evidence makes conclusions??? Not SCIENCE! sorry.
PvM · 21 October 2008
Robin · 21 October 2008
Stanton · 21 October 2008
Wayne Francis · 21 October 2008
Hey Blow Jobby,
Have you read that paper you asked me to pick so we can discuss it yet? Or are you going to, once again, claim it doesn't actually say what it says then say you don't have to read it until someone puts it into a language that a kindergartner can understand? (which I still think is about 3 years to advanced for you)
In case you forgot and are to lazy to look up a few post the paper is
“Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”
by Kenneth Weber, Nancy Johnson, David Champlin, and April Patty from Genetics Society of America
I eagerly await your response on how and why this paper does not actually explain Drosophila Melanogaster wing morphology. I'll clue you in..."morphology" is a grown up word for "shape"
Henry J · 21 October 2008
Wayne Francis · 21 October 2008
*crickets chirping*
over 12 hours now. Maybe Hand Jobby has finished reading the abstract of paper, then again probably not.
Come on blow jobby the paper is less then 10,000 words.
Wayne Francis · 22 October 2008
I read the paper again jobby. Hope you are taking so long because you are doing some research on any questions you have about the paper.
cobby · 22 October 2008
Wayne Francis · 22 October 2008
Wayne Francis · 22 October 2008
Well Blow Jobby you have another 6-8 hours to read the paper. I'm going to bed. I look forward to your comments on the paper. You keep saying the papers don't address how genetics control morphology but you clearly have not read the papers so unless "God" is talking to you I'm at a loss how you can make those statements.
DS · 22 October 2008
Wayne,
Good luck. I picked a paper for the dill weed to read almost three weeks ago. Althouth it never read it, it still demanded just such a paper thirty more times since then. I think it knows that it could never understand a real scientific paper, so it must avoid reading one at all costs. Of course everyone else already knows that it can't comprehend anything scientific. Now why on earth would it want to come here and display it's ignorance for all to see? Who cares, let it wallow in ignorance.
Dave Lovell · 22 October 2008
cobby · 22 October 2008
... you really counted the hours since I last talked to you??
cobby · 22 October 2008
“Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”
... if you read it you can tell me what is says that makes you believe it shows how the shape of the wings are determined. not just now they are 'affected' actually I do not think you read one word of this article.
Henry J · 22 October 2008
Good grief.
SWT · 22 October 2008
cobby · 22 October 2008
Good grief.
... I agree. I do not think of these posters have read ANY of the articles they have referred to. It is easy just to make a list of article that supposed prove their points and say 'go read them'.
phantomreader42 · 22 October 2008
PvM · 22 October 2008
Wayne Francis · 22 October 2008
Wayne Francis · 22 October 2008
Wayne Francis · 22 October 2008
Glad I didn't hold my breath.
Dave Luckett · 22 October 2008
Proverbs 15:14.
DS · 22 October 2008
Wayne,
Nice try, but remember that others have previously picked papers and even presented entire abstracts. Hand Jobby still hasn't realized that he will never know if the papers answer the questions it asks or not until it reads them. It also hasn't seemed to realize that unless it reads them, it can never tell if anyone else has read them or not.
It's refusal to read the papers is strong evidence that it doesn't care about the answers to it's questions. If it really did care, it would have gotten a real education and read the papers already. It also doesn't seem to realize that absolutely no one cares if it chooses to remain ignorant or not. In the end, all that it can demonstrate is the level of it's ignorance ind it's determination to maintain that condition.
Oh well, this asshole would probably read a recipe for cake and demand to know where in the recipe the shape was determined.
cobby · 23 October 2008
cobby · 23 October 2008
Oh well, this asshole would probably read a recipe for cake and demand to know where in the recipe the shape was determined.
... well is a cake formed a shape say like a pyramid and you say the combination of ingredients cause that shape rather than some sort of mold or scaffolding well of course I would not believe it.
... and really what is going on with the toilet mouth stuff here? Don't you feel the least bit embarrassed about your language? Are you posters low-lifes?
Wayne Francis · 23 October 2008
Wayne Francis · 23 October 2008
fnxtr · 23 October 2008
Poor Yobbo's really backed itself into a corner. It's been so belligerent and confrontational this whole time, so that now, even if it does read the paper, it won't dare ask any questions about it, because that would be a sign of weakness.
I warned you in your last disguise, Yobbo, that if you were really serious about learning you'd get treated with respect, but if you came here looking for a fight you'd get creamed.
There's still a chance, Yobbo. Bury the hatchet, go read the friggin' paper already, and ask your questions. Who knows you might actually learn something from people who really do know more than you. I've learned a lot here in the last year or so and I'm grateful.
Of course, if you're 14 years old this will fall on blind eyes...
Robin · 23 October 2008
phantomreader42 · 23 October 2008
PvM · 23 October 2008
cobby · 23 October 2008
cobby · 23 October 2008
PvM · 23 October 2008
PvM · 23 October 2008
cobby · 23 October 2008
Afraid to discuss science eh Bobby?
... No but obviously YOU are. Just write 2 sentences on how that article demonstrates your point!
cobby · 23 October 2008
Intelligent Design:
Required by Biological Life?
February 19, 2008
K.D. Kalinsky
... here is an article that explains how ID is required for life. It supports my assertions here.
Dave Lovell · 23 October 2008
PvM · 23 October 2008
cobby · 23 October 2008
phantomreader42 · 23 October 2008
phantomreader42 · 23 October 2008
PvM · 23 October 2008
phantomreader42 · 23 October 2008
Henry J · 23 October 2008
tresmal · 23 October 2008
One problem with this paper is that it declares that natural selection (if it exists) must itself be a product of intelligent design.This is just an invocation of the Strong Anthropic Principle. Another problem is that it suffers from the "lottery fallacy". It confuses the probability of a lottery producing a particular winner for the probability of it producing a winner.
Henry J · 23 October 2008
phantomreader42 · 23 October 2008
Robin · 23 October 2008
Robin · 23 October 2008
Robin · 23 October 2008
cobby · 23 October 2008
cobby · 23 October 2008
These posters will do ANYTHING to avoid actually discussing the evidence that they contend validates their theory!
pages of avoidance. just pick an article and discuss it! dummies!
tresmal · 23 October 2008
phantomreader42 · 23 October 2008
cobby · 23 October 2008
SWT · 23 October 2008
Henry J · 23 October 2008
PvM · 23 October 2008
PvM · 23 October 2008
cobby · 23 October 2008
PvM · 23 October 2008
cobby · 23 October 2008
DS · 23 October 2008
Man, this troll is just full of bullshit. All it has to do is read the paper and then it can ask a question that only someone who has read the paper can answer. Until it does, it will never know if anyone else has read a paper or not. Man, talk about being immune to evidence, this jerk wad is even immune to the concept of evidence.
PvM · 23 October 2008
cobby · 23 October 2008
PvM · 23 October 2008
cobby · 23 October 2008
PvM · 23 October 2008
tresmal · 23 October 2008
Jobby. No one here is going to translate any article for you. You are going to have to read the article yourself. Admit it, you can't read scientific prose. If I'm wrong, Wayne Francis has an article that he would like to discuss. I've provided a link here:
Many P-Element Insertions Affect Wing Shape in Drosophila melanogaster”
Here's how it works: First you read the article and comment on it's faults, then we respond. IN THAT ORDER!
cobby · 23 October 2008
Henry J · 23 October 2008
Does ?obby have a relative named Eliza?
PvM · 23 October 2008
Wayne Francis · 23 October 2008
Dave Luckett · 23 October 2008
Hopeless, and unintentionally hilarious. We started out with an assertion that genetics and known physical laws are not sufficient to determine morphology. When this was called nonsense - which it plainly is - the troll demanded "proof" that it was nonsense.
This ignores logic, not only because it defies Occam's Razor, and not only because it demands that an unknown cause whose effect is entirely unstated be ruled out, but because it inverts the debate in unreasonable terms. If the troll thinks that he has a defensible proposal that contradicts conventional biology, he must be the one to show the evidence for it. It is the proposer of a hypothesis who must defend it by reasoned argument from evidence.
But to proceed. Despite the manifest unreason of the demand, evidence that genetics and known physical laws are sufficient to account for morphology was furnished. Papers were cited. References found. Now the troll says he isn't going to look at the evidence, but demands that it be elucidated and defended to him so that he can decide whether he accepts it or not. Thus, he makes the plainly insane assertion that unless he is persuaded by evidence that he doesn't understand and won't even look at, he wins.
The whole transaction is ridiculous. It was patently and furiously unreasonable from the start, and has now descended into pure farce, except that farce often has a point to make. This is pointless.
Wayne Francis · 23 October 2008
Wayne Francis · 23 October 2008
Wayne Francis · 23 October 2008
Wayne Francis · 23 October 2008
Wayne Francis · 23 October 2008
cobby · 24 October 2008
cobby · 24 October 2008
Have I read them all? Nope, don’t need to. Have I read most of them? Nope, don’t need to.
..... yes your FAITH in Darwinism is unshakeable!
cobby · 24 October 2008
You can’t understand that “arbitrary” and “logical” are antonyms,
.... they are not 'antonyms' an arbitrary decision can be the most logical thing to do. for instance deciding that people whose last names are from A to M can only get drivers license on odd numbered days. this might be beyond your cognitive abilities.
cobby · 24 October 2008
They show that rather then just one gene effecting wing shape there are multiple regions, both inside and outside of known genes that can effect wing shape.
... and this shows how the shape is formed? sorry charlie. there is nowhere in the literature where any researchers have found out how the shapes are constructed. yes genes turn off and on etc but it is a gigantic mystery on WHY then turn on WHEN they do.
.... ok lets see if you can engage in a civil, academic converstaion:
.... do humans keep growing or at a certain age does growth stop. bones quit elongating? what age does this happen?
cobby · 24 October 2008
The only thing left for me to do is post the whole paper in another post.
... that would be a good idea. or just parts of it that you feel are appropriate
Wayne Francis · 24 October 2008
Wayne Francis · 24 October 2008
cobby · 24 October 2008
As a side note, Kimura reasoned that about 107 or 108 bits bits of information would be necessary to specify human anatomy.(Source: Adaptation and Natural Selection By George Christopher Williams)
.... 10,000,000 bits for the human body?? way way too low!
cobby · 24 October 2008
... what is with the toilet-mouths here? Where I am from the underclass, uneducated, criminal types talk like this.
... I have responded to your discussion of the article. did you miss that?
... actually this toilet mouth talking makes the marine corp look really bad. and makes me ashamed of the US. no class, vulgar. just what the rest of the world thinks of us and this grunt is making US citizens look like ignorant, foul-mouthed bullies.
Wayne Francis · 24 October 2008
Wayne Francis · 24 October 2008
Wayne Francis · 24 October 2008
Wayne Francis · 24 October 2008
Wayne Francis · 24 October 2008
phantomreader42 · 24 October 2008
cobby · 24 October 2008
cobby · 24 October 2008
You’ve been provided the link to the full paper you lazy ignorant ass. Click on it and read it. The whole paper is appropriate. It explains what they tested for, how they did the tests, how they collected the results and what the results mean.
... where is the link??
cobby · 24 October 2008
phantomreader42 replied to comment from Wayne Francis | October 24, 2008 8:58 AM | Reply
Cobby would rather die than read that paper.
.... have YOU read it??
cobby · 24 October 2008
Depends on the human. There are humans that continue growing until, usually, their heart can no longer cope with the strain of pumping blood around their body.
... you cant be serious. even Acromegalics eventually stop growing. are you saying that most people continue to increase in height throughout their lives? you simply cannot be serious.
you are trolling me right??
SWT · 24 October 2008
SWT · 24 October 2008
Stanton · 24 October 2008
PvM · 24 October 2008
PvM · 24 October 2008
PvM · 24 October 2008
SWT · 24 October 2008
tresmal · 24 October 2008
DaveH · 24 October 2008
phantomreader42 · 24 October 2008
Henry J · 24 October 2008
Uh oh, was something contagious? :p
DaveH · 24 October 2008
cobby · 24 October 2008
Stanton · 24 October 2008
Stanton · 24 October 2008
And does this mean you are going to finally provide undeniable evidence and or a logical explanation to support your claim that Genomic DNA is informationally insufficient to produce a (human) body, even though no extra-genomic protein or other gene product have ever been proven to exist, and that all of the translation/transcription processes initiated by any stimulus, environmental or bodily, are all regulated and mediated by gene products?
DS · 24 October 2008
Stanton wrote:
"How is that a meaningful difference?"
Yea, come on you guys. Showing that you can change the shape of a wall by adding or removing bricks doesn't prove that you can make a wall by just putting bricks together.
Seriously, as I suggested several hundred posts ago, knowledge of how changes in gene interaction affect wing shape is strong evidence that wing shape is indeed determined by gene interactions in development. That and the fact that there is absolutely no evidence whatsoever for any other mechanism and no need to hypothesize one.
Of course a troll who doesn't understand any of this fancy smancy gene stuff can't really be expected to appreciate the finer nuances of the evidence now can it?
DS · 24 October 2008
Wayne,
Congratulations, you're making real progress. It proved that it could at least read part of the title anyway.
PvM · 24 October 2008
Stanton · 24 October 2008
Wayne Francis · 24 October 2008
Wayne Francis · 24 October 2008
Wayne Francis · 24 October 2008
Wayne Francis · 24 October 2008
Malcolm · 24 October 2008
I get the impression that the troll thinks that there must be one set of genes for the right eye and one for the left eye, one set for the left leg and one for the right, etc, each one requiring exact measurements. Probably in inches.
By the way troll, as someone not from the US, I don't think less of Americans when they swear. I do however think less of them when they show a complete lack of understanding of biology. And in case you weren't sure, that last sentence is referring to you.
PvM · 24 October 2008
Malcolm · 24 October 2008
Henry J · 25 October 2008
Maybe if somebody were to explain that chemical gradient thing in smaller words? Would that help?
Henry
Wayne Francis · 25 October 2008
Dave Luckett · 25 October 2008
Wayne Francis · 25 October 2008
cobby · 25 October 2008
cobby · 25 October 2008
cobby · 25 October 2008
cobby · 25 October 2008
... OK morons. I think we have too really, really dumb this down for you to understand.
... lets start with an easy question:
.... Can human tissue be grown outside of the human body? in vitro?
cobby · 25 October 2008
... I just wonder what motivates this posters to spend so much time on getting so angry and so vulgar. And then trying to portray themselves as educated people. Don't they have real lives? Family? Friends? Jobs? Hobbies? Let's see now they react to this.
Science Avenger · 25 October 2008
DS · 25 October 2008
Well who cares what corn cobby the corn holer doesn't understand? Everyone else already knows how development works. If anyone is really interested, here is a short list of examples of how hox genes affect wing shape in arthropods and morphology in other animals:
Nature 376:420-423 (1995)
Nature 388:682-686 (1997)
Nature 415:914-917 (2002)
Current Bio. 12:R291-R293 (2002)
American Scientist 85(2):1-10 (1997)
Of course bobby booby/hand jobby/corn cobby is expressly forbidden from reading these papers. Oh well, it's probably too buzy doing it's jumping monkey routine anyway.
rog · 25 October 2008
I feel sorry for Cobby...Jacob. He has passive-aggressive disorder and should get some professional help.
Passive-aggressive behavior traits: Ambiguity, Avoiding responsibility by claiming forgetfulness, Blaming others, Chronic lateness and forgetfulness, Complaining, Does not express hostility or anger openly (e.g., expresses it instead by leaving notes), Fear of authority, Fear of competition, Fear of dependency, Fear of intimacy (infidelity as a means to act out anger): The passive aggressive often can't trust. Because of this, they guard themselves against becoming intimately attached to someone., Fosters chaos, Intentional inefficiency, Making excuses, Losing things, Lying, Obstructionism, Procrastination, Resentment, Resists suggestions from others, Sarcasm, Stubbornness, Sullenness, Willful withholding of understanding
The last trait is especially diagnostic.
I suspect that communication with him will continue to be fruitless until he gets the help he needs.
cobby · 25 October 2008
cobby · 25 October 2008
cobby · 25 October 2008
cobby · 25 October 2008
............ interesting how the morons avoided the question here: are they really that dumb?
… OK morons. I think we have too really, really dumb this down for you to understand.
… lets start with an easy question:
.… Can human tissue be grown outside of the human body? in vitro?
DS · 25 October 2008
Rog,
I agree with your assessment. However, you forgot fixation on sexual perversity and obsession with foul language (even though it has used exactly the same language). Oh well, maybe that is just a smoke screen to hide the fact that it doesn't know anything and doesn't want to learn anything either.
Well now it knows how wing development is "initiated" by cascades of gene expression that create morphogenic gradients and how wing development is "affected" by alteration of gene expression that alters those gradients. The only thing left for it to discover is how wing shape is "determined". Now how could that possibly be accomplished? I know, maybe those pesky photons are responsible. Maybe it should do an experiment and try to raise fruit flies in the dark.
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
DS · 25 October 2008
Wayne,
What did you expect for someone who claimed that proteins were only "bricks"? Man this ignorant SOB will really go into another jumping monkey fit if it ever figures out that most of the chemical gradients are protein gradients. Obviously it doesn't know the first thing about biology or development, just as obviously it never will.
Maybe PvM will start another uncontaminated thread where people who are really interested in learning can discuss Drosophila wing development. There we could examine the molecular mechanisms whereby morphogenic fields are established and how they control cell differentiation and cell division. Maybe then someone could explain how anyone could ever get the idea that those mechanisms could not be responsibe for determining wing shape. Or maybe not, after all, everyone else already seems to understand the basics of developmental genetics.
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
cobby · 25 October 2008
...Can human tissue be grown outside of the human body? in vitro?
no answers? not a hard question. try to follow the logic here, moron.
cobby · 25 October 2008
Marginally? Chemical gradients are a huge key when genes turn on and off. That is like saying “Flour is only marginally useful for making bread”. You really can not be this stupid can you?
... no read some studies. they dont know how the shape are formed. yes they know how certain cells are instructed to start and stop but the shape, sorry charlie: its a mystery. go ask someone in the field.
cobby · 25 October 2008
Tonight, as it is 3am, I’m going to see Max Payne with my friend Christine. Out every night and I still have plenty of time to show you for the useless willfully ignorant lying shit for brain troll that you are.
... sounds like you are an alcoholic. how many times a week do you drink and how much?
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
cobby · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
cobby · 25 October 2008
PvM · 25 October 2008
So let's expose the fallacies some more. How much information is needed to specify the formation of an ice crystal?
As this diagram shows there are 4 generic depending on temperature and when taking saturation into consideration one has about 16 different basic shapes. In other words, the amount of information needed to specify the basic shape of a snow flake/ice crystal is about 4 bits. However, when a snowflake forms, the surrounding environment strongly affects the exact shape which is only under rare circumstances perfectly symmetric. So how much information is needed to describe one of the basic forms? And how much additional information is imparted by the laws of physics and the environment? I'd argue that the amount of information is far more than what is initially specified by the initial conditions. So where did this additional information come from? Simple really, from the laws of physics and the local conditions, the environment of the crystals.
This simple example shows how silly Bobby's claims are when realizing as people have so carefully attempted to explain to Bobby that the genetic information is sufficient to set in motion the morphogenesis while local conditions (epigenetics) determine the fate of the cells, and as we have seen in case of nematodes in a predictable fashion. We have also seen how the nematode vulva forms under the directions of genetic networks, local interactions.
So why is Bobby refusing to address these facts?
Mind boggling...
cobby · 25 October 2008
Some of them. Of course anything I have presented to you has been consistently ignored by you. So tell us, why do you go around calling people alcoholics?
... did call someone an alcoholic. how could i know if wayne is or not? he sounds like one tho
WWJD Bobby?
Or do you not know?
.... let discuss one the studies you allegedly have read
cobby · 25 October 2008
cobby · 25 October 2008
... latest most feared question:
... can human tissues grow in vitro?
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
cobby · 25 October 2008
I presented you with several studies, perhaps Bobby wants to discuss the nematode, and perhaps he would like to address the work done its vulva?
... well tell us why that study supports your assertion.
.... i dont know if wayne is an alcoholic. i asked him. maybe he will respond.
... why are you not familiar with the growth of human tissue in vitro? just dumb??
cobby · 25 October 2008
The same principles apply to embryogenesis.
... no it doesnt. theres your FAITH getting in the way again!
cobby · 25 October 2008
But Bobby did make a positive claim
... and what claim is that??
cobby · 25 October 2008
... pvm, are you going on and on about this hoping you will redeem yourself from the stupid comments you have made?
... its too late you are just looking stupider trying to backpedal. you need to take some college courses and learn to sharpen your mind.
fnxtr · 25 October 2008
PvM · 25 October 2008
fnxtr · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
Note that I predict that Bobby will ignore the nematode and vulva issues and continue to pretend that no objections were raised to his ignorance.
Just watch the thread and enjoy
Stanton · 25 October 2008
DS · 25 October 2008
So far the troll of many names has accused two total strangers of being an alcoholic and a pedophile. It has also complained about inappropriate language, even though it has used exactly the same language. It even complained and blamed others for it's own ignorance in response to a comment accusing it of complaining and blaming others!
It has refused to discuss even a single scientific reference for three weeks now. What could possibly be stopping it? It says it wants to discuss the papers but somehow never gets around to actually doing it. Maybe it reads the titles, but that appears to be all. It simply refuses to understand that until it proves that it has read the papers it will never know if anyone else has or not. I suppose that it can prove indefinately that it cannot understand science.
Thanks to everyone who has helped to keep it from contaminating other threads.
cobby · 25 October 2008
... pvm, are you going on and on about this hoping you will redeem yourself from the stupid comments you have made?
... its too late you are just looking stupider trying to backpedal. you need to take some college courses and learn to sharpen your mind.
cobby · 25 October 2008
...OK morons. one of you was able to wiki up the answer and you now know that some human tissues can be grown in vitro.
.... now next question: can human ORGANS be grown in vitro??
fnxtr · 25 October 2008
cobby · 25 October 2008
iml8 · 25 October 2008
Dropping back in for the moment to see what the folks in
the back room are up to with their Punching Bag ...
... ah, ya'll are up to 59 pages!
I like this. The PB is no longer amusing himself, he's
just trapped to go along with the game indefinitely
in hopes he'll have the last word. But there's more of
you than there are of him, so he can't win,
all he can do is run like the hamster on the wheel
forever. "Run, hamster, run!"
White Rabbit (Greg Goebel) http://www.vectorsite.net/gblog.html
cobby · 25 October 2008
PvM · 25 October 2008
Cobby wrote; .… still no answers on studies showing NS can evolve a complex structure.
Liar. And I do not take that word lightly. And why are you once again shifting the goalposts?
By avoidance you have shown once again that you are no match for knowledge, in fact you have shown that you actively avoid knowledge.
WWJD Bobby?
cobby · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
Remember that Bobby was presented sufficient evidence to undermine his claims, that Bobby has been unable to address this evidence nor has he been able to support his ignorance. Only through willful ignorance can Bobby avoid dealing with such issues as information content, embryology of the nematode and the nematode vulva.
In these days of ignorance, both scientific and political, it is good to have such excellent representatives who are willing to share the depth and breadth of their ignorance with all of us, helping many a uncommitted reader to make up their minds.
Ignorance does serve its purpose and Bobby should be thanked for his contributions. But at what a cost...
PvM · 25 October 2008
cobby · 25 October 2008
cobby · 25 October 2008
... oops I forgot to click my fingers *click*
PvM · 25 October 2008
I was wrong about 16 categories in fact Nakaya categorized 41 different snowflake categories. In addition, Bobby may want to familiarize himself with Lindenmayer. Science has so much to offer to Bobby and yet he keeps ignoring it.
PvM · 25 October 2008
PvM · 25 October 2008
cobby · 25 October 2008
.. wow so you found a couple of abstract by googling keywords like morphogenesis etc.
... well the first is a simulation and the second still does not show how the shapes were formed.
... did you really understand these studies? can you read them. paraphrase what they say. all you have ever done is cut and paste.
.... you really ought to take some courses in research. you are sounding stupider by the post.
cobby · 25 October 2008
"""How such trees are generated during development, and how the developmental patterning information is encoded, have long fascinated biologists and mathematicians."""
... translation: 'we have no idea how this is done'
"""We propose that each mode of branching is controlled by a genetically encoded subroutine, a series of local patterning and morphogenesis operations, which are themselves controlled by a more global master routine."""
translation: ' here is our guess'
... do you even read these abstracts??
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
cobby · 25 October 2008
dummuy, that is not quote mining that is QUOTING. do you know there is a difference?
.. you really dont understand any of this do you??
"However, how their interactions result in a branched structure has not been elucidated."
... how many times do they have to say they dont know till you believe they dont know?
cobby · 25 October 2008
"" We don’t throw up our hands and declare a miracle, but instead science gives us the tools to look deeper and work out (with much effort, admittedly) how seeming miracles occur ""
... again translation: ' we dont know how this works '
cobby · 25 October 2008
conceptual framework for understanding the interactions of these major signaling pathways in branching morphogenesis.**** future challenge is to translate understanding of the signaling cascade into knowledge of the cellular responses, including cell proliferation, migration and differentiation, that lead to the stereotyped branching. ****
...THEY DONT KNOW!!
PvM · 25 October 2008
PvM · 25 October 2008
PvM · 25 October 2008
As predicted, Bobby is quick to reject anything, even before having read the paper, just because his quote mining of the abstract causes him to believe that the authors have done nothing to remove some of the remaining areas of ignorance. It's sad to hear that even when evidence undermining Bobby's position is presented, Bobby, as many have predicted, remains unable and unwilling to address the research in any depth.
That my friends is what ignorance begets, just more ignorance. And the impact of such a foolish position is quite self evident.
PvM · 25 October 2008
So far the following 'assertions' by Bobby have not only shown to be without much merit, Bobby also has remained unable to provide any supporting evidence and research
1. The genome does not contain sufficient information
2. No instances of natural selection have been observed
3. No instances of natural selection leading to complex systems have been observed
4. Chemical gradients are only marginally useful in morphogenesis
There are a variety of lesser variants of statements by Bobby which underline his lack of familiarity with evolutionary and biological science. However, these seem to be recurring themes. Typically when cornered with facts, Bobby will chose another claim or revisits an earlier claim even though it had been shown to be lacking in evidence, logic and reason.
Fascinating behavior.
PvM · 25 October 2008
As to gradients and morphogenesis, Bobby should read the Max Planck article by Christiane Nüsslein-Volhard
Gradients That Organize Embryo Development: A few crucial molecular signals give rise to chemical gradients that organize the developing embryo
Anyone familiar with embryology knows the importance of gradients and morphogenesis.
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
Malcolm · 25 October 2008
Malcolm · 25 October 2008
Dave Luckett · 25 October 2008
Booby's invisible magical hand will always be present, simply because science will never know everything. His attack, for what it's worth, rests simply on the ancient axiom "a fool can ask questions that the wisest cannot answer." Find a question to which the answer is not yet known, and science is confounded!
It really is that simple, and that specious. All you have to do is keep asking ignorant questions until you reach the frontiers of human knowledge - which will happen, sooner or later, because human knowledge is finite. It doesn't matter that you will reach the frontiers of your own knowledge long before that, and won't understand the answers you receive. Not understanding stuff is familiar ground to ignorant people, among whom I include myself when it comes to the interaction of genetics and morphology; but the invincibly ignorant, like Booby, develop workarounds to deny their ignorance.
We've seen some of these workarounds in action here, like denial, (simple refusal to admit facts) argument from incredulity, (I don't believe this, so it can't be true) projection, (attributing to others one's own fraudulence) shifting ground (when answered, just ask another question) and false absolutism, (not everything is known, therefore nothing is known). There are others, and no doubt they can be discerned as well.
Of course these are fraudulent, and the fraud is obvious, but the point is that this simply doesn't matter to Booby, which is why this is a mug's game for science. I quite take PvM's point that Booby is making a thorough ass of himself, and that this must be plainly apparent to anyone with the slightest scintilla of ordinary common sense, but there's a point beyond which people will start to wonder if he's being taken seriously.
Further, there's a downside to gratifying him with attention like this. He's made his agenda plain a number of times. He enjoys annoying people, and he derives satisfaction from making them react. To him, it's evidence of his own importance and status. These are plainly vital issues for him, probably because people usually ignore and dismiss him. Reacting to him helps him fantasise about being a controller, with others his unwitting and unwilling toys, when he's actually only another sad, brain-dead little tosser with an ego where his brain should be.
Arguing with him is therefore like the proverbial mud wrestling with a pig. By arguing with him - even by exposing him as the contemptible fraud he is - we are actually reinforcing his behaviour. I seriously question whether there's any point to it.
Wayne Francis · 25 October 2008
Wayne Francis · 25 October 2008
Stanton · 25 October 2008
Wayne Francis · 26 October 2008
cobby · 26 October 2008
cobby · 26 October 2008
... Wayne, are you an alcoholic?
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
cobby · 26 October 2008
... well it was fun watching the hamsters run wild in their little cages after my *click* command. Of course I did not read the gibberish.
... anyhow lets get the little vermin back on track.
..... see if they can focus rather than ranting, spitting an gritting their rabid little teeth
.... OK 1. Can human tissue be grown in vitro?
2. Can human organs be grown in vitro?
cobby · 26 October 2008
... Wayne what time is it in Oz? Were you out drinking last night?
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
cobby · 26 October 2008
cobby · 26 October 2008
As for the 2nd question it depends on the organ. Pick one. There are many organs. The current answer is different depending on the organ you are talking about.
... well tell us one organ which CAN be grown in vitro!
.... youre a good monkey!
Wayne Francis · 26 October 2008
I'm off to bed. Blow Jobby has either gone away or is having a hard time figuring out the time in South Australia because he doesn't have enough fingers on one hand.
I'll point out to all the lurkers his stupidity in every post he makes in the next few hours tomorrow morning.
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
cobby · 26 October 2008
For the lurkers one organ that can be grown in the lab is skin.
.... any others??
cobby · 26 October 2008
... well I think Wayne passed out. hes right about one thing. he didnt have a hangover cuz its nite over there.
... he'll have a nasty one tomorrow. jeez he gets mean when he's drinking.
Wayne Francis · 26 October 2008
I'll exlain more on why Blow Jobby is a lying ass troll.
A ethical person that was truely interested in discussion would ask a question in the context of some statement like.
"If what PvM says is true we should be able to grow organs in vitro"
or
"If what PvM says is true we should not be able to grow organs in vitro"
But he uses a normal creationist tactic asking ambiguous questions to which he expects a certain answer which he'll pounce upon with some situation that doesn't match the answer given. The answer given would have been given in good faith it is the question that is ambiguous and misleading.
Kind of like when creationist make stupid claims about some radiometric dating then jump all over the answer because there is some exception, that is well known to scientist, that doesn't agree with the answer. Often the questions asked would take pages and pages of text to answer and honest people trying to answer the question will only answer the basic question leaving out the details.
This is the kind of dishonest question blow jobby is trying to lure people into. If he wasn't such a lying religious nut job he would state out his whole question in full. The problem with this for him is it would be so easy for everyone to show how his question is misleading at best and most likely an outright falsehood.
cobby · 26 October 2008
... Wayne, go to bed and sleep it off!
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
cobby · 26 October 2008
... Wayne go to bed and sleep it off!
cobby · 26 October 2008
Unfortunately for Blow Jobby I don’t think anyone would fall into his trap.
..... yes the ever so clever trap of asking if ' organs can be grown in vitro '!! what a diabolical, devious question to ask. this question should NEVER be asked. it is too, too deceptive!!
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
quote minded = quote mined. case of FFS (fat finger syndrome)
cobby · 26 October 2008
The heart tissue left alone would not form into a heart so this proves that there is more information needed.” All the while ignoring that we’ve said over and over that the shapes of organs are controlled not only by the stem cells turning into those organs but the cells all around that area.
.... and this of course has been proven?? has there been one experiment where any shape forming has been induced.
... there is a frantic need for shaped organs. even things like noses and ears because of the large amount of those injuries from the Iraq war. and also to replace damaged bladders etc. a researcher who could devise a way to even grow a shaped bladder would be a great hero. why isnt it happening. if we know the mechanism why arent people using that mechanism. they cannot even get an ear lobe shape to happen.
... yet i am told there are thousands of studies showing the mechanisms for shape. then why arent they growing shaped organs? i know the answer i will here: ' the check is in the mail' ' we havent gotten around to it'
.. why organs take certain shapes is 98% a mystery and it would be nice if these morons would admit it.
cobby · 26 October 2008
If I was intoxicated it would be very difficult to articulate myself so well.
.... i think you are proving my point here.
cobby · 26 October 2008
He thinks I’m mean, how nice. He shouldn’t take my insults to him to personally because they are not for his benefit but for the lurkers.
... now that made no sense. (slurp)
cobby · 26 October 2008
... those vets with blown off faces and missing limbs wish those scientists who know how to shape organs would let the rest of the world know.
cobby · 26 October 2008
If I was intoxicated it would be very difficult to articulate myself so well.
.... denial: one of the core signs of alcoholism. I think he finally passed out, whew. Some people get mean when they drink. I wonder if he is divorced.
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
cobby · 26 October 2008
...Wayne, you spend a lot of time trying to discredit someone you claim is apparently and obviously not credible. Seems illogical to me and a waste of time.
... OK couple of questions: are you saying that organs will never be able to grown in vitro? In the past were you a heavy drinker?
DS · 26 October 2008
Come on Wayne, just admit it, without the mold you don't have any idea what shape the jello will be! Corn cobby doesn't seem to notice that it is arguing against it's own position. What a microcephalic chimpanzee.
As for making unsupported accusations, that is all it has ever had. It don't need no stinkin evidence. That also explains why it is immune to evidence, it doesn't even understand the concept.
Just give up man. Leave this monkey screaming alone on a moribund thread. Two thousand off topic posts is enough. Besides, no one has come to the aid of this deviant. Obviously everyone already realizes that it doesn't have a clue.
cobby · 26 October 2008
Come on Wayne, just admit it, without the mold you don't have any idea what shape the jello will be! Corn cobby doesn't seem to notice that it is arguing against it's own position. What a microcephalic chimpanzee.
... Dave what % of the off topic post do estimate were mine and how many were the monkeys?
PvM · 26 October 2008
PvM · 26 October 2008
PvM · 26 October 2008
PvM · 26 October 2008
PvM · 26 October 2008
cobby said: .. why organs take certain shapes is 98% a mystery and it would be nice if these morons would admit it.
Cobby, it may be 98% a mystery to you and I am surprised you believe you belong it said category. Well, you said it... But to science, shape formation is hardly 98% a mystery. Anyone familiar with the facts would know how the interaction of genetics, local effects and constraints work to shape the many organs and limbs in the body. Just because Bobby refuses to educate himself does not mean that science is equally ignorant and several papers have been offered that show this.
Bobby's response other than quote mining and ridicule?
Nothing. Nothing at all.
Lurkers beware.
Science Avenger · 26 October 2008
Wow, 62 pages, and total domination of the "recent comments". Could the use of PT resources get further from optimal?
iml8 · 26 October 2008
Science Avenger · 26 October 2008
cobby · 26 October 2008
cobby · 26 October 2008
cobby · 26 October 2008
Cobby, it may be 98% a mystery to you and I am surprised you believe you belong it said category. Well, you said it… But to science, shape formation is hardly 98% a mystery.
... then why dont they grow organs?
PvM · 26 October 2008
PvM · 26 October 2008
PvM · 26 October 2008
cobby · 26 October 2008
... they grow organs? tell me more!
... and they do not know how to make fusion reactions? tell me more!
DS · 26 October 2008
PvM wrote:
"I have no idea, but I do know that you have violated the terms of services of this site. Surely you do not hold to the belief that the behavior of others is somehow an excuse for your own behavior?"
Just to be clear, I use only one name when I post and bobby/jobby/cobby/goff/hamstrung/observer/jacob/etc. has no evidence to the contrary. Then again, if it wants to argue that the behavior of others justifies it's own behavior, then I guess accusing total strangers of alcoholism and pedophilia certainly justifies calling that individual a cross dressing child molester.
Now how else could a lying ignorant troll deflect attention away from the fact that it has no evidence and no point other than name calling and complaining about name calling? If it won't read a paper, I guess that is all it has left. A brain is a terrible thing to waste.
cobby · 26 October 2008
DS, are you the same persona as Dave Stanton? and Stanton?
cobby · 26 October 2008
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
PvM · 26 October 2008
cobby · 26 October 2008
cobby · 26 October 2008
SFB once again asks a irrelevant leading and ambiguous question. Perhaps he would care to try to define what his definition of a “heavy drinker” is. Regardless if I had never had a drink, drink like I do, had 1 glass of wine every night with dinner, drank excessively one night a week or drank a bottle of scotch every night does not change the fact that all my posts about SFB,
... its not a leading question at all. you could simply answer 'no' but you did not so you must have been a heavy drinker. in fact in think you are at the best a recovering alcholic.
... why do you feel you need to justify yourself to me? you say I have no credibility but you seem to get upset if I criticize you in any way. you dont see me trying to defend your attacks. i know they are just gibberish. jeez you are so easy. its almost not fun anymore.
... anyway you have been completely wrong about 98% of what you have said here.
Wayne Francis · 26 October 2008
PvM · 26 October 2008
Wayne Francis · 26 October 2008
Stanton · 26 October 2008
fnxtr · 26 October 2008
(sigh)
A very belated happy birthday, Wayne.
We now return you to your regularly-scheduled taunting of the village idiot.
(aside to PVM: I don't think Yobbo's coming at this from a Christian perspective, he's more the Von Daniken / Heaven's Gate type)
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
Wayne Francis · 26 October 2008
cobby · 27 October 2008
the last time I had a drink was on August 30th of this year while calibrating my birthday with friends at a local pub.
... well how did the 'calibration' go? OK you on the wagon now but you have in the past been a heavy drinker, correct? now come on stop the denial!
cobby · 27 October 2008
It currently takes more energy to produce fusion here on earth artificially then the reaction produces.
... not true better study harder!
cobby · 27 October 2008
.. Wayne could you keep your rants down to like 2 paragraphs. I am not going to waste my time sifting thru the gibberish for some rational thought.
... Any if you have sobered up lets talk about the growing of organs gain. Well the main point is that you say that DNA enough info to construct a human. Yet we cannot even grow the simplest organ shape in vitro. Did the DNA disappear? Oh sure you have FAITH in your assumptions but sorry charlie thats not science.
... I know that ugly horse the sci method rears its head again but sorry charlie no cigar unless you can prove something experimentally. Now you can believe in as many pink unicorns as you want but until you show me one it is just FAITH on your part.
... so for now there is a very mysterious unknown factor in developing a human organ let alone the whole body. so you cannot say that the DNA has all the enough until you can prove it.
Wayne Francis · 27 October 2008
fnxtr · 27 October 2008
DS · 27 October 2008
fnxtr,
OK Kreskin, but you're not the only one.
Remember that I pointed out that the troll was arguing against it's own position. It has now effectively proven that the instructions in DNA are soley responsible for producing an organism. If those instructions are disrupted then the organs are usually not correctly produced, If however the instructions come from some "mysterious unknown factor" outside the body, then the organs should form just fine outside the body.
Oh well, did it really think that it could use some sort of semi-logical approach and show that all developmental biologists are completely wrong? It should just go screw itself into a light socket.
Stanton · 27 October 2008
Stanton · 27 October 2008
Wayne Francis · 27 October 2008
- SFB does not capitalize the first word in a sentence. Something most people learn to do in kindergarten or first grade.
- SFA can not decide if he wants to use a contraction with the auxiliary verb "can" and the adverb "not" so instead of putting a space between the 2 words or using the proper contraction of "can't" he invents some new grammar.
- SFA finally can't even hold a thought to the end of the sentence "so you cannot say that the DNA has all the enough until you can prove it."
The more I think about it ADHD would explain almost everything with SFB. Still he is a lying deceitful wilfully ignorant arrogant troll.cobby · 27 October 2008
.. First of all I cant believe someone would waste their time crticizing someones spelling and grammar here. i really an not concerned about that. i do this stuff in between what i am working on as a bit of diversion. i dont take it seriously.
cobby · 27 October 2008
The “cake mold” for an organ comes not only from the chemical signals from cells forming into that organ but chemical signals from cells adjacent to that organ.
... nice belief but its just a guess. where are the experiments??
cobby · 27 October 2008
. Astronomy is full of stuff that we will probably never “prove” experimentally.
... no wrong gain. what is this 'stuff'?
cobby · 27 October 2008
Science can not “prove” anything. Science can give the best explanation that fits the data.
.... evolution has not been proven? should that fact be taught in schools?
cobby · 27 October 2008
Remember that I pointed out that the troll was arguing against it’s own position. It has now effectively proven that the instructions in DNA are soley responsible for producing an organism.
... I was just told nothing can be proven
If those instructions are disrupted then the organs are usually not correctly produced, If however the instructions come from some “mysterious unknown factor” outside the body, then the organs should form just fine outside the body.
... no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape.
... you are basically saying 'gradients-did-it'. attributing the process to unmeasurable, untestable forces. aka pseudoscience.
cobby · 27 October 2008
It currently takes more energy to produce fusion here on earth artificially then the reaction produces.
... the above has been demonstrated several times not to be true. please study much harder.
PvM · 27 October 2008
PvM · 27 October 2008
PvM · 27 October 2008
PvM · 27 October 2008
PvM · 27 October 2008
cobby · 27 October 2008
cobby · 27 October 2008
cobby · 27 October 2008
... where's Wayne? is out calibrating with the boys again??
DaveH · 27 October 2008
Henry J · 27 October 2008
Dan · 27 October 2008
PvM · 27 October 2008
PvM · 27 October 2008
Henry J · 27 October 2008
DS · 27 October 2008
And there you have it folks. It's going with the magic invisible hologram hypothesis. As I predicted over 1000 posts ago, it's just those pesky photons. Notice how the invisible magic hologram can work within the uterus but cannot possibly determine organ shape outside the body, truly amazing.
Seriously, either the mechanism works outside the body or the hologram hypothesis makes no predictions different from the chemical gradient model and the whole organogenesis argument becomes no more than another exercise in mental masturbation.
If anyone seriously doubts the importance of chemical gradients in fruit fly development, just read the textbook Molecular Cell Biology. There is a wonderful figure of the chemical gradients in the fruit fly embryo in the very first chapter. I would reproduce it here, but don't want to violate copyright laws. The chapter on development describes in detail how the gradients are established, how they affect gene expression and how they specify body segment and appendage identity. Naturally the troll is expressly forbidden from reading the book or educating itself in any way.
DS · 27 October 2008
For anyone who is really interested:
During development, diffusible ligands, known as morphogens, are thought to move across fields of cells, regulating gene expression in a concentration dependent manner. The case for morphogens has been convincingly made for the Decapentapleigic (Dpp), Wingless (Wg) and Hedgehog (Hh) proteins in the Drosophila wing. In each case, the concentration of the morphogen’s receptor plays an important role in shaping the morphogen gradient, through influencing ligand transport and/or stability. However, the relationships between each ligand/receptor pair are different. The role of heparan sulfated proteoglycans, endocytosis and novel exovesicles called argosomes in regulating morphogen distribution will also be discussed.
Cadigan, K.M. (1998) Regulating morphogen gradients in the Drosophila wing. Seminbars in Vell and Developmental Biology 13(2):125.
Anybody got a reference for the invisible holgram hypothesis?
DS · 27 October 2008
That should be:
Seminars in Cell and Developmental Biology
DaveH · 27 October 2008
cobby · 27 October 2008
cobby · 27 October 2008
fnxtr · 27 October 2008
My thermos keeps hot liquids hot, and cold liquids cold. How does it know how to do that?
Wayne Francis · 27 October 2008
Wayne Francis · 27 October 2008
cobby · 27 October 2008
cobby · 27 October 2008
...OK morons. hows the human femur know when to stop lengthening?
Wayne Francis · 27 October 2008
Wayne Francis · 27 October 2008
DS · 27 October 2008
Notice that the troll has moved the goal posts yet again. First it claimed that the chemical gradients were "unmeasurable" and "untestable". Now, forced once again to realize that it is wrong, it claims that the gradients actually do exist and can be measured but that they don't determine the shape of the wing. No alternative explanation for their function is offered of course. How hypocritical can you get?
Where is this mysterious hologram? How is it made? Why is it invisible? Why does it operate in the uterus and not outside the body? How does the hologram determine shape? Why is there absolutely no evidence for any of this nonsense? Who cares about the ravings of a deluded lunatic who accuses total strangers of being alcoholics instead of familarizing itself with the evidence? Man, if ignorance is bliss this troll should be the happiest guy around.
Wayne Francis · 27 October 2008
Wayne Francis · 27 October 2008
Wayne Francis · 27 October 2008
Wayne Francis · 27 October 2008
tresmal · 27 October 2008
Wayne Francis · 27 October 2008
Wayne Francis · 27 October 2008
Henry J · 27 October 2008
Wayne Francis · 27 October 2008
DS · 27 October 2008
Wayne wrote:
"I can show this claim to be false. If there was some type of “holographic construction” then you would not see people with 6 fully functioning fingers. You would not see science experiments where scientist can make a fruit fly grow legs where its antennas should be."
As already noted several times, the mere fact that mutations that alter chemical gradients and also alter morphology is strong evidence that those gradients in fact determine the morphology.
Unless of course the antennapedia mutation affects the hologram and not just the chemical gradient. But in that case the hologram is simply an unnecessary and redundant hypothesis that really isn't needed at all, so the troll loses again. That makes ninety eight times in a row in this thread alone.
Wayne Francis · 28 October 2008
Marek14 · 28 October 2008
I agree with everything you say, Wayne Francis, except for one thing:
"Cannot" is, indeed, the proper negative of "can". Not "can not".
cobby · 28 October 2008
cobby · 28 October 2008
Any bets on SFB aka Cobby/Jobby/Bobby/Jacob actually producing any evidence of successful controlled fusion with a net surplus of power?
... dummy, that was not the original question. learn to read.
cobby · 28 October 2008
…Sater, A. K. and Jacobson, A. G. 1990. Restriction of the heart morphogenetic field in Xenopus laevis. Devel. Biol. 140: 328-336.
.… end your ignorance and read the article!
.... please willfully ignorant trolls. read the article and quit being dumb
DS · 28 October 2008
I think I'll wait for the reference on the magic invisible hologram. Man that should be a good one. Very well kept secret after all.
SWT · 28 October 2008
cobby · 28 October 2008
SWT · 28 October 2008
Henry J · 28 October 2008
DaveH · 28 October 2008
I've only read the abstract of Sater and Jacobson 1990, (not having a subscription to the Journal of Developmental Biology), but I have read a couple of papers that reference it. Serbedzija et al (Development 125, 1095-1101 (1998)) is a good one. What does jobbie think it's showing us?
Wayne Francis · 28 October 2008
Henry J · 28 October 2008
Eric Finn · 28 October 2008
DaveH · 28 October 2008
DaveH · 28 October 2008
Ooops, that's just a citation as well. Interesting article, though.
Jobbie seems to be stuck in the 1920s!
Eric Finn · 28 October 2008
I apologize my loose googling.
The link I provided does not seem to link to the article in question. I am sorry.
Regards
Eric
Henry J · 28 October 2008
cobby · 28 October 2008
cobby · 28 October 2008
… then how does the body know when to produce the ”certain proteins produced in larger quantities during puberty”?
... no anwer? or is your answer 'Godditit'??
cobby · 28 October 2008
“How do I know when I’m hungry"
.. actually there have been a lot of studies on what causes hunger. it is still a bit of a mystery. but they are honest scientists and admit the answer is elusive. unlike Darwinists.
cobby · 28 October 2008
“How does my body know to heal itself when I get cut”
.... this also has been studied. you act like these are silly questions. have you heard of hemophilia??
DaveH · 28 October 2008
DaveH · 28 October 2008
cobby · 28 October 2008
Puberty begins consistently at around 47 kg for girls and 55 kg for boys.
... then how does the body know what its weight is?? the real answer is they do not know
SWT · 28 October 2008
cobby · 28 October 2008
cobby · 28 October 2008
cobby, you must have missed this response. Have you read this paper? If so, why do you think that it is in any way supportive of anything you’ve posted here?
Inquiring minds want to know!
... have YOU read the paper??
SWT · 28 October 2008
PvM · 28 October 2008
PvM · 28 October 2008
DaveH · 28 October 2008
cobby · 28 October 2008
cobby · 28 October 2008
DS · 28 October 2008
So, no paper on holograms, no evidence for the hologram hypothesis. Instead the troll asks everyone else to read a paper that it hasn't read that doesn't support it's position. Why a thirty year old paper anyway?
And of course it hasn't answered any questions about the hologram hypothesis either. Where does it come from? Is there a separate hologram for the larval, pupal and adult stages? How does a hologram tell the cells to form a certain shape? How do the cells know what to do? What are all these gradients for if they don't have anything to do with development? Why do changes in the gradients affect wing shape if wing shape is determined by the hologram? Why can't anyone see this hologram? Does the hologram work in the dark? What intelligence is producing this hologram? Why does it care so much what shape a fly wing is? Are the photons processed in the magnetic field of the earth? And most importantly, who cares about a magic invisible hologram?
cobby · 28 October 2008
So, no paper on holograms, no evidence for the hologram hypothesis. Instead the troll asks everyone else to read a paper that it hasn’t read that doesn’t support it’s position. Why a thirty year old paper anyway?
... still applies
And of course it hasn’t answered any questions about the hologram hypothesis either. Where does it come from? Is there a separate hologram for the larval, pupal and adult stages?
How does a hologram tell the cells to form a certain shape? How do the cells know what to do?
... needs reseach
What are all these gradients for if they don’t have anything to do with development?
the follow the image
Why do changes in the gradients affect wing shape if wing shape is determined by the hologram?
Why can’t anyone see this hologram?
... same reason we cant see gravity
Does the hologram work in the dark?
... no
What intelligence is producing this hologram?
... not know
Why does it care so much what shape a fly wing is?
...not known
Are the photons processed in the magnetic field of the earth?
...photons arent involved
And most importantly, who cares about a magic invisible hologram?
...well obviously you do. its no more magic than graivity.
...any of the above questions can be applied to gravity
Henry J · 28 October 2008
DS · 28 October 2008
And there you have it folks. Chemical gradients are "unmeasurable" and "untestable" but the magic invisible hologram that doesn't use photons and doesn't work in the dark is a hypothesis that should be preferred. HA HA HA HA HA. Very funny. Next time you screw yourself into a light socket, forget the light socket.
Dave Lovell · 28 October 2008
Malcolm · 28 October 2008
Henry J · 28 October 2008
Wayne Francis · 28 October 2008
DaveH · 28 October 2008
cobby · 28 October 2008
cobby · 28 October 2008
... trying to explain anything other than the simplest concepts here is like trying to teach my dog algebra. a truly brainless bunch. nothing but jeers and gibberish
SWT · 28 October 2008
tresmal · 28 October 2008
Jobby, the paper you asked us to read doesn't seem to be online. If I'm wrong can you provide a link?
I have read one of the articles that cite the paper and I have an hypothesis. Jobby caught the term "morphogenetic field" and assumed it was some sort of mysterioso phenomenon, therefore possibly something to do with his missing "information". In reality the gradients he is so dismissive of, explain the morphogenetic field.
Wayne Francis · 28 October 2008
Wayne Francis · 28 October 2008
Wayne Francis · 28 October 2008
- Ignore your post full stop
- Insult you without addressing your post
- Throw out a line from the paper that doesn't support anything he has said in hopes that lurkers will just believe that it some how supports SFB side
I'm doubtful on #3 though. It would require him to look at the paper long enough to cut and paste.Henry J · 28 October 2008
DS · 28 October 2008
Well now all the troll has to do is explain how mutations in DNA alter the hologram projector and how it can determine the shape of human organs in the uterus if it can't work in the dark. Of course I grow fruit flies in the dark all the time and they come out just fine, so I guess the magic invisible hologram doesn't affect wing shape after all.
I guess trying to con people with nonsense only works if the people are sufficiently ignorant. The troll picked the wrong audience to try to sell it's crapola to. Oh well, at least it can no longer contaminate any other threads with it's jumping monkey feces slinging. Man this nut job won't even read a paper it comes up with.
Malcolm · 28 October 2008
Wayne Francis · 28 October 2008
- Ignore your post full stop
- Insult you without addressing your post
- Throw out a line from the paper that doesn't support anything he has said in hopes that lurkers will just believe that it some how supports SFB side
I'm doubtful on #3 though. It would require him to look at the paper long enough to cut and paste. ...the unicorn are pink. ...study harder. That is my attempt of being like SFB a.k.a. jobby/cobby/bobby/jacob.Wayne Francis · 28 October 2008
That was odd. Sorry for the post merging with my last one.
fnxtr · 28 October 2008
Still more coherent than anything from Yobbo, Wayne. Of course it's not like Yobbo actually goes out of his way to, you know, explain anything, it's all just "Darwinism is insufficient", end of story.
Maybe he's afraid someone will steal and publish his ideas.
Can't wait for "study harder" to turn into "buy my book".
Wayne Francis · 29 October 2008
Eric Finn · 29 October 2008
cobby · 29 October 2008
...OK the trolls were out in their usually ugly selves. But let recap thru all the crap. Well of course some how the dimensions of the pelvis could be stored in the DNA and then the 'gradients' could do their job and direct the construction of the femur. But again thru all their obfuscations the trolls still cannot explain how all that info can be contained in 750
MB. and again the science stopping trolls when presented with an idea like a morphic field that guides development which is supported by many mainstream scientists go thru their ritualistic pounding of chests, spitting and gritting their teeth. 'no new ideas here' they shout and spit.
... the anti-science trolls do not understand that somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
... now of course there could be other storage methods in the DNA other than the 4 positions or the info could be obtained from an external source or done in a way yet unknown. but trolls. DNA IS NOT SACRED!. these trolls remind me of science fiction movie where the humans want to move some sort of rock statue of the sub-humans god and the sub-humans destroy everything in site in a spitting rage.
... the primal reaction of the trolls here gives away their emotional attachment to Darwinism and DNA. the hostility to new ideas is enormous. science can never move forward if criticism of the status quo is met with such primal aggression.
... no I will sit back and wait for the ritualistic spitting, cursing, and attacking by the anti-science trolls
Dan · 29 October 2008
Wayne Francis · 29 October 2008
cobby · 29 October 2008
DS · 29 October 2008
Somehow that seems strangly appropriate for comment 1984.
fnxtr · 29 October 2008
To paraphrase Arthur Dent, is this some new usage of the word 'childish' I wasn't previously familiar with?
I never knew 'childish' meant 'accurate/pithy' before.
SWT · 29 October 2008
cobby · 29 October 2008
... if there is anyone posting here with a decent amount of education and intelligence who would like to seriously discuss any of this please respond here. Trolls: please go elsewhere. Thank You.
SWT · 29 October 2008
PvM · 29 October 2008
PvM · 29 October 2008
PvM · 29 October 2008
cobby · 29 October 2008
Saddlebred · 29 October 2008
cobby · 29 October 2008
cobby · 29 October 2008
Saddlebred · 29 October 2008
SWT · 29 October 2008
cobby · 29 October 2008
DaveH · 29 October 2008
Henry J · 29 October 2008
DaveH · 29 October 2008
Saddlebred · 29 October 2008
DS · 29 October 2008
Well we could all just discuss the paper and leave the troll out of the discussion. Sure why not? Once all the big sciency words come out it will be completely lost anyway. Of course then it couldn't complain any more about people not responding and not discussing something or other. After all, we're over 2000 posts now. Why not have a meaningful discussion that doesn't concern magic invisible holograms or pink unicorns or little blue devils?
Here, I'll get the discussion started. What proteins and genes are responsible for producing the morphogenic fields mentioned in the paper? How are these genes regulated? How did they study gene expression patterns back then before ectopic gene expression assays and genetic engineering of chimeric gene expression constructs were available? Has there been any more recent investigations of heart development using more sophisticated techniques? What progress has been made in the understanding of heart development in the last twenty years?
Corn cobby choose this reference a week ago and now claims he doesn't have time to discuss it. Who cares? We don't need it to discuss anything.
PvM · 29 October 2008
PvM · 29 October 2008
PvM · 29 October 2008
Malcolm · 29 October 2008
Henry J · 29 October 2008
DS · 29 October 2008
The abstract:
We have examined the spatial restriction of heart-forming potency in Xenopus laevis embryos, using an assay system in which explants or explant recombinates are cultured
in hanging drops and scored for the formation of a beating heart. At the end of neurulation at stage 20, the heart morphogenetic field, i.e., the area that is capable of heart formation when cultured in isolation, includes anterior ventral and ventrolateral mesoderm. This area of developmental potency does not extent into more posterior regions. Between postneurula stage 23 and the onset of heart morphogenesis at stage 28, the heart morphogenetic field becomes spatially restricted to the anterior ventral region. The restriction of the heart morphogenetic field during postneurula stages results from a loss of developmental potency in the lateral mesoderm, rather than from ventrally directed morphogenetic movements of the lateral mesoderm. This loss of potency is not due to the inhibition of heart formation by migrating neural crest cells. During postneurula stages, tissue interactions between the lateral mesoderm and the underlying anterior endoderm support the heart-forming potency in the lateral mesoderm. The lateral mesoderm loses the ability to respond to this tissue interaction by stages 27-28. We speculate that either formation of the third pharyngeal pouch during stages 23-27 or lateral inhibition by ventral mesoderm may contribute to the spatial restriction of the heart morphogenetic field.
PvM · 29 October 2008
PvM · 29 October 2008
DS · 29 October 2008
Sorry, forgot the reference for the above abstract:
Dev. Bio. (1990) 140:328-336
Of course we have learned a great deal about vertebrate heart development since then. It is after all a rather important topic, medically speaking. For anyone who is really interested, here are a few more references from more recent articles on frog heart development:
Dev. Bio. (1994) 165:432-441
Dev. Genet. (1998) 22:230-238
Devlopment (1999) 126:1739-1751
Dev. Bio. (2000) 218:74-88
Sem. Cell Dev. Bio. (2007) 18:46-53
Funny. all of these seem to concern protein gradients created by cascades of gene expression. No mentoion of holograms, unicorns or blue devils. And they all seem to work in the dark. Go figure.
PvM · 29 October 2008
SWT · 29 October 2008
cobby · 29 October 2008
I can walk you thru all of this if you have the patience. Go to my first mention of the word holograph etc. And read carefully! Actually I do not think any one is really trying to have an academic conversation. Really seems like trolls with too much time on their hands. The new literature supports what I am getting at. The trolls have still not come up with studies to support their claims. If the trolls could read well they would see that I did not claim that holograms store info. Trolls go back and read very slowly what I said. I think if you read it several times you might be able to understand it.
DS · 29 October 2008
Just be patient guys. In another month and another 2000 posts the troll of many names will definately:
stop making jumping monkey jokes
stop complaining about foul language
stop accusing total strangers of being pedophiles and alcoholics
read all papers recommended (even the ones it recommended)
come up with at least one reference that acutally supports it's claims
stop making up self-contridictory nonsense with no evidence whatsoever
admit that proteins aren't just "bricks"
admit that chemicals gradients are measurable and testable
quit yanking your chain and admit it really doesn't have a clue
After it does all that, I guess someone might be interested in something it tries to explain, but I know it won't be me. Destroying your credibility has consequences. TIme for the troll to pay.
cobby · 29 October 2008
cobby · 29 October 2008
... again if anyone wants to intelligently talk about these things please respond. trolls please do not respond. thank you.
cobby · 29 October 2008
Spectrin and ankyrin are two essential proteins acting like bricks and mortar to shape and fortify cell membranes. But distinguishing which protein is the brick and which is the mortar has turned out to be difficult. New evidence suggests that spectrin can do both jobs at once.
Ron Dubreuil, associate professor of biological sciences at the University of Illinois at Chicago, reports the finding in the Oct. 23 issue of the Journal of Cell Biology.
... someelse thinks proteins are 'bricks'. you trolls looks so petty and foolish!
cobby · 29 October 2008
.. I have to admit. I am a bit guilty in feeling so much smarter than these trolls. its a bit of a guilty indulgence. but its just so easy. i wish one could give me a little challenge. oh well
Wayne Francis · 29 October 2008
cobby · 29 October 2008
So for pointing his mistakes out he thinks we are childish trolls.
... no i think you are childish for not sticking to the subject and having these tantrums. why would a grown man waste so much time just tearing apart another person
... lets stick to debating the issue. can you do that, troll?
cobby · 29 October 2008
Is having sex in the dark a method of birth control?
... here is an example of the childishness. really sounds so junior high
Wayne Francis · 29 October 2008
- Why does your "Magical Hologram Hypothesis" not work in the dark?
- Does this mean that if I have sex with my girlfriend in a dark room she can not get pregnant?
- Why do you think that protein gradients do not work in 3d?
- Why have you never been willing to discuss any scientific paper, including ones that you, yourself, have picked?
- Why do you make claims then in later posts claim that you never said those claims?
I, of coarse, don't expect you to answer any of these questions because they expose your ignorance, arrogance and lying behavior. I fully expect you to either call me an alcoholic or just ignore me. Come on and surprise me and answer just one of the questions and back up your answer.Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
cobby · 29 October 2008
1. Why does your “Magical Hologram Hypothesis” not work in the dark?
... i have not such theory
2. Does this mean that if I have sex with my girlfriend in a dark room she can not get pregnant?
... wow that was really beavis
3. Why do you think that protein gradients do not work in 3d?
... beavis when did i say that?
4. Why have you never been willing to discuss any scientific paper, including ones that you, yourself, have picked?
... lets discuss. you are the one making the beavisesque slams
5. Why do you make claims then in later posts claim that you never said those claims?
... well just cut and paste what i said.
( sounds like hes been drinking again. )
cobby · 29 October 2008
Wayne Francis · 29 October 2008
cobby · 29 October 2008
We’ve shown how your “hologram hypothesis” is lacking any merit.
... so what. dummy you missed the whole point. i DONT have a “hologram hypothesis”.
that was yet another invention of your pickled brain. you really ought to get off the sauce because it is ruining you ability to read. put the beer down and go back to my original statement on hologr* and pasted it here and lets talk about it.
Wayne Francis · 29 October 2008
cobby · 29 October 2008
Because you’re little brain couldn’t understand the joke above SFB I’ll explain it in tiny words.
... well you had to copy my 'translation' schtick. imitation is the sincerest form of flattery. you dont seem me imitating any thing clever that you do. well i guess that is impossible since you DONT do anything clever.
... go ahead try!
cobby · 29 October 2008
It is not a waste of time tearing you down. Shedding light on the darkness of ignorance is a noble act and I’ll gladly continue doing it.
... dummy you dont shed light by going into a rant. use some logic! ( his brain is pickled. )
cobby · 29 October 2008
.. i think i do this the same reason chess masters play 20 people at once. its hard to find good competition and doing 7 or 8 of these guys at once is the only way to make a level playing field here. of course i doing computer work in the interim.
cobby · 29 October 2008
i think wayne finally passed out. he doesnt have a tag team buddy tonite and he cant keep up
cobby · 29 October 2008
poor sot!
tresmal · 29 October 2008
Thanks for the abstract DS. I don't suppose that the paper itself is online? Anyway from the abstract I see nothing that supports jobby's views and much that is consistent with everybody elses. The hypothesis that jobby picked up on the term "morphogenetic field" and wrongly assumed it was some sort of unworldly entity supportive of his position seems to be confirmed. The fact that he won't explain why he thought this paper supported his claims or even acknowledge that other people here have read it also supports the hypothesis.
He seems to be getting a bit colicky. It must be time for his evening Thunderbird.
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
Stanton · 29 October 2008
PvM · 29 October 2008
PvM · 29 October 2008
PvM · 29 October 2008
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
Wayne Francis · 29 October 2008
DS · 29 October 2008
So someone refers to two proteins as "bricks" and therefore, by the logic of the troll of many names, presto, all proteins thus become "bricks". Just priceless. What a waste of protoplasm this jerk is. It is truly a legend in it's own mind. No wonder no one here is intelligent enough to understand his imaginary hypothesis.
It also seems to be suffering from some advanced form of schizophrenia. I guess we could have deduced that from the number of times it has changed it's name. It can't seem to remember which side of the argument it is supposed to be on or to distiinguish analogy from reality. Of well, it was amusing for a while. Thanks to Wayne for documenting what a lying hypocrite it really is. Why does it think that everyone will forget everything it posted over the last month, just because it did?
I don't know if that entire article is available on line for free. Who cares? The troll hasn't read it and no one else needs to. We can all tell from the abstract that it is the same as all the other papers that describe the different genes that create the morphogenic gradients. Still, sex in the dark might not be a bad idea. At least if you don't try to use it as a method of birth control.
Henry J · 29 October 2008
Well, a few interesting things did manage to come up in the thread: gradients; morphogenetic fields; the mechanism that initiates puberty. On that last one, I wonder how that trigger is affected by differences in build (bone thickness)? Another question, do heavy kids tend to hit puberty earlier than thin kids?
Henry
Wayne Francis · 29 October 2008
PvM · 29 October 2008
fnxtr · 29 October 2008
Malcolm · 30 October 2008
I wonder what the troll thinks puts the bricks together, given that DNA only codes for proteins.
Maybe unseen monohorned ungulates of indeterminate colour put them together.
DaveH · 30 October 2008
cobby · 30 October 2008
Well you claim that protein gradients can’t control the shapes of organs.
.... when did I claim that??
cobby · 30 October 2008
Still waiting for SFB to actually discuss the problems with his hypothesis
... what hypothesis is that? you really need to read things about 3 or 4 times so you do not get confused
cobby · 30 October 2008
I wonder what the troll thinks puts the bricks together, given that DNA only codes for proteins.
.... YOU tell ME.
cobby · 30 October 2008
… no because it seems that the information is in some sort of holographic construction and once removed from its original position it loses its ability to make a shape.
.... so THIS is my 'theory'?? you trolls are pitiful!
Malcolm · 30 October 2008
Wayne Francis · 30 October 2008
cobby · 30 October 2008
and that proteins are just bricks.
... you are saying the proteins determine the shapes of organs? or are they just building blocks arranged by another method?
fnxtr · 30 October 2008
As I've noticed before, Yobbo, you are very careful never to clearly explain your theory/hypothesis/neurosis. That way you can still claim "I never said that".
...and responding to this with an "I know you are but what am I" won't change the above fact. I'm not arguing against the current standard model, you are. You need to present your perspective, clearly and completely. If you have the balls, which I doubt.
DS · 30 October 2008
Well if corn cobby disavows any knowledge of the hologram hypothesis, perhaps it can demonstrate where it stold the idea from. Then we can all evaluate the merits of this ground breaking hypothesis. It certainly can't claim that it never advanced the idea, since the peskly evidence is there for all to see.
Oh well, just another round of insanity from the schizophrenic, microcephalic, feces slinging chimpanzee. Perhaps there are really four or five posters using the cobby persona. If so, they really should read what the other ones write. Self contradiction is not a very good style of argumentation. Denying that you made claims on a thread with 70 pages of evidence is not going to work and reasking questions that have already been answered one hundred times is not going to fool anyone either. If it really wants an education, perhaps it should start by reading the recommended references.
Of course it could be the one that has the problems with alcoholism. I hear that does cause problems with short term memory loss in the advanced stages. Maybe Wayne will have the patience to find and repost all of the explanations and references for morphogenic fields that have been offered to the troll, I know I don't.
DaveH · 30 October 2008
cobby · 30 October 2008
PvM · 30 October 2008
PvM · 30 October 2008
PvM · 30 October 2008
PvM · 30 October 2008
cobby · 30 October 2008
PvM · 30 October 2008
Henry J · 30 October 2008
Conclusion: people who know stuff sometimes talk more than people who don't actually have anything to say.
DS · 30 October 2008
Well I guess when you're schizophrenic you can demand that people have patience and then accuse them of spending too much time here. Oh well.
If anyone is still interested, here are two more articles with lots of pretty pctures of the "bricks" that control the shape of fruit fly wings:
Development (1993) 117:597-608
Genetics (2005) 171:625-638
These articles are freely available through pubmed. The troll could educate itself, but that seems highly unlikely. No evidence of any holograms, pink unicorns or blue devils, too bad.
cobby · 30 October 2008
cobby · 30 October 2008
Malcolm · 30 October 2008
PvM · 30 October 2008
PvM · 30 October 2008
DS · 30 October 2008
Yea, transcription factors are just "bricks". Hox gene products are just "bricks". Enzymes are just "bricks". DNA polymerases and transposases and reverse transcriptases are just "bricks". Gated ion channels are just "bricks". Electron transport chains are just "bricks". Only someone with just "bricks" for brains would try to claim that. I guess the troll never read that textbook I recommended. Who would have thunk it?
Man, those pictures in those papers sure don't look like "bricks". Nothing that looks like a hologram either. The troll seems to have gone into the manic jumping monkey phase of it's bipolar disorder again. No longer desperate to explain it's nonexistent hypothesis, it now resorts again to taunting and name calling, accusing others of the behavior it alone exhibits.
Wayne Francis · 30 October 2008
Wayne Francis · 30 October 2008
Wayne Francis · 30 October 2008
DS · 30 October 2008
Thanks for the links DaveH. I guess real scientists really do understand what controls bone shape after all, amazing. Just gene regualtion creating morphogenic fields after all.
Now, if the troll can explain how all the proteins involved are just "bricks" then I guess someone might take it seriously. Of course, this is the nut job that stated that "chemical gradients are only marginally effective" at determining the shape of structures. So I guess all the Hox gene products are just "bricks" as well. When it has demonstrated that it understands protein structure and function perhaps someone will care about what it has to say, but it won't be me.
cobby · 31 October 2008
cobby · 31 October 2008
Stanton said: So, do you plan on ever producing any example where Creationists, Intelligent Design proponents or any other assorted evolution-denier groups, were able use the Scientific Method to put forth alternative scientific hypotheses that could explain biological, paleontological and or geological phenomena better than current scientific theories, or are you just going to continue on with your useless, yet snide babbling?
.... can you put forth a TESTABLE hypothesis for Darwinism??
DS · 31 October 2008
Once again the schizophrenic troll apes the behavior or real scientists, never realizing that it is displaying exactly the type of unsound reasoning that it ridicules. So "bricks" is an analogy huh? Yea, sure. And here I thought it meant that proteins were literally made of rock, no wonder no one can understand the ravings of this deranged lunatic, after all, it's just so much smarter than all the rest of humanity.
For anyone who has been paying attention, the point is that the analogy is fundamentally flawed and has led to an erroneous conclusion on the part of the troll of many names. Proteins are not a homogeneous asemblage of molecules. There ia an almost infinite variety of shapes sizes and functions for proteins. To try to pretend that they are all just "bricks" is like saying that insects are all "bad". If the troll ever gets around to reading the textbook I recommended, it is in for a big surprise.
I grow weary of wrestling with a mental midget, so here is a challenge for the troll. If it can describe in detail what transciption factors are, where they come from, how they are produced, what their structure is, what their function is and how they can reasonably be described as "bricks" in any meaningful sense of the word, then I will read every scientific reference on the hologram hypothesis. Until then, it can take it's flawed and simplistic analogy and it's delusions of grandeur and shove them up it's favorite orifice.
In the meantime, just ask yourself, why hasn't this genius explained how changes in DNA affect the hologram, or how it can work in the uterus if it doesn't work in the dark? This nut is truly a legend it it's own mind. I think it spends way too much time here trying to explain things it knows nothing about. That can't be healthy.
rog · 31 October 2008
Just a reminder, Cobby…Jacob has passive-aggressive disorder and should get some professional help.
Passive-aggressive behavior traits: Ambiguity, Avoiding responsibility by claiming forgetfulness, Blaming others, Chronic lateness and forgetfulness, Complaining, Does not express hostility or anger openly (e.g., expresses it instead by leaving notes), Fear of authority, Fear of competition, Fear of dependency, Fear of intimacy (infidelity as a means to act out anger): The passive aggressive often can’t trust. Because of this, they guard themselves against becoming intimately attached to someone., Fosters chaos, Intentional inefficiency, Making excuses, Losing things, Lying, Obstructionism, Procrastination, Resentment, Resists suggestions from others, Sarcasm, Stubbornness, Sullenness, Willful withholding of understanding
The last trait is especially diagnostic.
This thread has been confirmed that communication with him will be fruitless until he gets the help he needs.
PvM · 31 October 2008
cobby · 31 October 2008
cobby · 31 October 2008
cobby · 31 October 2008
PvM · 31 October 2008
PvM · 31 October 2008
DS · 31 October 2008
TRANSLATION: I DON"T KNOW AND I DON'T WANT TO KNOW.
Well, if the troll can't even be bothered to learn what transcription factors are then perhaps it should just go away. After all, an uninformed opinon is worthless.
If anyone is really interested and doesn't already know, transcription factors are proteins that control the expression of genes. So, in the analogy they are not bricks, since they are not structural components. In the analogy they are the instructions for when to make which types of bricks and where. Other proteins are the brick makers and the brick transporters. Proteins control the brick makers and the brick layers. They direct the construction and assembly of the structural components.
Take heat shock proiteins for example. They are not produced until the organism undergoes heat stress. Then, certain transcription factors are produced that induce the production of proteins that are resistant to heat denaturation. The transcription factors are not structural components of the cell, indeed they are only produced under certain circumstances as a adaptive response. They are not "bricks" in any meaningful sense.
Of course the troll is incapable of reading any post over two sentences in length, even though it begs everyone to read it's deranged rantings over and over. No wonder it can't read an scientific paper. No wonder it doesn't know what transcription factors are. More is the pity. Oh well, at least some people are learning some things here.
Henry J · 31 October 2008
If I thought there was a chance somebody actually wanted a testable prediction of "Darwinism", I'd say something about nested hierarchies from multiple sources, geographic distribution of species, distribution of species in time, and maybe even correlations between genetic "distance" with fossil time lines, or that most traits (and proteins) are known to exist in a variety of forms in various species. But what would be the point?
Stanton · 31 October 2008
Robin · 31 October 2008
cobby · 31 October 2008
cobby · 31 October 2008
nested hierarchies from multiple sources,
.... those prove natural selection can cause new phyla?? dont think so!
Robin · 31 October 2008
PvM · 31 October 2008
fnxtr · 31 October 2008
Ya, but Yobbo's all about the "natural selection isn't enough" evasive tactic(never mind that his concrete skull is immune to the drilling everyone's been trying to deliver that no-one (currently here at least) said it was), without actually having the guts to say what he thinks does create new phyla. We've had hints of space aliens and holographic fields (probably from another dimension... maybe it's The Old Ones? Cthulhu?), but nothing you could actually call, say, an idea.
Henry J · 31 October 2008
One thing about "new phyla" - people stuck the label "phyla" on large taxonomic groups that have had on the order of a half billion years to diverge from each other. Had there been scientists to study them at the end of the Cambrian, they would probably have called them something equivalent to family or order, with "animal" being at that point a class in a phylum within the eukaryote domain.
That illustrates one major drawback to having an absolute rank system applied to clades; it obscures the fact that the beginning of a taxonomic group (below domain rank, anyway) was simply a speciation event, and at the time it happened it was no more dramatic than any speciation event today.
Henry
(Btw, "clades" and "speciation" aren't in the spell checker.)
Malcolm · 31 October 2008
cobby · 31 October 2008
Nevertheless, the evidence from these many additional sources of data simply confirm that Darwin was correct in his conclusions that all living things have descended from a common ancestor and can be placed within a tree of life, and that the principle process guiding their descent has been natural selection.
... again there is plenty of evidence that confirms the 'everything was created last thursday' hypothesis. you need a TEST that could possibly falsify. got one??
cobby · 31 October 2008
First referenced used is by me on page 9 of this thread:
... well that proves my point. i have used it long before this thread. nice try at deception!
Malcolm · 31 October 2008
cobby · 31 October 2008
… one byte, one letter of the alphabet is enough info for even the design of a fingernail? you are totally ignorant.
Translation: “I don’t have a rebuttal so I’ll just toss out the usual litany of insults and nonsensical statements.”
Robin replied to comment from jobby | September 25, 2008 11:15 AM | Reply jobby said:
... robin, you really need to get a life. i cant believe you would look up that and quote it to prove such a petty point. i have better things to do.
cobby · 31 October 2008
Do you actually understand what an enzyme is?
... get off of it. you are making yourself look obsessed and stupid.
Malcolm · 31 October 2008
Malcolm · 31 October 2008
Sorry for the double post there.
Troll, I asked the question for a reason.
Your analogy shows that you may not understand what enzymes are or do.
cobby · 31 October 2008
Just gene regualtion creating morphogenic fields after all.
... nice hypothesis. any proof or is your FAITH strong?
cobby · 31 October 2008
DaveH · 31 October 2008
cobby · 31 October 2008
cobby · 31 October 2008
DaveH · 31 October 2008
tresmal · 31 October 2008
Jobby said: "… moron, that is what i said “last-Thursdayism” has lots of evidence supporting it. but it cannot be disproven. (whats the use? its like trying to teach my dog algebra)"
Wow. That one broke my moronometer.
cobby · 31 October 2008
tresmal · 31 October 2008
"Dummy, what does the theory say we should observe it the theory is true?? "
Oops! There goes another one!
The point of "last-thursdayism" is that it is a priori impossible for there to be evidence for it.
DaveH · 31 October 2008
cobby · 31 October 2008
DS · 31 October 2008
Well anyone who really knew anything could post an eloquent description of what enzymes are and what they do, complete with references. But of course the troll with bricks for brains would just declare it "gibberish" simply because it couldn't possibly understand anything scientific. Oh well, at least it has proven that it thinks that proteins really are bricks. No evidence yet that it understands transcription factors, polymerases, gated ion channels, electron transport chains or anything else biological.
Talk about gibberish, how about that imaginary invisible hologram that can't work in the dark but still controls development. Man, it really had to smash the bricks in it's brain together really hard to come up with that crapola. Of course now that it has been exposed for the nonsense that it is, the troll will claim that it never wrote that.
Now it is going to try to claim that the universe was created last Thursday and that there is lots of evidence for that hypothesis. When asked to produce said evidence it will probably claim that it never wrote that either. Well maybe it was created last Thursday, that would explain it's complete lack of knowledge of biology. I say it that the universe was created last Wednesday, so there heretics.
Oh and by the way, the same nested hierarchy produced from different data sets is very strong evidence not only that phyla can be produced by descent with modification, but that they in fact actually were. The troll of many names has no alternative to the mechanism of natural selection, no knowledge of the evidence for it's central role in cladogenesis and no knowledge of any of the other mechanisms that have been elucidated since the time of Darwin. What can you expect from someone who thinks that proteins are bricks? Once your credibility is shot, there really is no point in making any further claims. I say, ignore it's ass into oblivion.
cobby · 31 October 2008
Oh and by the way, the same nested hierarchy produced from different data sets is very strong evidence not only that phyla can be produced by descent with modification, but that they in fact actually were.
... but Darwinism states NS did the job. just because a hierarchy exists does not necessarily dictate that it was caused by NS.
... what would we observe if NS did not cause the hierarchy? (why do i feel like i am asking rover to solve a quadratic equation? )
cobby · 31 October 2008
Now it is going to try to claim that the universe was created last Thursday and that there is lots of evidence for that hypothesis
... dummy, i never claimed the universe was create last thur. (woof rover, what is a + b rover, woof woof)
cobby · 31 October 2008
...did you ever play the game where you throw the ball for your dog to run after then you pretend you throw it (but dont) and he runs after it and cant find it and looks so confused.
..why do we enjoy doing that? i dont know but here i go:
woof woof trolls here i am throwing the ball. go chase (hahaha i didnt throw it but still they run and look back so, so confused)
PvM · 31 October 2008
PvM · 31 October 2008
cobby · 31 October 2008
... trolls, im throwing another ball. go chase. go chase (too funny)
... did wayne go on a bender. maybe i was a little to harsh with him. but hes got to get off the sauce but sometimes when alcs are confronted they go on a bender
PvM · 31 October 2008
DS · 31 October 2008
Here comes another manic jumping monkey spasm, feces flying everywhere. I guess it thinks this helps it's credibility. Just ignore it and it will go away.
And oh yea, I told you so.
Henry J · 31 October 2008
I hate to say this, but "what would we observe if NS did not cause the hierarchy?" does strike me as a legitimate question, if the question is altered to also include all the other genetic change processes (e.g., genetic drift, horizontal transfer).
The known genetic change mechanisms are expected to produce increasing differences over the whole genomes of genetically isolated populations, slower in the parts of the DNA affected by selection, and faster in parts not conserved by selection.
But something other than selection? It might or might not follow that pattern, though to actually predict what we'd observe in such a case, one would need a hypothesis on what the something else might be.
Henry
Malcolm · 31 October 2008
cobby · 1 November 2008
he whole point is that the embryo requires the appropriate signals and environment provided by the womb to grow.
.... any proof? or just FAITH??
cobby · 1 November 2008
the planning consent,
... there was a planner??
cobby · 1 November 2008
one would need a hypothesis on what the something else might be.
.... design for one.
DaveH · 1 November 2008
PvM · 1 November 2008
PvM · 1 November 2008
PvM · 1 November 2008
SWT · 1 November 2008
SWT · 1 November 2008
Wayne Francis · 1 November 2008
DS · 1 November 2008
Henry wrote:
"I hate to say this, but “what would we observe if NS did not cause the hierarchy?” does strike me as a legitimate question, if the question is altered to also include all the other genetic change processes (e.g., genetic drift, horizontal transfer)."
Good point Henry. Of course others have considered this scenario. Kimura developed the Neutral Theory to predict what one would expect at the population level if the effects of selection are minimal. The theory adequately describes much of molecular evolution but of course it cannot account for adaptive change. It shows that changes in allele frequency are dominated by processes of random mutation and genetic drift in the absence of selection.
At the level of speciation, reproductive isolation is often produced, or at least reinforced, by some form of selection, so rates of speciation would no doubt be much lower if no selection were operating.
At the level of macroevolution, a nested hierarchy would still be produced, but if selection were not operating, the pattern would probably appear quite different. No one has modeled this, since selection has obviously been important in macroevolution. However, there would probably be fewer lineages, smaller discontinuities between lineages and lower variance in lineage size and persistence. For example, in the absence of selection, there might be no good reasaon for the trilobite liineage to go extinct and the insect lineage to evolve to dominate the terrestrial habitat.
Of course, as you correctly point out, in the absence of a hypothesis about another force, it is impossible to say what the hierarchy might look like. Design cannot be the answer since it would not preclude selection. One could speculate that if all species were designed fixed and perfect that there would be no selection, but then again that would not produce the nested hieraracy, so that scenario ia conclusively falsified.
Wayne Francis · 1 November 2008
Wayne Francis · 1 November 2008
Wayne Francis · 1 November 2008
Wayne Francis · 1 November 2008
Wayne Francis · 1 November 2008
Wayne Francis · 1 November 2008
PvM · 1 November 2008
Malcolm · 1 November 2008
PvM · 2 November 2008
cobby · 2 November 2008
It would talk multiple instances of multiple events to chisel these theories away
... wrong. or are you saying Darwinism is not falsifiable and hence not science?
cobby · 2 November 2008
So not only do you have absolutely no understanding of what a protein is, or does, you have no idea what it takes to get a house built either.
... childish!
Still waiting for any evidence that you have any biological knowledge whatsoever.
... you first.
cobby · 2 November 2008
Common descent is a prediction of Darwinism
.... no sorry charlie Common descent ***via NS *** is a prediction of Darwinism. big difference. you should read about Darwin's theory. it really is quite intriguing.
cobby · 2 November 2008
cobby · 2 November 2008
But something other than selection? It might or might not follow that pattern, though to actually predict what we’d observe in such a case, one would need a hypothesis on what the something else might be.
.... so them come up with that hypothesis you need to falsify your theory or else it is not scientific.
woof, woof.
cobby · 2 November 2008
cobby · 2 November 2008
And once again Bobby shows his enormous level of ignorance with scientific fact and knowledge. And once again inappropriately uses the word ‘proof’.
How sad
.... you theory cannot be proven???
cobby · 2 November 2008
and why it is relevant to a discussion of morphogenesis.
... leading question! you really dont see that? its like asking why was hitlers conquest of china relevant to the fall of berlin. but this is typical of Darwinists since their theory has so little proof. first of all YOU have to show that it IS relevant ( again woof woof. this logic is above his canine cerebrums ability )
Wayne Francis · 2 November 2008
Wayne Francis · 2 November 2008
cobby · 2 November 2008
Or more generally, find cases where all genetic variations in a population produce the same average number of fertile adult offspring.
... woof woof. (have to get his attention) DUH! no one is saying NS does not exist. i want you to show that new phyla were produced by it. ( over his head again!)
cobby · 2 November 2008
wayne, youre back. were you on a bender or in detox?
Wayne Francis · 2 November 2008
- Sexual selection
- Random mutation
- Gene flow
- Genetic drift
- Speciation
Natural selection can not do much without other factors, like the ones listed above, taking place.Wayne Francis · 2 November 2008
Wayne Francis · 2 November 2008
cobby · 2 November 2008
Wayne Francis · 2 November 2008
DS · 2 November 2008
Everyone should be sure to notice that the troll of many names has still failed to display any knowledge whatsoever of proteins, enzymes, transcription factors, developmental biology or morphogenic fields. It has still failed to demonstrate how proteins should be considered merely "bricks" in any menaingful sense or provide any evidence that the universe was created last Thursday. It still hasn't explained why the magic invisible hologram is affected by changes in DNA or why it works for human development if it can't work in the dark. In short, it made up a bunch of bull shit and failed to support any of it. Now why should anyone pay any attention to anything it has to say since it has provided ample evidence that it doesn't have a cule what it is talking about? Oh well, at least it seems to have changed from a screaming monkey into a barking dog. Still shit for brains though, too bad.
Wayne Francis · 2 November 2008
Henry J · 2 November 2008
Stanton · 2 November 2008
mineralfungus. Eventually, though, it became more and more obvious that Protista was polyphyletic, so, some researchers began cutting it up into a bunch of smaller Kingdoms. How many, I've lost count.Malcolm · 2 November 2008
Wayne Francis · 2 November 2008
cobby · 3 November 2008
If you understood what RTKs were, you would understand the relevance.
... circular logic!
You claim that enzyme gradients don’t control morphology,
.... never said that. reading problems??
but you obviously have no clue what enzyme gradients do.
... false conclusions.
cobby · 3 November 2008
cobby · 3 November 2008
So you are claiming unless we show a phylum, which is 5 levels higher then a species, being created then NS doesn’t matter?
... are you saying new phyla are not 'created' by NS?
cobby · 3 November 2008
..trolls: woof woof! didnt you see me throw the stick?
cobby · 3 November 2008
cobby · 3 November 2008
expects to see a new phylum pop into existence.
.... i didnt say that. try to improve your reading skills.
DS · 3 November 2008
Obviously the troll of many names also has attention deficit disorder in addition to being a bipolar schizophrenic. Funny how no one ever seems to understand what it is trying to say and yet they are always somehow the ones to blame for the poor grammar and lack of coherence. Oh well, at least everyone can see that the troll still has no answers and is still just making shit up.
Wayne Francis · 3 November 2008
Stanton · 3 November 2008
cobby · 3 November 2008
So if phylum where rigorously defined you would need a HUGE number of changes to change phylum.
... so that is not possible??
cobby · 3 November 2008
My beloved Wayne,
... hmmm
cobby · 3 November 2008
PvM · 3 November 2008
PvM · 3 November 2008
PvM · 3 November 2008
PvM · 3 November 2008
PvM · 3 November 2008
Robin · 3 November 2008
Robin · 3 November 2008
Robin · 3 November 2008
cobby · 3 November 2008
Be that as it my, my first referenced use on this board is from 2006.
... prove it.
cobby · 3 November 2008
Robin · 3 November 2008
Robin · 3 November 2008
Henry J · 3 November 2008
If it matters (or even if it doesn't), the "Translation:" gimmick gets used fairly often on threads on the AtBC forum.
Henry
Stanton · 3 November 2008
cobby · 3 November 2008
I can say with 100% certainty that new phyla are NOT created by NS. New phyla (in fact, all phyla) are created by humans.
... phyla are intelligently designed??
cobby · 3 November 2008
cobby · 3 November 2008
Henry J · 3 November 2008
AtBC = "After the Bar Closes". There's a link to it at the top of this page.
Robin · 3 November 2008
Robin · 3 November 2008
Robin · 3 November 2008
Henry J · 3 November 2008
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
cobby · 3 November 2008
cobby · 3 November 2008
Even if you only count those experiments as 1 change there is no actual barrier for millions of changes to happen.
.... you know that from experimentation or FAITH???
cobby · 3 November 2008
Bottom line, there is no Kingdom, Phylum, Class, or Order that was created by NS. The organism groups in those greater groups were, but that’s a different subject.
... then species were also created by man and not NS??
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
DS · 3 November 2008
I wrote:
"Obviously the troll of many names also has attention deficit disorder in addition to being a bipolar schizophrenic. Funny how no one ever seems to understand what it is trying to say and yet they are always somehow the ones to blame for the poor grammar and lack of coherence. Oh well, at least everyone can see that the troll still has no answers and is still just making shit up."
I can keep posting this for another 5000 posts and the troll will still not have any answers. It will just make up more crap about magic invisible holograms and last Thursday. It has not only demonstrated that it has no knowledge but that it does not desire any knowledge either. It won't even read the papers it recommends. Crap says I and crap I means.
Imagine the delusional state required for someone to call other posters jumping monkeys and bark like a dog and then claim that others are childish for pointing out it's lack of knowledge! Crap says I and crap I means.
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
DS · 3 November 2008
Henry J wrote:
"The whole taxonomy system was intelligently designed."
You are correct sir, though as you yourself point out, not always intelligently.
Protista and Reptilia are two good examples of taxa that were not so intelligently designed, at least in hind sight.
cobby · 3 November 2008
At the level of speciation, reproductive isolation is often produced, or at least reinforced, by some form of selection, so rates of speciation would no doubt be much lower if no selection were operating.
... are you saying there would be ANY speciation if NS did not function??
Henry J · 3 November 2008
Lower and zero are not synonymous.
cobby · 3 November 2008
To put this another way the word “red” is a human invention and classification. Even without it photons of the wavelength between 625nm to 740nm would still exist. Even without the word “species” there would still be populations of life that change via evolutionary processes, to include NS, to a point that they would not be able to breed with the original population.
.... there is a little bit of difference between an 'arbitrary' naming convention such as red and terms which describe things which cannot be arbitrarily tagged. for instance water and ice cannot have an abitrary temperature boundary but colors can.
... so to say that phyla were invented by man is a deep misunderstanding of the term. nothing new here. woof woof.
cobby · 3 November 2008
cobby · 3 November 2008
have no problem using. I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity.
... this whole: "I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity. " seems to be a reaction formation. seems to be an undertone of homosexuality here since it is often being brought up by the opposition here why is it an issue at all here. your side keeps bringing it up. that is curious.
cobby · 3 November 2008
Do you care to enlighten us on what you did mean then? Not many different ways you can interpret “hmmm” of yours.
... hmmm is an open ended response. if a psychotherapy client says ' i have trouble meeting new people' and the therapist says 'hmmm' it is just an encouragement for the patient to expound without leading to a specific direction.
... my hmmm immediately brought out a denial of homosexuality on your part. why was there a need for a denial if you are not threatened by the fact that you might be homo.
.... my hmmm could have been interpreted that there is a collusion between the both of you or that you know each other or that you are trying to flatter. well there could be hundreds of interpretations
... but you had defend your non-homosexuality. very revealing indeed.
cobby · 3 November 2008
I also have no problem being around homosexuals and that includes gay men because they don’t threaten my masculinity.
.... would you be comfortable at a gay bar?
DaveH · 3 November 2008
cobby · 3 November 2008
cobby · 3 November 2008
jobbie said
somehow there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
Any proof?? or just FAITH? Please tell us all about how the Sater and Jacobson paper you cited supports your position as outlined above.
.... out of context! how deceptive of you. paste my entire comment!
cobby · 3 November 2008
Even if you only count those experiments as 1 change there is no actual barrier for millions of changes to happen.
.… you know that from experimentation or FAITH???
..... of course any answer to the above is vigorously avoided.
cobby · 3 November 2008
... i really think the problem with the opposition here is their abysmal reading skills. and now they say that the planet 'pluto' was created by humans since the word was created by humans.
... see the Darwinian theory is so full of holes they have to revert to these unbelieveable contortions of speech and logic when ever the glaring inconsistencies of their theory comes to the surface. so unscientific!
... and their greatest mantra of FAITH:
there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers! there are no barriers!
... quite a religious commitment they have. their steadfastness has to be admired!
Henry J · 3 November 2008
Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he's talking about, let alone what evidence might support the notion.
Malcolm · 3 November 2008
cobby · 3 November 2008
cobby · 3 November 2008
Like I said, feel free to prove me wrong at any time.
... do you have the patience for a walk thru? normally the Darwinists here start insulting and spitting as soon as they are forced to go thru a disciplined analysis of their logical steps.
... can you do it with out spitting?
cobby · 3 November 2008
Though of course it never occurs to this guy to do something like actually describe the alleged barrier(s) that he’s talking about, let alone what evidence might support the notion.
.... this reminds of some ancient civilizations who tried to build a 'stairway to heaven' your logic is that since i can take 10 steps i can walk around the world. it really is incumbent on YOU how are making extraordinary claims to show the extraordinary proof. at least thats how Sagan looked at it.
PvM · 3 November 2008
cobby · 3 November 2008
cobby · 3 November 2008
Bobby himself makes the more outrageous claims and fails, time after time, to show the extraordinary evidence.
... what was this extraordinary claim that i made? are you hallucinating again??
.... however YOU claim there are no limitations as to what NS can accomplish. I think THAT is an extraordinary claim that needs some validation
PvM · 3 November 2008
PvM · 3 November 2008
cobby · 3 November 2008
As usual, Bobby has failed to represent my beliefs and claims accurately when stating that there are no limitations to what NS can accomplish.
... so there ARE limitations? what are they? what are those barriers?
PvM · 3 November 2008
Wayne Francis · 3 November 2008
DS · 3 November 2008
Of course speciation can occur in the absence of selection, that is in fact how allopatric speciation works. It might not be the only form of speciation, but it has been well documented and it does not require any selection in order to establish reproductive isolation. I could find references if anyone wants them, but I certainly am not going to waste my time providing references for the illiterate troll.
Of course selection has limitations, historical contingency for one. We have discussed this to death in months past. Once again, I could give references, but just read Gould if anyone wants examples.
Still no answers from corn cobby, just a lot of childish barking, poor grammar and incoherent arguments. The illiterate, microcephalic chimpanzee with attention deficit disorder and short-term memory loss has zero credibility at this point, so just ignore it's feces slinging, barking and general idocy.
Henry J · 3 November 2008
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
Dan · 3 November 2008
Dan · 3 November 2008
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
- You have population A that gets split into population B and C that become geographically isolated.
- Each population will change via processes like random mutations.
- These random mutations will not be identical in both populations.
- With more of these random mutations the populations B and C will diverge further and further apart
The different selection pressures just dictate if a one trait is more likely to appear in subsequent generations then another. Of course the in real world you can't have no selection pressures. For example if I get a set of mutation that causes me to have cancer from birth this set of mutations will never get past on to my children because I'll not live long enough to have children. You know I was SOOO hopeful that SFB actually learned something for once. But he let me down. I was stupid for thinking he could learn.Wayne Francis · 3 November 2008
DS · 3 November 2008
Wayne,
You are indeed correct. In fact, as I pointed out previously, the neutral theory predicts what the rate of genetic divergence should be in the absence of selection.
You are also correct about the troll of many names. It's almost pathological inability to learn is no doubt responsible for the fact that it has been shown to be wrong about every claim that it has made here. Funny, you would think that it would be right about something eventually just by chance, but after 2250 posts it still hasn't happened yet.
Wayne Francis · 3 November 2008
DS · 3 November 2008
Everyone should notice that the troll of many names is effectively arguing against it's own position again.
It has claimed repeatedly that there is no evidence that natural selection is important for speciation and cladogenesis and therefore "Darwinism" is wrong. Of course it will deny this, as it has denied everything else it has ever written, but the evidence is there for all to see.
Now it claims that speciation cannot occur in the absence of selection. It will probably try to deny this as well, but who cares? Well, if speciation has occurred, which it demonstrably has, and natural selection is required for speciation as the troll claims, then ipso facto, selection must have been important for speciation and Darwin was exactly right.
Must be hard trying to remember which side of the argument you are on when you just make shit up. BOW WOW, fetch that jumping monkey.
Wayne Francis · 3 November 2008
Malcolm · 3 November 2008
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
Wayne Francis · 3 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
DaveH · 4 November 2008
cobby · 4 November 2008
... sorry fans, I simply do not have time to respond to all of your requests for comments. Obviously the demand for my views and thoughts are very high. but it is fun to throw the stick and watch SO many of my canine friends go chasing. now I know you saw me move my arms like i threw something but did i really? are you still sniffing the ground looking for it?
cobby · 4 November 2008
there is this holographic-like field that the femur eventually somehow fills with bone. somehow the at least approximate dimensions for this is stored somewhere.
.... you disagree with the above statement??
... ps. I will respond to the tremendous demand for my thoughts in reverse chronological order.
cobby · 4 November 2008
The only place you’ll see “Limits to evolution” is on creationist sites.
We do agree there are limits based on the environment. For example we don’t believe you could ever have an insect the size of an elephant on Earth.
... Wayne have you been drinking again? Seems like you are contradicting yourself up above.
... anyhow Wayne, I just can wade thru all your dribble. i perused your rantings a bit but really its just too confused to really even respond too.
cobby · 4 November 2008
... general response to all the trolls:
... so you do indeed agree with my point NOW that evolution has limits and barriers. glad i could elucidate that for you.
DS · 4 November 2008
Who cares what this lying scum bag has to say? It always misrepresents others, claiming that they said things they didn't. It never presents any evidence for the bull shit it makes up. It always argues against itself. forgetting which side of the argument it is supposed to be on. It continues to bark and scream while calling others childish. It still can't seem to be able to read any post over two lines.
It still hasn't answered a single question about the magic invisible hologram or any of the other crap that it's pee brain has spewed forth. It still has not shown any evidence at all that it understands enzymes or transcription factors, even though it could have taken an entire college course in the time it has spent here raving like a lunatic.
Now of course we can add selection, allopatric speciation and the neutral theory to the list of things that it doesn't understand. The list is getting longer faster that it can spew forth it's vile filth. Still hasn't contaminated any other threads at least.
cobby · 4 November 2008
Wayne Francis · 4 November 2008
cobby · 4 November 2008
... Dave Stanton:
can you clarify? Do you believe evolution has barriers or not?
cobby · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
phantomreader42 · 4 November 2008
Wayne Francis · 4 November 2008
Dan · 4 November 2008
DS · 4 November 2008
So now we can add historical contingency to the list of things that corn cobby doesn't understand. And once again, the fool of many names has no answers and no explanations, just mindless complaints about the language it so justly deserves. I wonder how that thing with the light socket worked out for it.
Robin · 4 November 2008
Wayne Francis · 4 November 2008
Robin · 4 November 2008
cobby · 4 November 2008
ts not a waste, I’m pretty good at multi tasking. I’m listening to some Black Eye Peas while testing some server code I wrote. Not only do I get some work done, making a nice chunk of change, but I get to show you to be a lying deceitful arrogant and willfully ignorant troll while also learning new stuff on other posts.
.... you do this at work??
cobby · 4 November 2008
...trolls you admit there are limits to evolution. well finally. so now the next question
.... how do we know that just for example: the whale did not exceed the limits of what evolution can do???
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
phantomreader42 · 4 November 2008
DS · 4 November 2008
"You won’t say what these “barriers” are, where they are, how big they are, what exactly they prevent, or how. You just babble and screech about barriers that your delusions demand, without the slightest speck of evidence."
I predict that corn cobby will now launch into it's patented diatribe about how the blowhole could not possibly have migrated to the top of the head in only 50 million years. It will jump up and down and scream and bark and blow shit out it's blow hole, but it will never give any explanation and it will never present any evidence. If it does give a reference it won't have anything to do with the topic. Just ignore it and it will go away.
After all, it hasn't bothered to support any of the other shit it made up. Why should it start now? Oh and don't give it any equations either. It doesn't understand math any more than it does biology. Any guesses as to why it hasn't tried to explain historical contingency or transcription factors yet?
cobby · 4 November 2008
But yes when I have spare time at work I’ll answer posts too.
... does your employer know you are doing that? Have you asked it if is OK to surf on company time? I would fire you.
cobby · 4 November 2008
how do we know that just for example: the whale did not exceed the limits of what evolution can do???
Because we don’t see anything that can’t be explained by evolution in the whale
... hmmm
cobby · 4 November 2008
.....Dave Stanton, what is your defecation obsession caused by?
cobby · 4 November 2008
Well, what’s stopping you from walking around the world? The ocean. the ocean is a barrier that actually exists in the real world.
.... trolls: what is stopping us from sailing from portugal to india by sailing straight west??
cobby · 4 November 2008
Perhaps if you didn’t take the attitude of not reading more then 2 sentences in a text book you could have had a job where you don’t have to live from pay check to pay check.
.... actually i am independently wealthy. self-made man and all of that! despite not getting out in 87 and getting out in late 99 it all worked out pretty well. well now that i think of it i did not miss much in 2000. however bush completely destroyed my method. completely missed the post iraq thing. now its just boring CDs. well i am glad i wasnt in for this last one!
Dave Lovell · 4 November 2008
cobby · 4 November 2008
fnxtr · 4 November 2008
Holy cow, is this nutjob still ranting? There's no substance here, it's just pushing people's buttons. It knows it's an ignorant shit and doesn't care, it just wants attention.
Sad, really.
cobby · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
Henry J · 4 November 2008
The question isn't whether there are barriers (evolution hasn't produced wheels on axles, microchips, or jet airplanes, afaik), but whether there are barriers between early life and known later life.
cobby · 4 November 2008
cobby · 4 November 2008
but whether there are barriers between early life and known later life.
... how could YOU tell if there were such barriers?
PvM · 4 November 2008
PvM · 4 November 2008
cobby · 4 November 2008
PvM · 4 November 2008
cobby · 4 November 2008
how do we know that just for example: the whale did not exceed the limits of what evolution can do???
Because we don’t see anything that can’t be explained by evolution in the whale.
.... Ptolemy felt the same way about his theory. It explained everything. Hmmm.... so if we do not see anything that is not predicted by our theory then the theory is true? How convenient! So the advocates of the theory that invisible pink unicorns live in the center of the earth have a valid theory since they do not see anything to the contrary??
... how do we know there was enough time for the whales to evolve??
PvM · 4 November 2008
cobby · 4 November 2008
1. The whale exists
.... true
2. The mutation rates to explain the evolution of the whale are well within what is observed
.... how did you come to that conclusion?? FAITH??
cobby · 4 November 2008
How do we know that the time was insufficient?
... at this time we do not know.
PvM · 4 November 2008
PvM · 4 November 2008
Henry J · 4 November 2008
Is Ahab still chasing that whale? Huh.
cobby · 4 November 2008
We do know that given the data and our present day knowledge, there is no reason to presume that time was insufficient.
... so there is no reason to assume it IS sufficient either. therefore the theory that whales evolved thru NS is not a validated theory and should be taught as such.
PvM · 4 November 2008
PvM · 4 November 2008
cobby · 4 November 2008
and thus there is a reasonable reason not to reject it given the evidence.
... sorry charlie. thats not science. because there is not evidence to reject a theory does not mean the theory is valid. remember your friend, falsification. you MUST have a test that can go 2 ways: what is seen if the theory is true and what is seen if it is not true. if we are not able to run this test it is a nice hypothesis and a nice world view and a nice philosophy, but sorry charlie it is NOT science.
... you wouldnt happen to have this little test hidden away somewhere? could we see this test as applied to whale evolution mutation speed.
.... i will not hold my breath.
PvM · 4 November 2008
DaveH · 4 November 2008
PvM · 4 November 2008
cobby · 4 November 2008
No,the theory is valid because of the evidence and since you admitted that there is no evidence that evolution is wrong, all we have is ignorance. You present your evidence.
...hmmm whoah I did not say the theory is WRONG. I said there was insufficient evidence to call it undeniably valid. and again of course evolution is a fact. again you are conflating. my point is that there is insufficient data to say that whales evolved thru NS.
... how do we know there was enough time for the whales to evolve thru NS?
cobby · 4 November 2008
... could whales have evolved from land animals in 10,000 years??
cobby · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
cobby · 4 November 2008
Yawn, as I said, there are worse problems for Bobby to deal with.
Guess his holographic-like statement suddenly has lost much of its appeal to him. Why not retract it, or clarify it.
Either way, Bobby is in trouble...
... whatever. first of all it was just an analogy to aid a thinking process. i never said it was a 'theory' but you have never answered:
...… could whales have evolved from land animals in 10,000 years??
cobby · 4 November 2008
… could whales have evolved from land animals in 1,000 years??
why the fear in answering this??
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
Henry J · 4 November 2008
The question does seem pointless, but I think that for a fully terrestrial species to evolve into a completely aquatic species would take two or three orders of magnitude more than 10,000 years.
cobby · 4 November 2008
cobby · 4 November 2008
The question does seem pointless, but I think that for a fully terrestrial species to evolve into a completely aquatic species would take two or three orders of magnitude more than 10,000 years.
.... why do you believe that? can you prove it?
cobby · 4 November 2008
And why the switch from evolution to NS?
... i certainly did not 'switch' you seems to conflate Darwinism with evolution.
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
cobby · 4 November 2008
And once again Bobby seems to be confused about science and proof. Will he ever learn?
... so Darwinism has never been proven? We should teach that.
cobby · 4 November 2008
Oh yes you did, you tend to conflate evolution with Darwinian theory.
... no YOU do that. I have said many times evolution is a fact and proven. However Darwinism has not been proven.
PvM · 4 November 2008
Wayne Francis · 4 November 2008
PvM · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
cobby · 4 November 2008
cobby · 4 November 2008
Exposing ignorant people like you that want to impose their brand of pseudoscience on the world is NOT a waste of time.
... and what exactly am i trying to 'impose on the world'??
Wayne Francis · 4 November 2008
cobby · 4 November 2008
If a scientist ever does come across a one of these magical “barriers”
... but you said evolution has limitations. no you are saying that the barriers are magical? you are going around in circles
cobby · 4 November 2008
No SFB we come to that conclusion from experiments where we measure various mutations and look at the changes it produces. We can then look at natural mutation rates of the target species and then see if there are enough mutation possible during the projected time.
... there have been no valid experimentation or even calcuation of mutation rates. go look it up!
Henry J · 4 November 2008
Is it worth asking how one would look up something if it hadn't been done?
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
Malcolm · 4 November 2008
cobby · 4 November 2008
cobby · 4 November 2008
… how do we know there was enough time for the whales to evolve thru NS?
..... i dont see any answers!
PvM · 4 November 2008
Malcolm · 4 November 2008
PvM · 4 November 2008
Wayne Francis · 4 November 2008
cobby · 4 November 2008
You are suggesting that there are barriers in between different forms of life on earth.
... and YOU of course know there are not. how?? experiments? data? FAITH!
cobby · 4 November 2008
Whether or not it included NS is a separate issue but we can look at how genetic sites have been conserved
... whether or not it included NS is the PRIMARY issue. Darwinism states that NS causes complex body plans. if NS does not Darwinism is invalidated.
cobby · 4 November 2008
Lets say every form of life would fit on roads in Kansas.
... silly analogy.
cobby · 4 November 2008
Wayne Francis · 4 November 2008
cobby · 4 November 2008
Dan · 4 November 2008
Dan · 4 November 2008
Henry J · 4 November 2008
It occurs to me that if the nameful one's questions had come from somebody who hadn't demonstrated an unwillingness to listen, the next step would be an explanation of the scientific method. I wonder if there are any lurkers on the thread who don't already understand it? (Probably not, given that the thread fell off the front page quite a while ago.)
Henry
cobby · 4 November 2008
This is how they estimate how far back 2 random people last relative is using mitochondrial DNA. You really are clueless.
... the problem with most of these studies is that the logic is circular. they use what they feel already is the correct time frame to massage the data. the methodology is very loosy goosy. there is a tremendous amount of cherry picking
Dan · 4 November 2008
cobby · 4 November 2008
Wayne Francis · 4 November 2008
DaveH · 4 November 2008
cobby · 4 November 2008
So what was with making testable claims like “the hologram doesn’t work in the dark”?
.... when did I say that?
Wayne Francis · 4 November 2008
cobby · 4 November 2008
Sounds like you coming up with a stupid idea,
... a morphogenic field is concept used by mainstream scientists
cobby · 4 November 2008
... i cant believe you trolls dont having anything better to do
Wayne Francis · 4 November 2008
cobby · 4 November 2008
Not from the mutations rates we observe SFB. 10,000 years seems to be off by 2 or 3 orders of magnitude
... you know how many mutations it takes to make a whale?
cobby · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
Wayne Francis · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
PvM · 4 November 2008
Note so far how Bobby has failed to support his claims once again, and as predicted has chosen to obfuscate.
Ah, the power of ignorance never fails.
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
Wayne Francis · 4 November 2008
DS · 4 November 2008
Well I finally figured out what the troll is trying to accomplish. It is trying to kill us by making us laugh so hard that we forget to breathe. Man what a dolt. How can one person cram so much ignorance into one small cranium?
Of course we have been able to estimate mutation rates since the early seventies and we have been able to measure mutation rates failry precisely since the early eighties. I could cite literally thousands of references, but why bother? Everyone else already knows this and the troll is uncapable of learning. I mean really, once you can sequence DNA, measuring mutation rates is fairly simple. And of course it is very important for medicine as well as evolution so lots of studies have been done.
Just in case anyone is not aware, the pattern of amino acid and nucleotide substitutions that has been revealed by the last thirty years of research is entirely consistent with the hypothesis of functional constraint. In other words, yes, selection is very important in determining the fate of mutations.
Now the troll will claim that it never said that there are no mearurements of mutation rates. It will probably also try to claim that it never said that proteins are just bricks and that protein gradients are only marginally effective at controlling development. And of course it has yet to explain any of of the hologram nonsense. Crap says I and crap I means.
phantomreader42 · 4 November 2008
tresmal · 4 November 2008
phantomreader42 said (to jobby):"From this moment, you have twenty-four hours to provide evidence in support of your idiotic assertions, or go fuck yourself."
If you have been reading this thread long enough you realize that jobby is quite squeamish and uncomfortable on the subject of sex. I think even autosexuality is too much for him.
DS · 4 November 2008
Now you've gone and done it, you used a dirty word. Now the troll will use that as an excuse to not explain anything for another two months. What ever shall we do? It will probably demand that you wash your mouth out, even though you typed the post.
When it gets through barking it will probably try to change the subject again. Maybe it will try to claim that no one has measured the speed of light yet. Yea, that's why the magic invisible hologram can't work in the dark.
Oh well. I guess we can now add the molecular clock to the list of things it doesn't understand. That list is getting pretty long. Too bad there is nothing in the list of things it has demonstrated that it does understand. Even if it did understand something, it would probably just argue against itself until it lost. Remember this is the same nut that claimed that there was no evidence for the role of natural selection in evolution and then claimed that there could be no speciation without natural selection! Of course it will deny making either claim, but of course the evidence never dies.
fnxtr · 4 November 2008
Congratulations, neighbours. The rest of the world is cautiously optimistic.
Wayne Francis · 4 November 2008
DS · 5 November 2008
Wayne,
Of course corn cobby cannot provide any evidence of any kind. Even if it were making a valid point, it still couldn't read a paper or explain why the paper supports it's claims. The only question is which troll tactic it will employ as an excuse not to provide any evidence. I already have dibs on the "wash your mouth out" tactic, you have dibs on the "I don't have time to respond" tactic, others can vote for their favorites. The ever popular "I never said that" tactic is still open.
Oh well, it doesn't really matter. I say that when the twenty four hours is up, we should all think of some creative acts of sexual deviance to suggest for corn cobby as a going away present. Maybe it can use the magic invisible hologram to display pornographic scenes while it continues it's mental masturbation. Really, no matter how crude, rude or lewd the suggestions, the troll has earned it. Of course the moderator could step in and end this fiasco at any time. 2500 posts of the troll proving it's ignorance serves no purpose that I can discern.
cobby · 5 November 2008
... I am beginning to realize this a place where disturbed people waste their time.
Wayne Francis · 5 November 2008
DS · 5 November 2008
OK, who guessed troll tactic 39 - just insult everyone and hope they will not realize that you have not provided any evidence of any kind? Now, the next step will probably be to claim that everyone is too stupid to understand so it doesn't have to bother trying to explain anything. Oh well, it probably can't even remember what it promised to explain anyway.
Only twelve hours left until time runs out. Get those suggestions ready. Man we could elect a new president faster that this troll can explain anything. Oops, never mind.
rog · 5 November 2008
cobby · 5 November 2008
fnxtr · 5 November 2008
(snicker) Such as...????
Henry J · 5 November 2008
phantomreader42 · 5 November 2008
PvM · 5 November 2008
PvM · 5 November 2008
DS · 5 November 2008
Just six hours left. Man I wonder what this nut job is waiting for, After all, if he offered a "walk through" two weeks ago then he must have already had the evidence, right. Either that or he never did and never will have any evidence of any kind.
Well, troll tactic 57 is still a possibility - you have all treated me so poorly that I don't have to explain anything to any of you. That might not be an effective strategy given all of th jumping monkey and barking dog business. Or maybe it will claim that we all somehow stopped it from posting the evidence. Yea right, if we could do that, why couldn't anyone stop it from posting 1000 pieces of crap here? Or maybe it will just ask some more insipid questions and try to change the subject again.
Malcolm · 5 November 2008
fnxtr · 5 November 2008
Maybe his next pseudonym should be Godot.
cobby · 5 November 2008
don’t worry SFB I did not waste time finding this. I have a whole set of bookmarks for your idiotic posts.
... i personally would not waste time bookmarking YOUR posts. do you really take this that seriously? does anyone close to you know you waste so much time here? you have a whole set of bookmarks for 'idiotic' posts? do you really think that is healthy??
cobby · 5 November 2008
tresmal · 5 November 2008
jobby said":"malcolm you are going to have to wait quite a while longer. i do not run my life on your dictates! please squirm away!"
Translation: Damn! He called my bluff!
Malcolm · 5 November 2008
PvM · 5 November 2008
Henry J · 5 November 2008
DS · 5 November 2008
Time is up.
Game over.
You lose.
Go fuck yourself.
phantomreader42 · 5 November 2008
Wayne Francis · 5 November 2008
PvM · 6 November 2008
cobby · 6 November 2008
... we have some really classy people here. wonderful examples for kids wanting to become 'scientists'. this site reads like a smut site. nice going trolls.
cobby · 6 November 2008
My time exposing you for a lying deceitful willfully ignorant creationist troll is not a waste in my opinion.
... do you really think anyone other than the participants here read this? would any teacher send one of his students here to read this smut?
Wayne Francis · 6 November 2008
cobby · 6 November 2008
phantomreader42 · 6 November 2008
Stanton · 6 November 2008
DS · 6 November 2008
Sorry PvM. You are absolutely right. It won't happen again. The moderator should remove that comment to the bathroom wall. If you will grant me moderator privileges I will remove it myself. Of course then I would immediately remove every single one of the troll comments that have inexplicably been allowed to infest this site.
Seriously, when you allow a mindless boob to post off-topic nonsense for month after month, what can you expect to happen? The only thing it seems to be averse to is foul language. The moderator has allowed it to change names at least a dozen times in blatant violation of the most basic rules and with malice a forethought. It has openly committed slander and accused people of being pedophiles and alcoholics. It has even made personal threats which were not only allowed to remain but were not even addressed by any moderator.
I know that you have done everything you can to prevent this ignorant idiot from infesting this site. Perhaps it is time that you suggest stronger measures before the site becomes overrun. Thank you for keeping the troll off of all other threads.
Wayne Francis · 6 November 2008
cobby · 6 November 2008
PvM · 6 November 2008
PvM · 6 November 2008
PvM · 6 November 2008
cobby · 6 November 2008
Dan · 6 November 2008
cobby · 6 November 2008
PvM · 6 November 2008
PvM · 6 November 2008
Dan · 6 November 2008
tresmal · 6 November 2008
So jobby, are you ready to walk us through your ideas?
DS · 6 November 2008
Dan wrote:
"I leave it to those more knowledgeable than me to decide wither the proper diagnosis for cobby is schizophrenia or multiple personality disorder or just plain stupidity."
I would just like to point out that those scenarios are not mutually exclusive. For example:
The same nut job who claimed that there was no evidence for the role natural selection in evolution also claimed that speciation could not occur in the absence of natural selection
The same nut job who claimed that the magic invisible hologram could not work in the dark denied ever having claimed that
The same nut job who offered to explain it's nonsensical ideas asked how much time it had to explain and then claimed that it didn't have to meet the deadline
The same nut job who claimed that he posted here for the benefit of the lurkers now claims that no one but the particiapants ever read the thread
I vote for all three scenarios simultaneously. Others may add to the list. I have already diagnosed short-term memory loss and attention deficit disorder. Maybe when it is through walking through it's own delusional mind it can try to make some sort of coherent argument, but of course no one will care.
Malcolm · 6 November 2008
Still no walk through from the troll.
It would appear that my original observation that the troll knows absolutely nothing about enzyme gradients was correct. What a surprise.
Malcolm · 6 November 2008
Malcolm · 6 November 2008
fnxtr · 6 November 2008
cobby · 6 November 2008
cobby · 6 November 2008
... I get what I want out of you trolls. But you don't get much from me. hahaha!
tresmal · 6 November 2008
cobby · 6 November 2008
tresmal · 6 November 2008
P.S. Ready to walk us through your ideas yet?
Dan · 6 November 2008
cobby · 6 November 2008
OK, now who is going to save you the many more hours of reading it? And who are you going to find to explain it to you in terms simple enough for your marginally literate and numerate mind to understand?
... well actually you trolls would find and paste what i needed to know. thanks! of course i could do the research myself but why should i when i have a pack of monkeys at my command.
... remember how well i had you trained. if i needed some info i just shouted
JUMP MONKEYS!! and off you would scurry to get what i needed.
cobby · 6 November 2008
.. but actually i think the term holograph has more than one def. i read some defs where a hologram does not have to be necessarily light.
JUMP MONKEYS!
cobby · 6 November 2008
...thanks monkeys!
tresmal · 6 November 2008
So jobby, are you ready to walk us through your ideas yet?
I suggest that this be the only response jobby gets until he does "walk us through" or admits he's got nuthin'.
cobby · 6 November 2008
tresmal · 6 November 2008
So jobby, ready to walk us through your ideas?
Stanton · 6 November 2008
cobby · 6 November 2008
PvM · 6 November 2008
cobby · 6 November 2008
Stanton · 6 November 2008
Stanton · 6 November 2008
DS · 6 November 2008
Come on guys, you're just wasting your time with this slack jawed slacker. Now it is going to argue about the definition of "hologram" and "force field" until someone actually looks it up and proves that it is wrong once again. Who cares? What kind of "force field" doesn't work in the dark? What kind of "force field" responds to changes in the sequence of nucleotides in DNA?
The brick for brains troll is just making crap up. It doesn't even have a clue what the words mean. The point is that it hasn't got any evidence, period. Why argue about definitions when there is absolutely no evidence? Obviously it is just desperate for attention, why give it any? Let the jumping monkey jump off a bridge by itself.
Henry J · 6 November 2008
Malcolm · 6 November 2008
Wayne Francis · 6 November 2008
Wayne Francis · 6 November 2008
Wayne Francis · 6 November 2008
- SFB claims doesn't waste time with trolls.
- SFB claims we are all trolls
- SFB keeps replying to our posts
and- SFB thinks smart people will not point out idiots
- SFB keeps calls us idiots
Doesn't mater what is easier either SFB. Doing volunteer work isn't as easy as sitting at home in front of the TV but I still do volunteer work. We already know you are lazy SFB. You don't have to emphasize that fact. Now he's trying to get us upset by implying that he tricked us into providing him links? SFB is a real idiot. 1) He has not shown any evidence of even looking at anything we've provided him. 2) We actually want him to read the stuff we provided him. 3) Finding this information didn't take hours, might take him hours to find it but for most of us it is a 30 second job. Read away troll. If you ever think you have learned something feel free to come back and show us your new found knowledge. My bet is you won't get past the first 2 lines from your own comments saying you just that. We have converted a few creationist in the past but never a troll. The difference is the former actually came here ignorant but willing to learn while the later, a.k.a. SFB, comes here ignorant and arrogant and has fought tooth and nail to even watch a video that explained a processes he didn't understand.Wayne Francis · 6 November 2008
Wayne Francis · 7 November 2008
Wayne Francis · 7 November 2008
Wayne Francis · 7 November 2008
Stanton · 7 November 2008
cobby · 7 November 2008
cobby · 7 November 2008
... good Monkeys!
.... most of you jumped. very good!
cobby · 7 November 2008
Umm you do realize that Jules Verne wrote journey to the center of the earth. A journey that would not ever happen the way he wrote about. He also wrote From the Earth to the Moon. Thankfully science didn’t follow his lead there either because being launched from a cannon that can achieve escape velocity would instantly kill a human.
... of course not all ideas in sci-fi have come to be. it is a bit of a brainstorming area. most of us have our flip out 'communitcators' and there is puctureless medical injections.
.... look up the etymology of 'hologram'. actually its use for 3d light structures is a bit of a misnomer. but so what.
.... go monkeys! learn something!
Dave Lovell · 7 November 2008
cobby · 7 November 2008
Wayne Francis · 7 November 2008
PvM · 7 November 2008
PvM · 7 November 2008
cobby · 7 November 2008
Hologram is Greek, means whole drawing.
.... where does it specify that light must be involved. yes it has been lately used to specify a certain type of image generation. but nowhere that i can see that it must use light
cobby · 7 November 2008
PvM · 7 November 2008
cobby · 7 November 2008
.... wouldnt be better to do this in a forum that was not biased. where your opposition would have an level playing field?
Stanton · 7 November 2008
tresmal · 7 November 2008
cobby · 7 November 2008
reality is biased against you.
.... you have not show the experiment proving new body plans can arise thru NS.
Henry J · 7 November 2008
A generalization is not proven by a single experiment; it's supported by 1) being consistent with the data, and 2) having ways in which contradictory data could have been found if the premise were wrong, plus 3) being consistent with some data that predicted before being examined.
PvM · 7 November 2008
PvM · 7 November 2008
cobby · 7 November 2008
Malcolm · 7 November 2008
Malcolm · 7 November 2008
cobby · 7 November 2008
cobby · 7 November 2008
because “body plans”, what ever they are, don’t arise through natural selection.
... then where do these body plans come from, oh great trollish one, Godditit??
PvM · 7 November 2008
cobby · 7 November 2008
PvM · 7 November 2008
PvM · 7 November 2008
cobby · 7 November 2008
Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006
... you read this article?? or just googled it?
PvM · 7 November 2008
cobby · 7 November 2008
PvM · 7 November 2008
PvM · 7 November 2008
cobby · 7 November 2008
Malcolm · 7 November 2008
cobby · 7 November 2008
Eric H. Davidson and Douglas H. Erwin, Gene Regulatory Networks and the Evolution of Animal Body Plans Science 311 (5762), 796 2006
Troll, since you are the only one talking about “body plans”, you first need to define what this term means.
... seems like Davidson and Erwin also are talking about body plans. If you read the article i think you would be familiar with the term
PvM · 7 November 2008
cobby · 7 November 2008
since you are the only one talking about “body plans”,
.... what are you talking about?
PvM · 7 November 2008
cobby · 7 November 2008
PvM · 7 November 2008
SWT · 7 November 2008
PvM · 7 November 2008
Malcolm · 7 November 2008
Henry J · 8 November 2008
Paraphrasing the question so that it makes sense: what evidence would reduce confidence in origin of body plans from earlier species via accumulation of genetic changes by the known causes of genetic change?
I reckon anything that reduces confidence in common descent of animal phyla would do that (e.g., later species found way too early in geographic record, or significant discrepancies between the nested hierarchies constructed from different body parts or DNA sequences).
Or, evidence for some mechanism other than natural selection for production of new complex traits, such that the newly discovered mechanism is also consistent with the evidence, while providing as good an explanation for that evidence as is provided by the current theory.
Without a plausible replacement for the known ways DNA can change, I don't see a way to separate the variation + selection hypothesis from common descent; it looks to me like they stand or fall together.
Henry
phantomreader42 · 8 November 2008
In all its idiotic babbling today, has the lying sack of shit made any attempt to present the slightest speck of evidence in support of its claims? No, of course not, it would rather die than do such a thing. Has it posted even a single letter of its promised "walkthrough"? No, of course not, the "walkthrough" exists only in its delusions.
So yet another day of the brain-dead troll flinging shit in every direction, without any effort at all to address reality. Just what we've all come to expect from creationists. Endless dishonesty, worship of ignorance, total lack of substance.
cobby · 8 November 2008
cobby · 8 November 2008
I reckon anything that reduces confidence in common descent of animal phyla would do that
... no you are misunderstanding. the point is YOU must show what we would see if common descent occurred WITHOUT NS.
cobby · 8 November 2008
I don’t see a way to separate the variation + selection hypothesis from common descent;
... we could have a combination of systems working thats how. of course NS happens and of course common descent happens.
... the question is can those methods reach far enough allow a reptile to evolve into a mammal. HOW can YOU show that?
cobby · 8 November 2008
That’s why I asked you to define body plans. The scientific definition didn’t seem to fit in well with your argument.
.... WHY do you say that?
Wayne Francis · 8 November 2008
cobby · 8 November 2008
cobby · 8 November 2008
Asking if NS can produce a new body plan then saying that we can not show NS can account for changes from a reptile to a mammal shows his ignorance. T
... its pretty much the same question. getting angry wont help you overcome your ignorance.
..... show me the experiment. you know there is not one and that is why you put on a tantrum
SWT · 8 November 2008
cobby · 8 November 2008
SWT · 8 November 2008
phantomreader42 · 8 November 2008
cobby · 8 November 2008
cobby · 8 November 2008
phantomreader42 replied to comment from cobby | November 8, 2008 2:12 PM | Reply
So, for the record, you HAVEN’T offered anything remotely resembling evidence, and once again you desperately try to distract attention from the fact that you’re a lying sack of shit. You know you’ve got nothing, everyone knows it. Time to put up or shut up, brain-dead troll. Provide your evidence, or take your mental masturbation elsewhere.
... would you be comfortable having this individual alone with your children??
Malcolm · 8 November 2008
Malcolm · 8 November 2008
tresmal · 8 November 2008
Jobby is a demonstration of the Dunning-Kruger effect.
PvM · 8 November 2008
cobby · 8 November 2008
cobby · 8 November 2008
PvM · 8 November 2008
PvM · 8 November 2008
Wayne Francis · 8 November 2008
Wayne Francis · 8 November 2008
Wayne Francis · 8 November 2008
Wayne Francis · 8 November 2008
DS · 8 November 2008
So, we can now add cladistics to the list of things that the troll doesn't understand. So far the list includes:
information theory and DNA
proteins including enzymes and transcription factors
developmental genetics and morphogenic fields
natural selection and speciation
mutation rates and the molecular clock
cladistics and systematics
Doubtless it does not see any connection between the areas of it's ignorance either.
If the troll demands any evidence, remember that it is just making crap up and has provided no evidence whatsoever for any claim that it has ever made. If anyone points this out too blatantly, it goes into a jumping monkey fit and then starts barking. Like spilt water, if you ignore it, it will eventually go away.
phantomreader42 · 9 November 2008
phantomreader42 · 9 November 2008
Wayne Francis · 9 November 2008
I better qualify what I meant by "No SFB, no one said body plan = plylum" because some people obviously don't have a problem with that statement and these people are more knowledgeable then I am about the topic.
Looking at it again I have to agree with PvM. This, of course, does nothing for SFB statements. All it shows is that I’m able to learn from someone else while SFB is in his own reality which does not reflect the real world and he is unable to change his perception without lying about it.
For clarification my thinking of phylum and body plans where overlapping classifications. I guess they are but they are far more overlapping then what I was taking them as.
DS · 9 November 2008
Good point. I made a list of contradictory statements made by the troll previously. I'm sure Wayne has bookmarked quite a few. So now we have lists of contradictory statements, psychological disorders and areas of ignorance. This basket case sure does provide lots of material to work with. Oh well, until it comes up with some evidence, or at least a reasonable hypothesis not tangential to reality, I guess the lists are all we're left with.
Stanton · 9 November 2008
Wayne Francis · 9 November 2008
Wayne Francis · 9 November 2008
You know SFB has a new spin on the "God of the gaps". He isn't finding gaps. He says "See that area there that is well known? Well you can't prove 'God' isn't the cracks."
Where most creationist start at the gap level and get squeezed into the crack level. SFB just jumps into solid block head on into solid science hoping he can make a crack and as he is laying there all bloody and can't remember even his own name he makes claims that literally are right in front of his face.
cobby · 9 November 2008
Well you can’t prove ‘God’ isn’t the cracks.”
.... when did i say anything even close to that. honestly it seems like you have a mental problem. you equates someone not accepting every Darwinian principle as 'gospel' as heresy. you have turned Darwinism into a religion.
.... is it against your religion to doubt Darwinism??
cobby · 9 November 2008
You’ve been babbling for 86 pages,
... actually if you would objectively ( dont think they have the capability of being objective) look at the amount of verbage here the darwinists are the the most verbose and rantish. i make small concise comments while my opposition rants on and on.
cobby · 9 November 2008
... I really do think that any reasonable, open minded people reading this would come to the conclusion that my opposition are vulgar, petty, deceitful, angry, and are not arguing their point in good faith.
cobby · 9 November 2008
.... Wayne, I read very little of your rants here.
Dave Lovell · 9 November 2008
Dave Lovell · 9 November 2008
cobby · 9 November 2008
Modern reptiles and mammals are both the result of millions of tiny changes from some common ancestor.
... any experiments backing this up? and predictions? falsification scenarios? nice hypothesis. but unfortunately cannot be validated.
Stanton · 9 November 2008
DS · 9 November 2008
Did mammals evolve from reptiles? Well let's see what predictions have been made:
Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia
A cladistic analysis of morphology should yield the same topology as the nested hierarchy produced on the genetic data
Reptiles and mammals should share common developmental pathways that are conserved in the early stages and more divergent in the later stages
There should be intermediate forms between reptiles and mammals in the fossil record including intermediate forms in the evolution of the three bones of the inner ear
That should do for now. There is strong evidence that is completely consistent with each of these predictions. Just go to talkorigins.org and search the archives if you want references. Each one of these prredictions, and dozens more, could have served to conclusively falsifiy the hypothesis, they just didn't. Historical reconstruction is not done by repeating the process in controlled conditions. Just watch CSI to see how the evidence is used to test hypotheses and reconstruct past events.
Of course the troll of many names did not learn anything past junior high, so obviously it is compeletely ignorant of all of this evidence. Oh well, if you don't understand cladistics, what can you expect?
Wayne Francis · 9 November 2008
cobby · 9 November 2008
... it is easy to get confirming predictions. where are the predictions to what we would see if the theory is NOT valid.
Did mammals evolve from reptiles? Well let’s see what predictions have been made:
Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia
.... genetic similarity?? thats a broad statemnet. express it in a way that can be test
A cladistic analysis of morphology should yield the same topology as the nested hierarchy produced on the genetic data
... same as above
Reptiles and mammals should share common developmental pathways that are conserved in the early stages and more divergent in the later stages
... ontog recaps philog?
There should be intermediate forms between reptiles and mammals in the fossil record including intermediate forms in the evolution of the three bones of the inner ear
.... the jaw bones became the middle ear?? any other evidence??
... would love to see some specific examples of your above vague generalizations
...OK if NS and common descent did not work would there be ANY humans according to your theory?
cobby · 9 November 2008
and have done nothing but antagonize us ever since you came here over 8 months ago?
.. i dont read posts from people that bother me. i think that would help you not get upset.
cobby · 9 November 2008
There should be intermediate forms between reptiles and mammals in the fossil record including intermediate forms in the evolution of the three bones of the inner ear
... if these forms were not found would that have falsified Darwinism?
cobby · 9 November 2008
Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia
... if reptiles and mammals have been individually created would they NOT have the same genetic material?
DS · 9 November 2008
TRANSLATION:
I DON'T UNDERSTSND ANY OF THEM BIG WORDS
JUMP MONKEY
BOW WOW
cobby · 9 November 2008
DS · 9 November 2008
Translation: Your answers have completely stumped me. Just like your questions about the protein bricks completely stumped me, just like your questions about the magic invisible hologram stumped me. All I can do is ask more inane questions and try to deflect the burden of proof once again. If that doesn't work, I'll just jump and scream and bark and hope that no one notices that I have no answers and no evidence at all. I'll complain about language and hurl personal insults and impotent threats trying to deflect attention away from the delusional claims that I have made and then denied making. I'll ask for more and more detail until everyone forgets what the original question was and that I was proven to be completely wrong months ago.
Oh yea, and everyone should notice that I never said anything whatsoever about natural selection, so if the troll tries to move the goalposts again, that won't work either. Maybe the troll will now offer to "walk thru" some more delusional crap and made up definitions. I'm going to try to care, but somehow I just don't think I''ll quite be able to do it.
PvM · 9 November 2008
Seems bobby has dumped yet another one of his claims and is moving on to more ignorance.
Fascinating
cobby · 9 November 2008
All I can do is ask more inane questions and try to deflect the burden of proof once again.
... burden of proof? I was told science does not 'prove anything.
cobby · 9 November 2008
Reptiles and mammals should share genetic similarity in a nested hierarchy with mammals nesting within the reptilia
… if reptiles and mammals have been individually created would they NOT have the same genetic material?
...... interesting: they do not have an answer to the above question so they feel if they call it 'innane' they can avoid answering it.
SWT · 9 November 2008
PvM · 9 November 2008
PvM · 9 November 2008
PvM · 9 November 2008
PvM · 9 November 2008
cobby · 9 November 2008
If reptiles and mammals had been individually created rather than resulting from common descent, genetic similarity would not necessarily be observed.
.... ok then genetic similarity is not a validation of Darwinism
PvM · 9 November 2008
cobby · 9 November 2008
Creation is an unconstrained explanation as it would both explain genetic similarity in a nested hierarchy as well as absence thereof.
... just as geocentrism and/or heliocentrism both would explain both the absence or presence of the planet jupiter.
PvM · 9 November 2008
PvM · 9 November 2008
cobby · 9 November 2008
Of course it is, for Darwinism, which is based on observable mechanisms, genetic similarity is a requirement.
.... then what EXACTLY would we see if genetic similarity did not exist in the animal kingdom. you have said Darwinism has made a prediction. so you must be saying if Darwinism were incorrect we would see WHAT in this area?
PvM · 9 November 2008
cobby · 9 November 2008
..... here is the error in their argument. they say that species were not individually created. they also say that it is possible if they were created there would be genetic similarities. but then they say validation that they were NOT created is a lack of genetic similarities. this simply is not logical.
PvM · 9 November 2008
PvM · 9 November 2008
Seems Bobby is confused about the following logic
1. Darwinian theory predicts genetic similarity
2. 'Creation' predicts absence or presence of genetic similarity since it is not constrained
Genetic similarity is found
1. thus is validated by the evidence 2. remains as uninteresting as a scientific explanation as ever.
Capisce?
PvM · 9 November 2008
cobby · 9 November 2008
Surely you must comprehend?
.... I comprehend however you seem confused. I guess you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity.
PvM · 9 November 2008
cobby · 9 November 2008
1.Existence of nested hierarchies 2.Existence of well conserved hox genes 3.(near) universal genetic code
.... again these are generalities
you need to give me an example of genetic similarity which to you supports Darwinism then give me an example of what we would see if there were no genetic similarity. SPECIFICALLY.
PvM · 9 November 2008
cobby · 9 November 2008
DS · 9 November 2008
The troll is simply assuming that in order to validate "Darwinism" one would have to disprove creationism. That of course is a logical fallacy, as PvM correctly points out.
If creationism predicts that no nested hierarchy of genetic similarities should be found, then creationism is conclusively falsified. If creationism makes no claims regarding genetic similaarity then creationism is unfalsifiable.
The theory of evolution predicts that a nested hierarchy of genetic similarity should be found, if it were not, then the theory of evolution would be falsified. However, a nested hierarchy is found and it corresponds precisely to the hierarchy produced by the morphological data and the fossil record. Who knows what it would look like if descent with modification were not true? What would it look like if there were no blue teapot in orbit around the moon? The troll of many names has still not learned anything in it's time her. It just keeps making the same mistakes over and over. More is the pity.
One could hypothesize about what one might observe if there were no nested hierarchy, depending on what alternative was proposed. For example, if an all powerful, omnipotent creator were to create every species fixed and perfect, then I guees that butterflies could be some random genetic distance from every other species and the distances would not correspond to any morphogical distance. So I guess one butterfly could be more closely related to spiders that to any other butterflies and another butterfly could be more closely related to a sponge than to any other insects, etc. I guess it would all be at the whim of the creator and so there need be no discernable pattern. Of course there is a pattern and there is no reason for an omnipotent creator to be constrained by such a pattern.
The troll cannot comprehend this because the explanation takes more than two lines and it has attention deficit disorder.
PvM · 9 November 2008
PvM · 9 November 2008
cobby · 9 November 2008
Creationism predicts little, while Darwinian theory predicts and retrodicts.
... yes of course Dism predicts just about everything. What does it say will not happen? you still have not answered the genetic similarity question.
DS · 9 November 2008
If the troll wants any more specific details, then perhaps it can give an example of what one would observe if the magic invisible hologram was responsible for development rather than morphogenic fields. Perhaps it could give a specific example of an observation tht would falsify it's nonsensical hypothesis. Perhaps it could give just one testable detail of the magic invisible hologram. Of wait, it claimed that it did not work in the dark. I guess that the hypothesis is conclusively falsified then.
PvM · 9 November 2008
PvM · 9 November 2008
PvM · 9 November 2008
Bobby's method of logic
Bobby: show me the evidence
Evidence is shown
Bobby: Show me the evidence
Evidence is shown again
Bobby: The evidence is wrong
Why
Bobby: Don't ask me such silly questions... It just is. Trust me...
cobby · 9 November 2008
For example, if an all powerful, omnipotent creator were to create every species fixed and perfect, then I guees that butterflies could be some random genetic distance from every other species and the distances would not correspond to any morphogical distance.
... you are using a strawman. the old 'creator must be perfect' trick.
..... are you saying that a less than perfect creator could not have used similar parts in similar animals? Is that not the way the 'creator' of automobiles has done. Fords and Chevys have similar parts. Does that show they were not created?
.... the point is that Darwinism is NOT validated because we observe genetic similarities. We would see those whether or not Dism is true or not. Just as we would see stars in the sky if heliocentrism was true or false
cobby · 9 November 2008
Creationism predicts little,
... ???
.... it predicts not complete common descent and lack of transitionals and sudden appearance of species, does it not??
cobby · 9 November 2008
cobby · 9 November 2008
Potential rejection: Lack of consistently nested phylogenies
... need specific example
PvM · 9 November 2008
PvM · 9 November 2008
DS · 9 November 2008
The question about genetic similarity was answered, multiple times. The questions about the magic invisible hologram were not. If the troll doesn't like the answers it can make up it's own.
The troll of many names is just using a strawman argument, the magic invisible creator could have made everything look exaclty like it would if evolution had actually happened. Not a very scientific explanation.
Creationism may or may not predict lack of common descent, lack of transitionals and sudden appearance of species. If it does, it is falsified. If it doesn't, it is unfalsifiable.
Now, how about those "bricks". Are enzymes just "bricks"? Are transcription factors just "bricks"? I sure hope it educated itself about these topics by now.
PvM · 9 November 2008
cobby · 9 November 2008
Fords and chevys do not form a nested hierarchy.
.... give an example of a 'nested hierarchy'
cobby · 9 November 2008
Creationism predicts little, while Darwinian theory predicts and retrodicts.
Creationism may or may not predict lack of common descent, lack of transitionals and sudden appearance of species. If it does, it is falsified. If it doesn’t, it is unfalsifiable.
... the 2 statements above seem to be contraditory.
.... anyhow has Creationism been proving wrong??
cobby · 9 November 2008
the magic invisible creator could have made everything look exaclty like it would if evolution had actually happened. Not a very scientific explanation.
.... i never said that. quit the lying. you deceitful troll
DS · 9 November 2008
So now we can add "nested hierarchy" to the list of things that the troll of many names does not understand. It should go look it up for itself.
If the troll wants to agrue about what creationism does or does not predict, it needs to pick one form of creationism and explain what it predicts and what it doesn't predict.
How about a specific example of a transcription factor that is a "brick"? Oh well, at least it has now stopped trying to claim that there is a magic invisible hologram. I guess it realizes that it is all morphogenic fields after all. Well that only took two months.
cobby · 9 November 2008
And what would disproof do for the concept of creation? Nothing really since it can accommodate lack or existence of any of the examples you mention.
.... has creationism been disproven??
cobby · 9 November 2008
DS · 9 November 2008
There it goes again. Trying to deny what it just posted for all to see. The magic invisible creator could have "used similar body parts in similar animals" but that doesn't mean that it created things to look exactly the same as they would if evolution was true. Right.
And the magic invisible hologram is just an analogy. Yea, an analogy that can't work in the dark! HA HA HA HA HA, very funny. When Wayne wakes up, I'm sure he will get a real kick out of the analogy excuse.
And yes, some forms of creationism have been conclusively falsified. That is why the rest of them are so reluctant to make any specific predictions. They don't know enough about the evidence to understand which claims have already been falsified and which claims will shortly be falsified by new evidence. Of course, the failure to make predictions removes them from the realm of science, hence the legal problems seen of late.
cobby · 9 November 2008
And yes, some forms of creationism have been conclusively falsified.
... like what liar?
cobby · 9 November 2008
DS · 9 November 2008
Well, it's losing the argument, so out come the impotent personal threats. Very childish.
Of course, what can your expect from someone who claims that morphogenic fields are only marginally effective at controlling development, then claims that magic invisible holograms are really responsible, then claims that they won't work in the dark, then claims that they are only an anology, then denies claiming that they don't exist. Priceless.
Stanton · 9 November 2008
Henry J · 9 November 2008
cobby · 9 November 2008
cobby · 9 November 2008
Malcolm · 9 November 2008
SWT · 9 November 2008
SWT · 9 November 2008
DS · 9 November 2008
HA HA HA, the troll of many names is complaining about someone else changing their handle. Of course the troll can call anyone it wants any time it wants, but if it does it will be in for a big surprise.
As for the accusation that I am lying about something, well anyone can read exactly where the troll said every one of those things. Perhaps Wayne can provide convenient links.
Now why do you suppose it tried to change the subject once again? Perhaps the troll would like to post it's mother's phone number.
Wayne Francis · 9 November 2008
PvM · 9 November 2008
PvM · 9 November 2008
PvM · 9 November 2008
PvM · 9 November 2008
PvM · 9 November 2008
Seems to me that Bobby's problem is that he is or has shown little familiarity with biological sciences, the scientific method and logic.
Too bad.
Wayne Francis · 9 November 2008
Stanton · 9 November 2008
Malcolm · 9 November 2008
cobby · 10 November 2008
Globin genes. They are literally a textbook example of gene duplication. The globins are a perfect example of a nested hierarchy. They also give a perfect example of something which you would not expect to see in creationism; pseudogenes.
.... wrong again!
cobby · 10 November 2008
Wayne Francis said:
I’m pretty sure SFB here has been told before that DS and David Stanton are 2 different people.
.... well lets ask him and see what he says
cobby · 10 November 2008
Have you called my current employer yet SFB? Seems you are having issues of threatening other people here.
.... tell me who your employer is. you say he knows you post here while you work so you should not be afraid. and you consider whistle blowing 'threats'? I think both you and Dave Stanton should be sanctioned for your unethical activities here.
Malcolm · 10 November 2008
Malcolm · 10 November 2008
cobby · 10 November 2008
cobby · 10 November 2008
Malcolm · 10 November 2008
cobby · 10 November 2008
Did I mention “literal textbook example”? If you knew anything about genetics, you would know about this. I’d point you to some papers on it, but what would be the point? You don’t read science papers.
.... yes and i could point you to many places etc, etc. but the point here is to explain your ideas in these boxes. anyone say 'its all out there' 'here is a link read it '
.... you have said 'pseudogenes prove my point' and i am saying 'no they dont' . but arguments have equal value.
Wayne Francis · 10 November 2008
Wayne Francis · 10 November 2008
Wayne Francis · 10 November 2008
cobby · 10 November 2008
Definition of a whistleblower
Most whistleblowers are internal whistleblowers, who report misconduct to a fellow employee or superior within their company. External whistleblowers, however, report misconduct to outside persons or entities. In these cases, depending on the information's severity and nature, whistleblowers may report the misconduct to lawyers, the media, law enforcement or watchdog agencies, or other local, state, or federal agencies.
... wrong again! look up qui tam. and if you are so sure of yourself tell me where you work and i will talk to them.
Dave Lovell · 10 November 2008
cobby · 10 November 2008
Wayne said:Whistle blowing is an employee reporting criminal activity within the company
.... where did he say that??
SWT · 10 November 2008
Stanton · 10 November 2008
Dan · 10 November 2008
PvM · 10 November 2008
PvM · 10 November 2008
Some questions Bobby has yet to address:
Prediction: Genetic similarity and nested hierarchies such as found in globins
Falsification: Lack of nested hierarchies or genetic similarities.
Assertion: Bobby: The claims at 29+ Evidences for Macroevolution The Scientific Case for Common Descent are in error.
Argument: Bobby has provided none.
Let's see if we can get Bobby to present some arguments to support his claims.
phantomreader42 · 10 November 2008
phantomreader42 · 10 November 2008
ben · 10 November 2008
I have an idea on how to deal with Bobby. Enforce his ban. Oh yeah, PT is run by spineless wimps who thrive on 90-page derailed comment threads, would rather snipe endlessly at ineducable trolls instead of maintain the slightest QC, and seem to be capable of being fooled innumerable times by idiots who post under slightly different names, I forgot. Nevermind.
PvM · 10 November 2008
Phantomreader, I believe that you are way out of line here...
PvM · 10 November 2008
Science Avenger · 10 November 2008
Then they are either masochists, have a really perverse sense of humor, or are completely disinterested in attracting new, intelligent readers.
SWT · 10 November 2008
Last I checked, PT contributors were all vertebrates.
... where is the evidence? Or do you just believe this on FAITH? This is a huge problem for Darwinism. I think you just googled this and are faking it.
PvM · 10 November 2008
phantomreader42 · 10 November 2008
Henry J · 10 November 2008
DS · 10 November 2008
Ben,
I would have to agree in this case. Not only that, but they allow those who have broken the rules to post personal threats and post what they believe is personal information about other posters without their permission. I can think of no justification for allowing this behavior.
Everyone knows that these particular threats are impotent, but that is not the issue. If the site refuses to moderate the thread then they invite all sorts of illegal activity and personal attacks. Why in the world would anyone want to post here if they thought that some mentally disturbed person would post personal information about them?
If this site wishes to be destroyed by the mentally challenged such as jacob/bobby/jobby/cobby/observer/goff then they are dong a great job of accomplishing their goal. 2700 off-topic posts and counting.
Malcolm · 10 November 2008
PvM · 10 November 2008
Wayne Francis · 10 November 2008
DS · 10 November 2008
Thanks PvM.
Malcolm · 10 November 2008